Multi-channel chained precise amplification biosensor and detection method
By modifying the working electrode array of the biosensor with dCas13a-crRNA complex and nanocomplex, the insufficient sensitivity and specificity of existing miRNA detection methods in multi-channel detection are solved, realizing efficient recognition and detection of multi-channel miRNAs, which has broad clinical application prospects.
Patent Information
- Application Number
- CN202511220956.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2025-11-28
AI Technical Summary
Existing miRNA detection methods suffer from insufficient sensitivity and specificity in multi-channel detection, making it difficult to efficiently identify multiple miRNA expression profiles associated with specific diseases.
A multi-channel chain amplification (CPA) biosensor was developed, which modifies the working electrode array with dCas13a-crRNA complex and [Ir(ppy)2(phen-NH2)]+@Au-dsDNA2@MoS2 nanocomplex to achieve simultaneous detection of multiple target miRNAs. The specific recognition of dCas13a-crRNA complex and photoelectric signal amplification of nanocomplex are utilized.
It achieves high sensitivity and specificity for the detection of multiple miRNAs, and can simultaneously detect multiple target miRNAs, significantly improving detection efficiency and making it suitable for clinical diagnosis.
Smart Images

Figure CN121027246A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biosensors, specifically relating to a multi-channel chain-type precision amplification biosensor and its detection method. Background Technology
[0002] miRNAs are a class of highly conserved small non-coding RNAs, typically composed of 18–23 nucleotides. Although miRNAs constitute only 1%–2% of the eukaryotic genome, they regulate the expression of approximately 30% of protein-coding genes. Recent studies have shown that miRNAs play crucial regulatory roles in various biological processes, such as individual development, organogenesis, hematopoiesis, antiviral responses, and lipid metabolism. Due to their complex and diverse functions, miRNAs are closely associated with a variety of diseases, including cancer, infectious diseases, immune diseases, cardiovascular diseases, and infertility. As potential biomarkers for disease diagnosis, miRNAs are receiving increasing attention, and their detection is of great significance for clinical applications.
[0003] Since many diseases (such as cancer and cardiovascular diseases) are closely related to the abnormal expression of various miRNAs, multichannel detection of miRNAs is of great value. Compared with single-channel detection methods, multichannel miRNA detection can more efficiently identify miRNA expression profiles associated with specific diseases. However, traditional miRNA detection methods have significant limitations. Although real-time quantitative polymerase chain reaction (RT-qPCR) exhibits excellent sensitivity and specificity, its multichannel detection capability is limited by the number of available fluorescent probes. Planar microarrays and northern blot techniques, while capable of simultaneously detecting multiple miRNAs, suffer from poor sensitivity and specificity. Recent miRNA detection technologies have achieved innovative breakthroughs in multiplex detection, but they still inevitably face similar limitations and challenges as traditional methods. Therefore, developing a multichannel miRNA detection method with high specificity and high sensitivity is crucial. Summary of the Invention
[0004] The present invention aims to at least solve one of the technical problems existing in the prior art. To this end, the present invention proposes a multi-channel chain-based precision amplification (CPA) biosensor with high channel capacity, capable of simultaneously detecting more target miRNAs by increasing the number of working electrodes, and exhibiting high specificity and sensitivity.
[0005] This invention also proposes a detection method for target miRNAs for purposes other than disease diagnosis and treatment using the aforementioned multi-channel CPA biosensor.
[0006] According to one aspect of the present invention, a multichannel CPA biosensor is provided, comprising a multichannel printed electrode, the multichannel printed electrode comprising a working electrode array, the working electrode array comprising a plurality of working electrodes; the surface of the working electrodes is modified with a dCas13a-crRNA complex, wherein the crRNA in the dCas13a-crRNA complex can specifically recognize target miRNA. It also includes [Ir(ppy)2(phen-NH2)] + The @Au-dsDNA2@MoS2 nanocomposite is constructed via [Ir(ppy)2(phen-NH2)]. + It binds to the double strand formed by the target miRNA and crRNA and to dsDNA1 linked to the 3' end of the target miRNA to achieve photoelectric signal amplification.
[0007] According to a preferred embodiment of the present invention, at least the following beneficial effects are achieved: Under the control of a multi-channel electrochemical workstation, multiple working electrodes can operate simultaneously, enabling the synchronous detection of mixtures containing various target miRNAs. Traditional multi-miRNA target detection systems mainly include RT-qPCR, northern blot, and planar microarrays. Compared with RT-qPCR, the biosensor proposed in this invention has significant advantages: its detection requires no amplification step, and it has a higher channel capacity, allowing for the simultaneous detection of more targets by simply increasing the number of working electrodes; while the channel capacity of RT-qPCR is limited by the types of available fluorescent probes. Compared with northern blot and planar microarrays, this biosensor also has advantages in sensitivity and specificity. Furthermore, compared with emerging multi-miRNA target detection systems in recent years, this biosensor also exhibits a higher level of sensitivity.
[0008] In some embodiments of the present invention, the working electrode array includes four working electrodes.
[0009] In some embodiments of the present invention, the substrate material of the working electrode is selected from at least one of carboxylated vertical graphene oxide (GO), carbon nanotubes, and graphene derivatives.
[0010] In some preferred embodiments of the present invention, the substrate material of the working electrode is carboxylated vertical GO.
[0011] Specifically, the substrate material of the aforementioned working electrode is a conductive material.
[0012] In some embodiments of the present invention, the modification process of the working electrode includes the following steps: S1: The substrate material of the working electrode is fixed to the working electrode area of the multi-channel printed electrode using conductive ink to obtain the working electrode array; S2: Immobilize dCas13a on the surface of each working electrode, and after sealing, incubate with crRNA to form the dCas13a-crRNA complex.
[0013] In some embodiments of the present invention, the concentration of dCas13a in step S2 is 1~1.2 μM, and the concentration of crRNA is 10~12 μM.
[0014] In one embodiment, after adding the dCas13a to the surface of each working electrode in step S2, the electrode is incubated at 36-38°C for 1-1.5 h; then, 1-1.2% bovine serum albumin (BSA) is added and the electrode is incubated at 36-38°C for 8-12 min for blocking; finally, the crRNA is added and the electrode is incubated at 36-38°C for 50-70 min to form the dCas13a-crRNA complex.
[0015] In one embodiment, when the substrate material of the working electrode is carboxylated vertical GO, before fixing the dCas13a, a step of activating the carboxyl groups is further included, specifically as follows: the carboxyl groups of the carboxylated vertical GO are activated with 1-ethyl-3-(3-dimethylaminopropyl)carbodiimide / N-hydroxysuccinimide (EDC / NHS).
[0016] Specifically, the steps for activating the carboxyl group are as follows: 2-(N-morpholino)ethanesulfonic acid (MES) buffer containing 18-22 mM EDC and 8-12 mM NHS is dropped onto the surface of each working electrode, and the electrode is incubated for 50-70 min to activate the carboxyl group.
[0017] In some embodiments of the present invention, the multichannel printed electrode further includes a reference electrode and a counter electrode.
[0018] Specifically, the material of the reference electrode is selected from either silver / silver chloride (Ag / AgCl) or mercury / mercury oxide.
[0019] Specifically, the counter electrode material is selected from at least one of silver, platinum, graphite rod, carbon cloth, carbon paper, gold, and stainless steel.
[0020] In some embodiments of the present invention, the [Ir(ppy)2(phen-NH2)] + The @Au-dsDNA2@MoS2 nanocomposite is composed of [Ir(ppy)2(phen-NH2)]. + The @ssDNA3@MoS2 nanocomposite is formed by base complementary pairing with the Au-ssDNA4 probe.
[0021] In some embodiments of the present invention, the [Ir(ppy)2(phen-NH2)] + The preparation method of @ssDNA3@MoS2 nanocomposites includes the following steps: mixing carboxylated MoS2 quantum dots (Quantum Dot, QD) with 5'-amino-modified ssDNA3 and [Ir(ppy)2(phen-NH2)]. + PF6 - The mixture was reacted and purified to obtain the [Ir(ppy)2(phen-NH2)] + @ssDNA3@MoS2 nanocomposite.
[0022] Specifically, the carboxylated MoS2 QD is activated with EDC / NHS before mixing.
[0023] Specifically, the carboxyl group modified on MoS2 QD is activated using EDC / NHS.
[0024] Specifically, 0.4–0.6 mg / mL of the carboxylated MoS2 QD was added to a MES buffer containing 18–22 mM EDC and 8–12 mM NHS, and incubated for 60–70 min to activate the carboxylated MoS2 QD.
[0025] Specifically, 0.4–0.6 mg / mL of the activated carboxylated MoS2 QD is mixed with 90–110 μM of 5'-amino-modified ssDNA3 and 1.0–1.2 mM of [Ir(ppy)2(phen-NH2)]. + PF6 - The mixture was reacted with 100–120 mM borate buffer at pH 9.0–9.2 for 1.5–2.5 h; then centrifuged at 7000–9000 rpm for 18–22 min at 4–6 °C, the precipitate was resuspended and washed to obtain [Ir(ppy)2(phen-NH2)]. +@ssDNA3@MoS2 nanocomposite.
[0026] In some embodiments of the present invention, the preparation method of the Au-ssDNA4 probe includes the following steps: mixing 5'-thiol-modified ssDNA4 with gold nanoparticles, allowing it to stand at -18 to -20°C for 2 to 2.5 h, and then purifying to obtain the Au-ssDNA4 probe.
[0027] Specifically, 95-105 μM of 5'-thiol-modified ssDNA4 was mixed with gold nanoparticles with a diameter of 12-18 nm, and the mixture was allowed to stand at -18 to -20 °C for 2-2.5 h before thawing. Then, the mixture was centrifuged at 11,000-13,000 rpm for 18-22 min, and the precipitate was washed to obtain the Au-ssDNA4 probe.
[0028] According to a second aspect of the present invention, a method for detecting target miRNAs using the above-described multichannel CPA biosensor for purposes other than disease diagnosis or treatment is provided, comprising the following steps: A1: The sample to be tested is mixed with a DNA linker and then incubated with the working electrode of the multichannel CPA biosensor; the DNA linker is used to attach to the 3' end of the target miRNA in the sample to be tested; A2: Incubate dsDNA1, formed from ssDNA1 and ssDNA2, with the working electrode after step A1; the dsDNA1 is used to ligate to the DNA adapter via base complementary pairing. A3: [Ir(ppy)2(phen-NH2)] + The @Au-dsDNA2@MoS2 nanocomposite was incubated with the working electrode treated in step A2, and the photocurrent signal was detected. If the photocurrent signal in step A3 increases, the target miRNA is present in the sample to be tested; if the photocurrent signal in step A3 remains unchanged, the target miRNA is not present in the sample to be tested.
[0029] In some embodiments of the present invention, the incubation time in step A1 is 25 to 35 minutes.
[0030] In some embodiments of the present invention, one end of the DNA adapter is connected to the 3' end of the target miRNA in the sample to be tested, and the other end is connected to the dsDNA1.
[0031] In some embodiments of the present invention, the ssDNA1 and the ssDNA2 form the dsDNA1 through base complementary pairing.
[0032] In some embodiments of the present invention, in step A2, the concentration of ssDNA1 is 8-12 μM and the concentration of ssDNA2 is 8-12 μM.
[0033] In some embodiments of the present invention, the incubation time in step A2 is 25 to 35 minutes.
[0034] In some embodiments of the present invention, the incubation time in step A3 is 25 to 35 minutes.
[0035] In some embodiments of the present invention, step A3 first involves [Ir(ppy)2(phen-NH2)] + The @ssDNA3@MoS2 nanocomposite was incubated with the working electrode treated in step A2; then the Au-ssDNA4 probe was incubated with the working electrode treated above, and the photocurrent signal was detected.
[0036] Specifically, the incubation time for both incubation periods was 25-35 minutes.
[0037] In some embodiments of the present invention, the photocurrent signal in step A3 is irradiated by a light source with a wavelength of 450~470 nm for 15~25 s on-off cycles, and a working voltage of 0.2~0.4 V is applied for detection.
[0038] Specifically, if the target miRNA is present in the sample to be tested, the dCas13a-crRNA complex modified on the multichannel CPA biosensor can capture the miRNA, forming a dCas13a-crRNA-miRNA-DNA linker complex (compared to the photocurrent signal of the multichannel CPA biosensor itself, the photocurrent signal is further reduced at this point because the dCas13a-crRNA complex captures the miRNA-DNA linker strand, further reducing the conductivity of the working electrode and increasing the steric hindrance); subsequently, dsDNA1 ligates to the DNA adapter (the photocurrent signal decreases again at this point because the binding of dsDNA1 further weakens the conductivity of the working electrode and increases the steric hindrance). Next, [Ir(ppy)2(phen-NH2)] + The @ssDNA3@MoS2 nanocomposite and the Au-ssDNA4 probe were sequentially modified onto the working electrode (introducing [Ir(ppy)2(phen-NH2)) +The photocurrent signal was significantly enhanced after the introduction of the @ssDNA3@MoS2 nanocomposite, which is attributed to the excellent photoelectric response performance of the nanocomposite and its binding ability to crRNA-miRNA double strands and dsDNA1. The photocurrent signal was further significantly enhanced after the introduction of the Au-ssDNA4 probe, due to the probe's binding to [Ir(ppy)2(phen-NH2)]. + The @ssDNA3@MoS2 nanocomplex binds to form [Ir(ppy)2(phen-NH2)] + @Au-dsDNA2@MoS2 nanocomposite), ultimately [Ir(ppy)2(phen-NH2)] + The @Au-dsDNA2@MoS2 nanocomplexes are anchored to the crRNA-miRNA double strand and dsDNA1. Since multiple nanocomplexes can bind to a single nucleic acid double strand, the recognition of the target miRNA is efficiently converted into a valuable photocurrent response signal. This multichannel CPA biosensor provides a highly specific and sensitive innovative approach for the simultaneous detection of multiple miRNAs, and has broad application prospects in clinical diagnostics. Attached Figure Description
[0039] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 This is a schematic diagram of the pretreatment process before detecting miRNA using the multi-channel CPA biosensor of this invention; Figure 2 This is a schematic diagram illustrating the mechanism by which the CPA of the multichannel biosensor of the present invention recognizes miRNA. Figure 3 This is a graph showing the photocurrent response test results during the assembly process of the multi-channel CPA biosensor in Example 1 of the present invention; where a-GO; b-dCas13a / GO; c-BSA / dCas13a / GO; d-BSA / dCas13a-crRNA / GO; e-miRNA-21-DNA linker / BSA / dCas13a-crRNA / GO; f-dsDNA1 / miRNA-21-DNA linker / BSA / dCas13a-crRNA / GO; g-[Ir(ppy)2(phen-NH2)] + @ssDNA3@MoS2 / dsDNA1 / miRNA-21-DNA linker / BSA / dCas13a-crRNA / GO; h-[Ir(ppy)2(phen-NH2)] +@Au-dsDNA2@MoS2 / dsDNA1 / miRNA-21-DNAlinker / BSA / dCas13a-crRNA / GO; Figure 4 The graph shows the photocurrent response of the multi-channel CPA biosensor in Example 2 of this invention to different concentrations of (A) miRNA-21, (B) miRNA-29a, (C) miRNA-29b, and (D) miRNA-29c; where a-0; b-1 aM; c-10aM; d-100 aM; e-1 fM; f-10 fM; g-100 fM; Figure 5 The graph shows the correlation analysis results between ΔI and the logarithmic concentrations of (A) miRNA-21, (B) miRNA-29a, (C) miRNA-29b and (D) miRNA-29c in Example 2 of the present invention. Figure 6 This is a graph showing the specificity analysis results of the multi-channel CPA biosensor in Example 3 of the present invention; Figure 7 The photocurrent stability of the multi-channel CPA biosensor in channels (A) miRNA-21, (B) miRNA-29a, (C) miRNA-29b and (D) miRNA-29c under 10 consecutive "off-on-off" irradiation cycles in Example 4 of the present invention. Figure 8 The image shows the photocurrent response results of the multi-channel CPA biosensor on channels (A) miRNA-21, (B) miRNA-29a, (C) miRNA-29b and (D) miRNA-29c after different storage times in Example 4 of the present invention. Figure 9 The graph shows the repeatability test results of the multi-channel CPA biosensor in Example 5 of the present invention on channels (A) miRNA-21, (B) miRNA-29a, (C) miRNA-29b and (D) miRNA-29c. Figure 10 This is a diagram showing the results of analyzing miRNAs in pleural effusion using (A) a multi-channel CPA biosensor and (B) RT-qPCR in Example 6 of the present invention. Detailed Implementation
[0040] The following will describe the concept and technical effects of the present invention clearly and completely with reference to the embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, not all of them. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention. Unless otherwise specified, the experimental methods used in the embodiments are conventional methods; the materials and reagents used, unless otherwise specified, are commercially available.
[0041] The detection principle of the biosensor provided by this invention: This invention develops a biosensor based on the dCas13a system and the Ir complex ([Ir(ppy)2(phen-NH2)]). + This multi-channel CPA biosensor is used for the simultaneous detection of multiple miRNAs. CPA stands for chain, precision, and amplification. "Chain" refers to the long double-stranded nucleic acid chain composed of a miRNA-crRNA double strand and a double-stranded DNA (dsDNA1) linked to the 3' end of the miRNA; "precision" refers to the precise recognition of the target miRNA by the dCas13a-crRNA complex; and "amplification" refers to the conversion of the recognition information into a significant photocurrent signal through a large number of nanocomplexes linked to the long double-stranded nucleic acid chain. Figure 1 As shown, this biosensor is constructed using multichannel printed electrodes (SPEs), with multiple working electrodes mounted on conductive substrates. Each working electrode substrate is functionalized with a dCas13a-crRNA complex that recognizes the corresponding miRNA. Furthermore, an Ir complex (iridium complex, [Ir(ppy)2(phen-NH2)] is used. + Gold nanoparticles were functionalized on the surface of MoS2 QD to construct [Ir(ppy)2(phen-NH2)] + The @Au-dsDNA2@MoS2 nanocomposite is used for photoelectric conversion. Before detection, a DNA linker is attached to the 3' end of the miRNA, and ssDNA1 and ssDNA2 are designed to co-form dsDNA1. In the presence of the target miRNA, the corresponding dCas13a-crRNA complex can capture the miRNA, forming a dCas13a-crRNA-miRNA-DNA linker complex, after which dsDNA1 ligates to the DNA linker. Next, [Ir(ppy)2(phen-NH2)] +The @ssDNA3@MoS2 nanocomposite and Au-ssDNA4 probe were sequentially modified onto the working electrode, ultimately resulting in [Ir(ppy)2(phen-NH2)]. + The @Au-dsDNA2@MoS2 nanocomplexes are anchored to both crRNA-miRNA double strands and dsDNA. Because multiple nanocomplexes can bind to a single nucleic acid double strand, the recognition of the target miRNA is efficiently converted into a valuable photocurrent response signal (e.g., Figure 2 (As shown). This multichannel CPA biosensor provides a highly specific and sensitive innovative approach for the simultaneous detection of multiple miRNAs, and has broad application prospects in clinical diagnosis.
[0042] The following examples illustrate this in detail.
[0043] Example 1 This embodiment assembles a multi-channel CPA biosensor for detecting miRNAs. The biosensor includes a multi-channel printed electrode array comprising four working electrodes. The substrate material for the working electrodes is carboxylated vertical GO, the reference electrode is Ag / AgCl, and the counter electrode is silver. This biosensor is used to detect aberrantly expressed miRNA-21 and miRNA-29a / b / c in non-small cell lung cancer (NSCLC). The specific process is as follows: (1) A carboxylated vertical GO film (2 mm in diameter) was fixed to the working electrode area with conductive ink and then air-dried to obtain a GO electrode array.
[0044] (2) Subsequently, 5 μL of MES buffer containing 10 mM NHS and 20 mM EDC was dropped onto the surface of each GO electrode and incubated at room temperature for 60 min to activate the carboxyl group.
[0045] (3) After rinsing with phosphate-buffered saline (PBS), add 5 μL of 1 μM dCas13a solution (dissolved in PBS buffer) to the surface of each activated electrode and incubate at 37°C for 1 h.
[0046] (4) After rinsing with PBS buffer again, 5 μL of 1% BSA solution (dissolved in PBS buffer) was added to the surface of each modified dCas13a GO electrode and incubated at 37°C for 10 min to block non-specific active sites.
[0047] (5) Then rinse with 2 mM MgCl2 solution, and then add 5 μL of 10 μM crRNA solution (dissolved in 2 mM MgCl2) to the surface of each obtained BSA / dCas13a / GO electrode. The nucleic acid sequence of crRNA-21 is shown in SEQ ID NO:1: GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUCAACAUCAGUCUGAUAAGCUA; the nucleic acid sequence of crRNA-29a is shown in SEQ ID NO:2: GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUAACCGAUUUCAGAUGGUGCUA; the nucleic acid sequence of crRNA-29b is shown in SEQ ID NO:3: GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACAACACUGAUUUCAAAUGGUGCUA; the nucleic acid sequence of crRNA29c is shown in SEQ ID NO:3. NO:4: GGGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACUAACCGAUUUCAAAUGGUGCUA (as shown), incubated at 37℃ for 60 min to form the dCas13a-crRNA complex. Finally, the obtained BSA / dCas13a-crRNA / GO electrode array was washed with 2 mM MgCl2, thus completing the assembly of the multi-channel CPA photoelectrochemical biosensor.
[0048] To characterize the various stages of biosensor assembly, its photocurrent response was measured, and the results are as follows: Figure 3 As shown, the miRNA-21 channel is used as an example. Initially, the carboxylated vertical GO electrode exhibits a strong photocurrent response (curve a), attributed to the excellent photoelectric properties of graphene. Subsequently, with the gradual introduction of dCas13a, BSA, and crRNA, the photocurrent signal gradually weakens (corresponding to curves b, c, and d, respectively), due to the low conductivity of these molecules on the electrode surface and the significant steric hindrance they cause. Upon incubation with the miRNA-DNA linker strand, the photocurrent response further decreases (curve e) because the dCas13a-crRNA complex captures the miRNA-DNA linker strand, further reducing the electrode's conductivity and increasing steric hindrance. Following incubation with dsDNA1, the photocurrent decreases again (curve f), because the binding of dsDNA1 further weakens the electrode's conductivity and increases steric hindrance. Next, [Ir(ppy)2(phen-NH2)] is introduced. +The photocurrent was significantly enhanced after incubation with the @ssDNA3@MoS2 nanocomposite (curve g), which is attributed to the excellent photoelectric response properties of the nanocomposite and its binding ability to crRNA-miRNA double strands and dsDNA1. Finally, the photocurrent was further significantly enhanced after incubation with the Au-ssDNA4 probe (curve h), this enhancement being due to the binding of the Au-ssDNA4 probe to [Ir(ppy)2(phen-NH2)]. + The @ssDNA3@MoS2 nanocomplex binds to form [Ir(ppy)2(phen-NH2)] + The @Au-dsDNA2@MoS2 nanocomposite. In summary, the photoelectrochemical characterization analysis successfully validated the construction process of the multi-channel CPA biosensor.
[0049] Example 2 This embodiment tested the sensitivity of the multi-channel CPA biosensor in Example 1. The specific process is as follows: The potential of the multichannel CPA biosensor assembled in Example 1 for detecting miRNA was explored under the constructed experimental conditions. The detection principle and procedure are as follows: Figure 1 and Figure 2 As shown.
[0050] The 3' end of miRNA was ligated to a DNA adapter using a Small RNA 3'-Linker (5' end adenylated, 3' end blocked) and a ligase kit. The 100 μL reaction mixture consisted of: 12.75 μL of RNA, 7.25 μL of a universal miRNA cloning adapter (6.9 μM, sequence 5'-rAppCTGTAGGCACCATCAAT (SEQ ID NO:5)-NH2-3'), 60 µL of PEG8000 (50%, RNase-free), 10 µL of 10× T4 Rnl2 (truncated) buffer, 5 µL of an RNase inhibitor (40 U / μL), and 5 µL of T4 RNA ligase 2 (truncated). The mixture was incubated at 25 °C for 60 min, followed by heating at 65 °C for 20 min. The reaction mixture was then thoroughly mixed with 300 µL of PBS buffer and dropped onto the electrode surface, incubated at room temperature for 30 min, and then the electrode surface was rinsed with PBS buffer.
[0051] To prepare the dsDNA1 fragment, 10 µL of ssDNA1 (10 µM, nucleic acid sequence as shown in SEQ ID NO:6: AACTGGAAAGATTGCTGATTATAATTATAAATTACCAGATGATTTTACAGGCTGCGTTATAGCTTGGAATTCTAACAATCTTGATTCTAAGGTTGGTGGTAATTATAATTACCTGTATAGATTGTTTAGGAAGTCTAATCTCAAACCTTTTGAGAGAGATATTTCAACTGAAATCTATCAGGCCGGTAGCACACCTTGTAATTGATGGTGCCTACAG) was mixed with 10 µL of ssDNA2 (10 µM, nucleic acid sequence as shown in SEQ ID NO:6). NO:7: TACAAGGTGTGCTACCGGCCTGATAGATTTCAGTTGAAATATCTCTCTCAAAAGGTTTGAGATTAGACTTCCTAAACAATCTATACAGGTAATTATAATTACCACCAACCTTAGAATCAAGATTGTTAGAATTCCAAGCTATAACGCAGCCTGTAAAATCATCTGGTAATTTATAATTATAATCAGCAATCTTTCCAGTT (as shown) was added to 380 µL of PBS buffer and incubated at room temperature for 15 min. The solution was then dropped onto the electrode surface and incubated at room temperature for 30 min, allowing the dsDNA1 fragment to bind to the 3' DNA linker of the target miRNA through base complementarity pairing. Afterward, the electrode surface was rinsed with PBS buffer. Next, 400 µL of [Ir(ppy)2(phen-NH2)] was added to the electrode surface. + @ssDNA3@MoS2 nanocomposite solution [Preparation method: Take 100 μL of 0.5 mg / mL carboxylated MoS2 QD suspension and add it to 900 μL of MES buffer containing 20 mM EDC and 10 mM NHS. Incubate at room temperature for 1 h to activate the carboxyl groups. After activation, add 5 μL of 5'-amino-modified ssDNA3 (100 μM), 120 μL of borate buffer (100 mM, pH 9.0), and 90 μL of [Ir(ppy)2(phen-NH2)] to the reaction system. + PF6 -The solution (1.0 mM, dissolved in dimethylformamide) was shaken and reacted for 2 h. After the reaction, the mixture was centrifuged at 8000 rpm for 20 min at 4°C, the supernatant was discarded, and the solution was resuspended in Tris-HCl buffer (25 mM, containing 150 mM NaCl, pH 7.4), and washed three times. The resulting [Ir(ppy)2(phen-NH2)] was then... + The @ssDNA3@MoS2 nanocomposite was dispersed in 400 μL Tris-HCl buffer and incubated at room temperature for 30 min, followed by rinsing with PBS buffer. Then, 400 µL of Au-ssDNA4 probe [Preparation method: 5 μL of 100 μM 5'-thiol-modified ssDNA4 solution was added to 100 μL of 15 nm diameter gold nanoparticle solution, and the mixture was gently vortexed. The mixture was stored at −20 °C for 2 h, then thawed at room temperature. It was then centrifuged at 12000 rpm for 20 min, the supernatant was discarded, and the precipitate was washed three times with PBS buffer to remove unbound free ssDNA4. Finally, the obtained Au-ssDNA4 probe was resuspended in 400 μL PBS and incubated at room temperature for 30 min, followed by rinsing again with PBS buffer.] Finally, photoelectrochemical detection was performed at room temperature using a PBS buffer containing 0.1 M triethanolamine and 0.1 M KCl as the electrolyte. A 460 nm LED lamp was used as the light source during the detection process, with a 20-second alternating light and dark cycle, and an applied potential of 0.3 V was maintained throughout the experiment.
[0052] Based on the detection method of this embodiment, the sensitivity of the biosensor was tested. The photocurrent of the multi-channel CPA biosensor showed a significant positive correlation with the miRNA concentration. (See time-photocurrent curves). Figure 4 The results showed that the photocurrent gradually increased with increasing miRNA concentration. The change in photocurrent ΔI (ΔI = I - I0, where I is the photocurrent in the presence of the target miRNA and I0 is the photocurrent in the absence of the target miRNA) showed a good linear relationship with the logarithm of the miRNA concentration in the range of 1 aM to 100 fM (see [reference]). Figure 5 The linear regression equations for miRNA-21, miRNA-29a, miRNA-29b, and miRNA-29c are as follows: ΔI(miRNA-21) = 26.59LogC(miRNA-21) + 504.89 ΔI(miRNA-29a) = 26.81LogC(miRNA-29a) + 508.34 ΔI(miRNA-29b) = 26.34LogC(miRNA-29b) + 499.11 ΔI(miRNA-29c) = 26.03LogC(miRNA-29c) + 495.50 Based on the 3σ / k formula (where σ is the standard deviation of the blank signal and k is the slope of the calibration curve), the detection limits for miRNA-21, miRNA-29a, miRNA-29b, and miRNA-29c are 0.14, 0.17, 0.20, and 0.13 aM, respectively. This sensor exhibits significantly higher sensitivity than traditional methods such as RT-qPCR, northern blot, and planar microarrays. Furthermore, even compared to advanced detection technologies of recent years, this sensor demonstrates superior sensitivity, highlighting its significant technological advantages.
[0053] Example 3 This embodiment tested the specificity of the multi-channel CPA biosensor in Example 1. The specific process is as follows: Excellent specificity is an essential requirement for practical biosensors. Based on the biosensor assembled in Example 1 and the detection method in Example 2, its detection capabilities for miRNA-21, miRNA-29a / b / c, and mixtures thereof were tested. Figure 6 As shown, the miRNA-21 channel exhibited a significant photocurrent response in the presence of miRNA-21, while the response of miRNA-29a / b / c was comparable to the blank control; similar results were obtained in the miRNA-29a / b / c channels. Furthermore, the sensor's ability to recognize single-base, double-base, and triple-base mismatches was evaluated. Compared to the target miRNA sequence, these mismatched sequences did not elicit a significant photocurrent response, and their signals were close to the blank control. These results confirm that this multi-channel CPA biosensor possesses excellent specificity, even capable of precisely distinguishing single-base differences. The nucleic acid sequences of the aforementioned miRNAs are as follows: miRNA-21, the nucleic acid sequence of which is shown in SEQ ID NO:8: UAGCUUAUCAGACUGAUGUUGA; miRNA-21 (single base mismatch), nucleic acid sequence as shown in SEQ ID NO:9: UAGCUUAUCAUACUGAUGUUGA; miRNA-21 (double base mismatch), nucleic acid sequence as shown in SEQ ID NO:10: UAGCGUAUCAUACUGAUGUUGA; miRNA-21 (triple mismatch), nucleic acid sequence as shown in SEQ ID NO:11: UAGCGUAUCAUACUGCUGUUGA; miRNA-29a, the nucleic acid sequence of which is shown in SEQ ID NO:12: UAGCCACCAUCUGAAAUCGGUUA; miRNA-29a (single base mismatch), nucleic acid sequence as shown in SEQ ID NO:13: UAGCCACCAUCGGAAAUCGGUUA; miRNA-29a (double base mismatch), nucleic acid sequence as shown in SEQ ID NO:14: UAGUCCAUCGGAAAUCGGUUA; miRNA-29a (triple mismatch), nucleic acid sequence as shown in SEQ ID NO:15: UAGUCCAUCGGAAACCGGUUA; miRNA-29b, the nucleic acid sequence of which is shown in SEQ ID NO:16: UAGACCAUUUGAAAUCAGUGUU; miRNA-29b (single base mismatch), nucleic acid sequence as shown in SEQ ID NO:17: UAGCCACCAUUCGAAAUCAGUGUU; miRNA-29b (double base mismatch), nucleic acid sequence as shown in SEQ ID NO:18: UAGCGCCAUUCGAAAUCAGUGUU; miRNA-29b (triple mismatch), nucleic acid sequence as shown in SEQ ID NO:19: UAGCGCCAUUCGAAAGCAGUGUU; miRNA-29c, nucleic acid sequence as shown in SEQ ID NO:20: UAGCCACCAUUUGAAAUCGGUUA; miRNA-29c (single base mismatch), nucleic acid sequence as shown in SEQ ID NO:21: UAGCCACCAUUAGAAAUCGGUUA; miRNA-29c (double base mismatch), nucleic acid sequence as shown in SEQ ID NO:22: UAGCUCCAUUAGAAAUCGGUUA; miRNA-29c (triple mismatch), nucleic acid sequence as shown in SEQ ID NO:23: UAGCUCCAUUAGAAACCGGUUA.
[0054] Example 4 This embodiment tested the stability of the multi-channel CPA biosensor in Example 1. The specific process is as follows: The signal stability of the multi-channel CPA biosensor assembled in Example 1 and the detection method in Example 2 were investigated. During 10 light-on / off cycles over 200 s, the photocurrent response remained consistent. The relative standard deviations (RSDs) of the miRNA-21, miRNA-29a, miRNA-29b, and miRNA-29c channels were 0.55%, 0.57%, 0.47%, and 0.38%, respectively, indicating that the sensor exhibits good signal stability. Figure 7 To further evaluate the stability of this biosensor, a four-week storage test was conducted. After two weeks of storage at 4°C, the photocurrent response of the four channels of the sensor remained at an average of 92.53% of the initial value, demonstrating excellent storage stability. Figure 8 ).
[0055] Example 5 This embodiment tested the reproducibility of the multi-channel CPA biosensor in Example 1. The specific process is as follows: Based on the multi-channel CPA biosensor assembled in Example 1 and the detection method in Example 2, the photocurrents of six multi-channel CPA biosensors assembled in the same batch were compared to conduct a reproducibility study of the biosensors. Figure 9 The results showed that the photocurrent variation in the four channels was minimal, with RSD values ranging from 0.89% to 1.73%, highlighting the high repeatability of the biosensor.
[0056] Example 6 This embodiment utilizes the multi-channel CPA biosensor from Example 1 to detect miRNA in clinical samples. The specific process is as follows: To evaluate the applicability of the proposed multichannel CPA biosensor for detecting miRNAs in clinical samples, pleural effusion samples from NSCLC patients and healthy individuals were used. The clinical samples were tested using the multichannel CPA biosensor prepared in Example 1. The recoveries of various miRNAs in these samples were determined using a standard addition method. The recoveries of miRNA-21, miRNA-29a, miRNA-29b, and miRNA-29c were 96.27%–102.80%, 93.93%–101.40%, 93.20%–98.01%, and 96.60%–103.02%, respectively, with RSDs all less than or equal to 4.62%. These results indicate that the multichannel CPA biosensor has high accuracy in detecting target miRNAs in pleural effusion. Subsequently, this biosensor was used for clinical diagnostics. Figure 10As shown in Figure A, compared to the healthy control group, the level of miRNA-21 in the pleural effusion of NSCLC patients was significantly increased, while the levels of miRNA-29a / b / c were significantly decreased. Furthermore, the RT-qPCR analysis results were highly consistent with the detection results of the multi-channel CPA biosensor. Figure 10 (B), further verifying the reliability of the sensor in accurately analyzing miRNAs in clinical samples.
[0057] The embodiments of the present invention have been described in detail above. However, the present invention is not limited to the above embodiments. Within the scope of knowledge possessed by those skilled in the art, various changes can be made without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.
Claims
1. A multi-channel CPA biosensor, characterized in that, The multi-channel CPA biosensor includes a multi-channel printed electrode, which includes a working electrode array, and the working electrode array includes a plurality of working electrodes; the surface of the working electrodes is modified with a dCas13a-crRNA complex, and the crRNA in the dCas13a-crRNA complex can specifically recognize target miRNA. It also includes [Ir(ppy)2(phen-NH2)] + The @Au-dsDNA2@MoS2 nanocomposite is constructed via [Ir(ppy)2(phen-NH2)]. + It binds to the double strand formed by the target miRNA and crRNA and to dsDNA1 linked to the 3' end of the target miRNA to achieve photoelectric signal amplification.
2. The multi-channel CPA biosensor according to claim 1, characterized in that, The substrate material of the working electrode is selected from at least one of carboxylated vertical GO, carbon nanotubes, and graphene derivatives.
3. The multi-channel CPA biosensor according to claim 1, characterized in that, The modification process of the working electrode includes the following steps: S1: The substrate material of the working electrode is fixed to the working electrode area of the multi-channel printed electrode using conductive ink to obtain the working electrode array; S2: Immobilize dCas13a on the surface of each working electrode, seal it, and incubate it with crRNA to form the dCas13a-crRNA complex; Preferably, the concentration of dCas13a in step S2 is 1~1.2 μM, and the concentration of crRNA is 10~12 μM.
4. The multi-channel CPA biosensor according to claim 1, characterized in that, The multi-channel printed electrode also includes a reference electrode and a counter electrode; The material of the reference electrode is selected from either silver / silver chloride or mercury / mercury oxide. The material of the counter electrode is selected from at least one of silver, platinum, graphite rod, carbon cloth, carbon paper, gold, and stainless steel.
5. The multi-channel CPA biosensor according to claim 1, characterized in that, The [Ir(ppy)2(phen-NH2)] + The @Au-dsDNA2@MoS2 nanocomposite is composed of [Ir(ppy)2(phen-NH2)]. + The @ssDNA3@MoS2 nanocomposite was formed by base complementary pairing with the Au-ssDNA4 probe; Preferably, the [Ir(ppy)2(phen-NH2)] + The preparation method of @ssDNA3@MoS2 nanocomposites includes the following steps: carboxylated MoS2 QD is combined with 5'-amino-modified ssDNA3 and [Ir(ppy)2(phen-NH2)]. + PF6 - The mixture was reacted and purified to obtain the [Ir(ppy)2(phen-NH2)] + @ssDNA3@MoS2 nanocomposite; Preferably, the preparation method of the Au-ssDNA4 probe includes the following steps: mixing 5'-thiol-modified ssDNA4 with gold nanoparticles, allowing it to stand at -18~-20℃ for 2~2.5h, and then purifying to obtain the Au-ssDNA4 probe.
6. A method for detecting target miRNA using the multi-channel CPA biosensor described in any one of claims 1 to 5 for purposes other than disease diagnosis or treatment, characterized in that, Includes the following steps: A1: The sample to be tested is mixed with the DNA adapter and then incubated with the working electrode of the multichannel CPA biosensor; the DNA adapter is used to connect to the 3' end of the target miRNA in the sample to be tested; A2: Incubate dsDNA1, formed from ssDNA1 and ssDNA2, with the working electrode after step A1; the dsDNA1 is used to ligate to the DNA adapter via base complementary pairing. A3: [Ir(ppy)2(phen-NH2)] + The @Au-dsDNA2@MoS2 nanocomposite was incubated with the working electrode treated in step A2, and the photocurrent signal was detected. If the photocurrent signal in step A3 increases, the target miRNA is present in the sample to be tested; if the photocurrent signal in step A3 remains unchanged, the target miRNA is not present in the sample to be tested.
7. The detection method according to claim 6, characterized in that, One end of the DNA adapter is connected to the 3' end of the target miRNA in the sample to be tested, and the other end is connected to the dsDNA1.
8. The detection method according to claim 6, characterized in that, The ssDNA1 and the ssDNA2 form the dsDNA1 through complementary base pairing.
9. The detection method according to claim 6, characterized in that, In step A2, the concentration of ssDNA1 is 8-12 μM, and the concentration of ssDNA2 is 8-12 μM.
10. The detection method according to claim 6, characterized in that, Step A3 first involves [Ir(ppy)2(phen-NH2)] + The @ssDNA3@MoS2 nanocomposite was incubated with the working electrode treated in step A2; then the Au-ssDNA4 probe was incubated with the working electrode treated above, and the photocurrent signal was detected.