Gene for regulating and controlling corn endosperm prolamin content and grain hardness

By inhibiting the expression of the maize gene Fie1 and using CRISPR-Cas9 technology to alter the H3K27me3 modification state, the problem of regulating the content of gliadin in maize endosperm and kernel hardness was solved, resulting in a significant increase in gliadin content and kernel hardness, thus improving the agronomic traits of maize kernels.

CN121045355APending Publication Date: 2025-12-02CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202410678481.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-05-29
Publication Date
2025-12-02

AI Technical Summary

Technical Problem

In the existing technology, the regulatory mechanism of corn endosperm gliadin content and kernel hardness is not clear. This leads to kernels becoming smaller and nutrient distribution becoming uneven when gliadin content is too high, and difficulties in harvesting and storage when hardness is insufficient.

Method used

By inhibiting the expression of the maize gene Fie1, including knocking out, downregulating or inactivating the Fie1 gene, mutants were created using CRISPR-Cas9 technology to alter the H3K27me3 modification state, thereby increasing the content of prolamins and kernel hardness.

Benefits of technology

It significantly increased the content of endosperm gliadin and kernel firmness in maize, improved the texture and storage performance of maize kernels, and provided a genetic strategy for breeding maize varieties with high endosperm gliadin and high kernel firmness.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention discloses application of a gene Fie1 in regulation and control of corn endosperm prolamin content and / or grain hardness. The corn endosperm gliadin content and / or grain hardness can be improved by inhibiting the expression of the gene Fie1 in corn, which indicates that the gene Fie1 plays an important role in regulating the corn endosperm gliadin content and / or grain hardness. The invention provides a valuable gene resource for enhancing the corn endosperm prolamin content and / or grain hardness.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of agricultural biotechnology and relates to the application of gene Fie1 (NCBI number Zm00001d049608) in regulating the content of gliadin in maize endosperm and / or kernel hardness, and particularly to a method for inactivating gene Fie1 to increase the content of gliadin in maize endosperm and / or kernel hardness. Background Technology

[0002] Gramineae endosperm filling exhibits significant co-initiation of transcription, including starch synthases and prolysin synthesis genes. This co-regulation of transcription originates from transcription factors highly expressed during the endosperm filling period, such as O2, PBF, and NAC130 (Yang, Wu et al. 2023). However, the mechanisms by which these highly expressed transcription factors during the endosperm filling period determine transcription initiation have not been reported.

[0003] An open chromatin state is a prerequisite for initiating transcriptional activation. The polycomb group protein (PcG) family, which catalyzes the trimethylation modification of histone H3 at lysine 27 (H3K27me3), is an important transcriptional repressive modifier and is considered to play a crucial regulatory role in various developmental stages. The PRC2 complex mainly comprises three types of members: methyltransferases with the SET domain, Fie (fertilization-independent endosperm) proteins with the WD domain, and ESC proteins. The PRC2 complex plays a vital role in the initiation of Arabidopsis endosperm development, inhibiting excessive endosperm proliferation and promoting normal differentiation of endosperm cells (Grossniklaus, Vielle-Calzada et al. 1998; Ohad, Yadegari et al. 1999). Among them, the fie mutant of Arabidopsis thaliana shows that the endosperm develops autonomously in the unfertilized state, while the fie mutant after fertilization shows that the endosperm and embryo cannot develop normally, resulting in abortion (Yadegari, Kinoshita et al. 2000).

[0004] In the Poaceae family, Fie1 differentiates into two copies: Fie1 (fertilization-independent endosperm 1) and Fie2, with Fie1 specifically expressed at the initiation of grain filling (Springer, Danilevskaya et al. 2002). Rice Fie1 mutants have been reported to have small grains and reduced storage protein content (Huang, Lu et al. 2016, Cheng, Pan et al. 2020, Wu, Xie et al. 2023). The expression pattern of ZmFie1 in maize is very similar to that of OsFie1, but evolutionarily, OsFie1 is of independent origin within the Os genus, while both ZmFie1 and ZmFie2 show higher homology to OsFie2 (Cheng, Pan et al. 2020). ZmFie1 is an endosperm maternal imprinted gene, and its expression characteristics and imprinting regulation have been reported in many studies (Springer, Danilevskaya et al. 2002, Gutierrez-Marcos, Costa et al. 2006, Ni, Ma et al. 2019), but its biological function in the endosperm filling stage has not yet been reported.

[0005] Mature corn kernels consist of approximately 72% starch, 11% protein, and 4% lipids. Storage proteins are classified based on their ethanol solubility into zein and non-zein, comprising approximately 60% and 40% respectively. Figure 2Prolactins, as the most important storage proteins, can be divided into four subclasses based on amino acid sequence homology: α (19- and 22-kDa), β (15-kDa), γ (50-, 27-, and 16-kDa), and δ (18- and 10-kDa) (Woo, Hu et al. 2001, Song and Messing 2003, Xu and Messing 2008, Miclaus, Xu et al. 2011, Dong, Feng et al. 2016). β and γ prolactins are expressed slightly earlier than α and δ prolactins, and are located in the peripheral region of the proteosome, which is considered to be related to the initiation of the proteosome; α and δ prolactins then fill the central region of the proteosome until the proteosome finally matures into a spherical particle with a diameter of about 1 μm (Wu and Messing 2017). The content, location, and structure of gliadin in the endosperm are among the main factors determining the texture (soft or hard) of corn kernels. Excessive increases in gliadin, from 12% to 30%, can lead to uneven nutrient distribution and significantly smaller kernels (Moose, Dudley et al. 2004). A moderate increase in gliadin content helps improve kernel firmness, which is beneficial for machine harvesting and long-term storage of corn, and has practical application value. Summary of the Invention

[0006] In our research on the content of gliadin in maize endosperm and kernel firmness, we discovered that the gene Fie1 (i.e., ZmFie1, NCBI number Zm00001d049608) can simultaneously regulate both the content of gliadin in maize endosperm and kernel firmness. Inhibiting the expression of the Fie1 gene in maize can increase the content of gliadin in maize endosperm and / or kernel firmness. Based on the above findings, this invention includes the following technical solution.

[0007] The first aspect of the present invention provides the use of the gene Fie1 in regulating the content of maize endosperm gliadin and / or kernel hardness.

[0008] The nucleotide sequence of the coding region of the maize-derived gene Fie1, namely CDS, is SEQ ID NO:2, and the amino acid sequence of the protein Fie1 it encodes is SEQ ID NO:1.

[0009] The protein Fie1 functions as a polycomb protein to catalyze the trimethylation modification of lysine at position 27 of histone H3 (H3K27me3), and is specifically expressed during the initiation of grouting.

[0010] As a specific application, the Fie1 gene can be used to breed maize varieties with high endosperm gliadin content and / or high kernel hardness and / or to create maize germplasm resources.

[0011] In one application implementation, the endosperm gliadin content and / or kernel firmness of maize are increased by inhibiting the expression of the Fie1 gene in maize.

[0012] The inhibition of Fie1 gene expression mentioned above refers to the downregulation, inactivation, weakening or knockout of Fie1 gene expression.

[0013] The corn varieties mentioned above include, but are not limited to, corn B73, KN5585, etc., which are considered as wild-type corn in this article.

[0014] In one specific application, Fie1 gene suppression is implemented in the following manner:

[0015] (1) Knock out the Fie1 gene in the maize chromosome;

[0016] (2) Downregulate the expression level of gene Fie1 in maize chromosomes;

[0017] (3) Replace the Fie1 gene on the chromosome of wild-type maize with a Fie1 mutant that has lost or downregulated coding function; and / or

[0018] (4) Block, inhibit or interfere with the expression of the Fie1 gene in the chromosome of wild-type maize.

[0019] In one implementation, method (2) is selected from the group consisting of:

[0020] (2-1) Mutations in the promoter region and / or coding region of the Fie1 gene lead to downregulation of the expression level of the Fie1 gene;

[0021] (2-2) Mutations in the upstream regulators of the Fie1 gene lead to downregulation of Fie1 expression; or

[0022] (2-3) The function of the Fie1 gene was altered by introducing an interacting protein of ZmFie1 into wild-type maize.

[0023] Optionally, the above method (3) is selected from the following group:

[0024] (3-1) Base mutations occur in the coding region, resulting in the loss of function of the encoded protein Fie1;

[0025] (3-2) A frameshift mutation occurs in the coding region, resulting in the loss of function of the encoded protein Fie1.

[0026] For example, the mutation in the coding region described in method (3-2) is a frameshift mutation, selected from the following group of forms:

[0027] (a) A frameshift mutant in which the insertion of a base A at position 747 of the coding region of gene Fie1 (i.e. ZmFie1, NCBI number Zm00001d049608) in the CDS nucleotide sequence SEQID NO:2 causes premature termination of protein translation. In this paper, it is named zmfie1-1 or fie1-1.

[0028] (b) A frameshift mutant caused by the insertion of 29 bases ATTTAAACTGATAAAAAAGACAATCTTTT at position 743 of the coding region of gene Fie1 (i.e., ZmFie1, NCBI number Zm00001d049608), i.e., CDS nucleotide sequence SEQ ID NO:2, which causes premature termination of protein translation, is named zmfie1-2 or fie1-2 in this paper.

[0029] In one embodiment, the method (3-2) can be to overexpress an inactivating gene in maize with the nucleotide sequence SEQ ID NO:3, which is a frameshift mutant in which an A base is inserted at position 747 of the nucleotide sequence SEQ ID NO:2, causing premature termination of protein translation, and is named zmfie1-1 or fie1-1 in this document; or

[0030] The method (3-2) can be to overexpress the inactivating gene with the nucleotide sequence SEQ ID NO:4 in maize. This inactivating gene is a frameshift mutant in which 29 bases ATTTAAACTGATAAAAAAGACAATCTTTT are inserted at position 743 of the nucleotide sequence SEQ ID NO:2, causing premature termination of protein translation. In this paper, it is named zmfie1-2 or fie1-2.

[0031] The above steps can be implemented through gene editing technology, antisense nucleic acids, and transcriptional regulation.

[0032] The gene editing technologies mentioned above can be selected from the following group: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0033] A second aspect of the present invention provides a method for identifying maize varieties with maize endosperm gliadin content and / or kernel hardness, comprising the following steps:

[0034] Genomic DNA was extracted from maize material, and the Fie1 gene was sequenced, and / or

[0035] The determination was made to determine whether the protein expressed by the maize cells contained a polypeptide with the amino acid sequence shown in SEQ ID NO:1.

[0036] When the detection results show that the corresponding gene FIE1 coding region, i.e., the CDS nucleotide sequence, in the maize genome is not SEQ ID NO:2, or when the protein expressed by maize cells does not contain the protein FIE1 with an amino acid sequence as shown in SEQ ID NO:1, it suggests that maize has a tendency to have high endosperm gliadin content and / or high kernel hardness, and this maize variety is considered as a candidate for a variety with high endosperm gliadin content and / or kernel hardness.

[0037] A third aspect of the present invention provides a kit for the above-described identification method, comprising the following PCR primers for amplifying the Fie1 gene:

[0038] Forward primer W1056: 5'-acttgccccgaagataacactcat-3' (SEQ ID NO:5),

[0039] Reverse primer W1057: 5'-acaattaagatacgcggtcaaggc-3' (SEQ ID NO:6), or

[0040] Reverse primer W1058: 5'-catgccacaacttgcaaaaatccc-3' (SEQ ID NO:7).

[0041] When sequencing the Fie1 gene using the above kit, amplifying the Fie1 gene with primers W1056 and W1057 yielded an 837bp band, which can be further sequenced to determine the mutation sites of the two mutants, fie1-1 and fie1-2; or

[0042] When amplifying the Fie1 gene using primer pairs W1056 and W1058, the genotypes of the wild-type (WT) and mutant fie1-2 materials can be distinguished. The PCR band size of the WT genotype is 224 bp, while the fie1-2 band size is 253 bp. The bands of these two genotypes can be distinguished using 3% agarose gel electrophoresis.

[0043] Furthermore, the kit also includes an instruction manual that describes the steps and identification criteria for performing the FIE1 gene detection in maize.

[0044] For example, the instructions can be written on bottles, test tubes and similar objects, boards, or on a separate piece of paper, or on the outside or inside of a container, such as a paper document with an operation demonstration video app download window or a QR code. The instructions can also be in multimedia form, such as a CD, USB flash drive, or cloud storage.

[0045] This invention is the first to discover that the gene Fie1 can simultaneously regulate the content of endosperm gliadin and kernel firmness in maize. Inactivation of the Fie1 gene in maize can increase the content of endosperm gliadin and / or kernel firmness. This function of the Fie1 gene provides a genetic strategy for improving maize agronomic traits, breeding maize with high endosperm gliadin content and / or high kernel firmness, and creating maize germplasm resources. Attached Figure Description

[0046] Figure 1 This shows a heatmap of the expression levels of maize PRC2 member genes in various tissues, compiled using common transcriptome data from different maize tissues.

[0047] Figure 2 This paper presents the phenotypes and comparative statistics of wild-type maize KN5585 (WT) and the ZmFie1 gene mutants fie1-1 and fie1-2. The data includes: A. Ear phenotype (scale bar = 5 cm); B. Kernel phenotype (scale bar = 1 cm); C. Kernel cross-section (scale bar = 1 cm); D. Kernel longitudinal section (scale bar = 1 cm); E. Expression analysis of the ZmFie1 gene in the endosperm of WT and fie1 mutants 10 days after pollination; F. Transmission electron microscopy observation of the endosperm of KN5585 and fie1-1 mutants 18 days after pollination; G. Gel images of mature kernels from WT and fie1 mutants; H. Content of glycans, non-glycans, and total protein in mature kernels from WT and fie1 mutants; I. Count of protein bodies based on transmission electron microscopy images; J. Count of protein body diameter based on transmission electron microscopy images. A two-tailed Student's t-test was used to determine the p-value.

[0048] Figure 3 This paper presents the results of single-ear testing of the Zmfie1-2 mutant gene. A. Ear phenotype (scale bar = 5 cm); schematic diagram of the calculated proportion of mealy endosperm (OEA); B. Schematic diagram of the Zmfie1-1 and Zmfie1-2 mutation sites; C. Agarose gel electrophoresis image of the Zmfie1-2 mutation site identification; D. Segregation ratio of Zmfie1-2 heterozygous ears conforming to the chi-square test; E. Comparison of single-kernel weight, mealy endosperm proportion, and prolamin content between WT (wild-type maize KN5585) genotype kernels and mutant genotype kernels in Zmfie1-2 ears. A two-tailed Student's t-test was used to determine the p-value.

[0049] Figure 4The study shows the H3K27me3 modification in the fie1 mutant. Specifically: A. The differential peak of H3K27me3 modification between WT (wild-type maize KN5585) and fie1-1 mutant materials; B. The intersection of lost peaks and upregulated / downregulated genes in ChIP-seq; C. The expression levels of genes with lost H3K27me3 modification differential peaks in WT and fie1-1 mutants; D. Quantitative detection of the difference in gliadin expression levels between WT and fie1-1 materials; E. The difference in H3K27me3 modification between WT and fie1-1 mutants shown by IGV plots. Detailed Implementation

[0050] In our study on the expression of 10 genes of the maize PRC2 members, we found that Fie1 was highly expressed. We further discovered that the ZmFie1 gene mutation obtained by CRISPR-Cas9 technology reduced the chromatin H3K27me3 modification of the maize endosperm gliadin site, which significantly increased the expression level of gliadin, ultimately increasing the content of 22kD and 19kD gliadin in the endosperm, resulting in transgenic maize kernels with improved hardness.

[0051] A frameshift mutation in the coding region of the Fie1 gene (SEQ ID NO:1) prematurely terminates protein translation, alters the amino acid sequence, and eliminates its original function as a transcriptional repressor of polycomb protein (PcG). This inactivation of the Fie1 protein increases the endosperm gliadin content and / or kernel firmness in maize mutants. Utilizing this characteristic of the Fie1 gene, it is possible to improve agronomic traits of wild-type maize, enhance maize kernel quality, and create transgenic maize varieties with high endosperm gliadin content and / or high kernel firmness.

[0052] In this article, the term "wild type" refers to native plants such as maize B73 and KN5585 that have a normal growth phenotype and express the normal protein Fie1 gene (Zm00001d049608).

[0053] Correspondingly, the terms "transgenic maize" and "maize mutant" in this article have the same meaning, referring to plants with increased endosperm gliadin content and / or kernel hardness obtained by genetically modifying wild-type maize.

[0054] In this document, for the sake of simplicity, the name of a protein, such as protein Fie1, and its encoding gene (DNA) are sometimes used interchangeably. Those skilled in the art should understand that they represent different substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, when describing the function or class of a polycomb protein (PcG), Fie1 refers to the protein; when used as a gene description, it refers to the gene encoding that polycomb protein (PcG).

[0055] Our study elucidated the chromatin modification state before grain filling regulation in maize, providing a new genetic strategy for increasing the content of gliadin in maize endosperm and kernel firmness. The study found that the single-gene mutant fie1 increased gliadin expression levels by reducing H3K27me3 modification at the gliadin locus, ultimately resulting in maize materials with increased gliadin content, reduced floury endosperm ratio, and increased kernel firmness.

[0056] In some implementations, the terms “(endosperm gliadin content / kernel hardness) increase,” “improvement,” or “increase” can mean an increase of at least 10% compared to a reference level (such as wild-type maize), for example, an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100%, or any increase between 10% and 100%, or an increase of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a reference level.

[0057] Similarly, the terms “(flour endosperm ratio) decrease” or “reduction” can mean a decrease of at least 10% compared to a reference level (such as wild-type maize), for example, a decrease of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a decrease of 100%, or any decrease between 10% and 100%, or a decrease of at least about 2 times, or at least about 3 times, or at least about 4 times, or at least about 5 times, or at least about 10 times compared to a reference level.

[0058] Specifically, this study includes the following results:

[0059] 1. A group of ZmPRC2 genes were detected to be highly expressed before maize endosperm filling.

[0060] In Arabidopsis, multiple members of the PRC2 complex are ubiquitously expressed genes, regulating developmental processes such as flowering time and seed development. Using common transcriptome data from various maize tissues, a group of PRC2 members, including Fie1, Mez1, Emf2b, and MSI1C, were concentratedly expressed slightly earlier than the grain-filling initiation point. Fie1 showed high expression in the endosperm 6-10 days after pollination, slightly earlier than the transcriptional regulatory initiation time of grain filling. It is hypothesized that this group of PRC2 complexes plays an important role in regulating the chromatin environment at the initiation of grain filling.

[0061] 2. The fie1 gene mutant exhibits a phenotype with increased prolactin content, decreased proportion of floury endosperm, and increased grain hardness.

[0062] We created gene-edited mutant materials using CRISPR-Cas9 technology in the KN5585 genetic background, and selected two mutant lines, fie1-1 and fie1-2, for further research. The fie1 mutant showed slightly greater grain transparency, a reduced proportion of floury endosperm, and increased content of 22kD and 19kD prolamins. Transmission electron microscopy revealed that the endosperm storage material had increased endosperm protein body diameter.

[0063] 3. In the fie1 gene mutant, the tandem repeat region on chromosome 4 shows reduced H3K27me3 modification and increased expression of the prolysin gene.

[0064] It is generally believed that the PRC2 complex catalyzes the trimethylation modification of histone H3 at position 27 (H3K27me3) in chromatin, thereby regulating gene expression. We collected WT and fie1 mutants, and after 10 days of endosperm post-pollination, we used the Anti-H3K27me3 Cut-tag technique to examine and compare the chromatin modification status between the two materials. We found that in the fie1 mutant, H3K27me3 modification was significantly reduced in the gliadin tandem repeat region of chromosome 4, accompanied by a significant increase in gliadin expression levels.

[0065] Based on this, we can conclude that the reduction of chromatin H3K27me3 modification at the maize endosperm gliadin site mediated by ZmFie1 significantly increases the expression level of gliadin, ultimately increasing the content of 22kD and 19kD gliadin in the endosperm, resulting in maize kernels with improved hardness.

[0066] It should be understood that there are various technical means to inactivate, attenuate, and / or prevent the expression of the Fie1 gene in maize, and these techniques can be used individually or in combination.

[0067] In the description of the technical solutions of this invention, the term "and / or" used in terms such as "A and / or B" or "A and / or B" is intended to include both A and B; A or B; A (alone); and B (alone). Similarly, the term "and / or" used in phrases such as "A, B, and / or C" is intended to cover each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); C (alone).

[0068] On the other hand, identifying the protein Fie1 with a normal sequence or its encoding gene Fie1 has a positive effect on predicting the content of gliadin in maize endosperm and / or kernel firmness in advance.

[0069] The advantage of the aforementioned Fie1 gene identification scheme lies in the ability to pre-assess the potential heat stress tolerance of candidate crops, such as maize varieties, solely in the laboratory. Since the entire life cycle of crops like maize is typically one year, examining their biological traits and phenotypes through field cultivation would normally require a significant amount of time and resources, including substantial land and labor costs. In contrast, the gene identification scheme can be completed in the laboratory, allowing for gene sequencing in a short period, such as on seedlings within a few weeks, or even directly on seeds. This significantly improves efficiency and substantially reduces time, space, and labor costs, resulting in substantial economic benefits.

[0070] This invention is the first to obtain zmfie1 mutant material with increased gliadin and kernel hardness by mutating the maize gene ZmFie1, thereby modifying the chromatin modification state of the gliadin locus H3K27me3, thus providing a method to improve the gliadin content and kernel hardness of maize.

[0071] Furthermore, those skilled in the art will anticipate that the application scope of the above-described technical solutions of the present invention is not limited to corn, but may also be applicable to other plants, wherein the plants are monocotyledonous plants, preferably grass crops, selected from corn, rice, wheat, soybean, barley, oats, rye and sorghum, and the preferred plant is corn.

[0072] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the invention.

[0073] Example

[0074] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0075] In the embodiments, if the operating temperature is not specifically specified, it generally refers to room temperature (15-35°C).

[0076] Materials and methods

[0077] The gene sequencing and primer synthesis in this embodiment were outsourced to Sangon Biotech (Shanghai) Co., Ltd.

[0078] The molecular biology experiments in this article, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly conducted in accordance with *Molecular Cloning: A Laboratory Manual* (3rd Edition), edited by J. Sambrook and DW. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. For example, the methods for competent cell transformation and competent cell preparation were based on Chapter 1, page 96 of *Molecular Cloning: A Laboratory Manual* (3rd Edition). Specific experimental conditions could be determined through simple experiments when necessary.

[0079] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0080] It should be noted that, for the sake of convenience, in the embodiments, the plant number and the gene number can share the same number, which is easily understood by those skilled in the art, that is, the same number can refer to different biological forms in different environments.

[0081] Example 1: Investigation of PRC2 members specifically expressed in endosperm

[0082] We used the public transcriptome database of maize endosperm development to identify PRC2 members specifically expressed in the endosperm.

[0083] The maize PRC2 group comprises 10 genes. Using common transcriptome data from various maize tissues, the expression levels of these 10 genes were analyzed and a heatmap was created. Figure 1 ).from Figure 1 As can be seen, a group of PRC2 members, including Fie1, Mez1, Emf2b, and MSI1C, were highly expressed in the endosperm 6-10 days after pollination. Fie1 was highly expressed only in the endosperm after pollination, slightly earlier than the transcriptional initiation point of grain filling. It is speculated that this group of PRC2 complexes plays an important role in regulating the chromatin environment of grain filling initiation, with ZmFie1 likely playing a central role.

[0084] Example 2: Obtaining ZmFie1 deletion mutants using CRISPR-Cas9 technology

[0085] To investigate the role of ZmFie1 in regulating the chromatin environment of granulation initiation, we selected a 20bp sequence [gacttccaccctaccgaggt] on exon 6 of the ZmFie1 gene (NCBI ID Zm00001d049608) as the sgRNA. Using CRISPR-Cas9 technology, we created gene-editing mutant materials in the KN5585 genetic background and selected two mutant lines, fie1-1 and fie1-2, for further research.

[0086] To this end, we designed two frameshift mutations: a frameshift mutant zmfie1-1 (or fie1-1) that causes premature termination of protein translation by inserting a base A at position 747 of SEQ ID NO:2, and a frameshift mutant zmfie1-2 (or fie1-2) that causes premature termination of protein translation by inserting 29 bases ATTTAAACTGATAAAAAAGACAATCTTTT at position 743 of SEQ ID NO:2.

[0087] 1. Two ZmFie1 deletion mutants, fie1-1 and fie1-2, were constructed using CRISPR-Cas9 technology. Taking the construction of mutant fie1-1 as an example, the following steps were included:

[0088] Use online websites http: / / www.e-crisp.org / E-CRISP / designcrispr.html Knockout target design was performed, and NCBI was used to confirm the uniqueness of the site on the maize genome. The 20bp ACTTCCACCCTACCGAGGTG segment of the ZmFie1 gene was selected as the target sequence. The sgRNA site was introduced into the p3301-CAS9 vector using a site-directed mutagenesis-like approach. Using the p3301-CAS9 vector as a template, two primer pairs, W728+W729 and W730+W731, were designed to amplify the sgRNA site. The two amplified fragments were excised from the gel, mixed in one tube, and recovered. 20 ng of this product was used as template for a second amplification using primers W728+W731 with homologous arms from both ends of the vector. The amplified product was 700bp, and the gel was excised again for recovery. Homologous recombination was then performed into the p3301-CAS9(XmaI+PstI) vector.

[0089] After sequencing verification, the vector was transformed into Agrobacterium EHA105 strain. This vector was then transformed into maize KN5585 immature embryos using Agrobacterium-mediated transformation to obtain CRISPR transgenic maize. The primer sequences are as follows:

[0090] W728: attcgagctcggtacccgggAAGTCGTAAAATAGTGGTG,

[0091] W729: aattcggtgcttgcggctcgACCTCGGTAGGGTGGAAGTC,

[0092] W730: GACTTCCACCCTACCGAGGTgttttagagctagaaatagc,

[0093] W731: gcttgcatgcctgcagGCGAGGGCTAAATCGTTAAGAA.

[0094] After the above steps, the mutant fie1-1 was constructed.

[0095] The mutant fie1-2 was constructed using the same method.

[0096] 2. Genotyping

[0097] Genomic DNA was extracted from wild-type maize KN5585 (WT) and mutants fie1-1 and fie1-2 for genotyping.

[0098] Maize DNA was extracted using the CTAB method for subsequent identification, including the following steps:

[0099] Place corn seedling leaves in a 2mL centrifuge tube, add 0.6mL of CTAB extraction buffer, add a 1mm steel bead, and grind (60Hz, 60s). After grinding, mix well and place in a 65℃ oven for 60min, mixing every 10-15min. Remove and let stand at room temperature for 5-10min, add an equal volume of chloroform:isoamyl alcohol (24:1) to the centrifuge tube, seal and shake for 5min. Centrifuge at 13000rpm for 15min at room temperature, and transfer the supernatant to a new 1.5mL centrifuge tube. Add an equal volume of isopropanol, mix by inverting, and place at -20℃ for 20min. Centrifuge at 12000rpm for 1min at room temperature and discard the supernatant. Wash the DNA precipitate 1-2 times with 1mL of 75% ethanol, centrifuging at 12000rpm for 1min each time, and discard the ethanol. Centrifuge briefly to remove excess liquid, and air dry the DNA precipitate at room temperature. Add 0.3mL of H2O to dissolve the DNA precipitate.

[0100] CTAB extraction buffer

[0101]

[0102] Chloroform:Isoamyl alcohol (24:1): Add 20.8 mL of isoamyl alcohol to 500 mL of chloroform and mix well.

[0103] The PCR detection reaction used a standard PCR mix, and the following primers were used for PCR identification:

[0104] Forward primer W1056: 5'-acttgccccgaagataacactcat-3',

[0105] Reverse primer W1057: 5'-acaattaagatacgcggtcaaggc-3',

[0106] Reverse primer W1058: 5'-catgccacaacttgcaaaaatccc-3'.

[0107] Taq enzyme (Yeasen, 10102ES06) PCR reaction system:

[0108]

[0109] Taq enzyme PCR reaction steps

[0110]

[0111] When PCR amplification was performed using primers W1056 and W1057, an 837 bp band was amplified, with the following sequence:

[0112] Acttgccccgaagataacactcattagaattctaatgttaccatttgttattgagcatgccaaatttcaattttaacatcatagataaaataa gaccccacaattacttttactgtttatctacttccattacattaggcataaagttatactgataaaaaagacaatcttttgtctgaaggacttccaccct ac [- / ATTTAAACTGATAAAAAAGACAATCTTTT] cga (- / A)ggttggggatttttgcaagttgtggcatggacaa tactgtgaaaatttggtcaatgaaaggtttgggaactactttaaactagcttcatgtttacattttgtgttgtatgttgcatatcatcgacaaatattgccaatgttgtcacagaattttggatatatgttgaaaatcatattcatggact ggccatccatcaaagtttccaacgaggaatatccagtttccggtatgttaagtagctataatcacctgagctcctttctttttttgcaaactattgttggtgttcagttttcatgccattcaagcatacatgtttcttttcttttaggtctt gactgctgcagtacactctgactatgttgattgtacaagatggcttggtgacttcatcctatcaaaggtaaattcttcatttgttaaatggctatacattttttataaaggaaattttttattaatttcaagcactttagattgaaataata caaaatcttaaaaacatttttggcctccatttaaacaagcacaaaaccaacaaaaaagagtaaaccaacccattctagtgaatattaatgcataaactagattgctacccatatgtctagaaaaagtagccttgaccgcgtatcttaattgt

[0113] The downslope positions are the two mutation sites, fie1-1 and fie1-2.

[0114] When PCR amplification was performed using primers W1056 and W1058, the genotypes of the WT and fie1-2 materials could be distinguished by the amplified fragments. The PCR band size of the WT genotype was 224 bp, and the band size of the fie1-2 genotype was 253 bp. The bands of these two genotypes could be distinguished by 3% agarose gel electrophoresis.

[0115] Gene sequencing confirmed that the nucleotide sequence of the mutant fie1-1 gene is SEQ ID NO:3 and the nucleotide sequence of the mutant fie1-2 gene is SEQ ID NO:4.

[0116] Example 3: Investigation of the content of prolysin, the ratio of flour to endosperm, and the grain hardness phenotype of the zmfie1 mutant.

[0117] In 2021, we planted three genotypes—WT, fie1-1, and fie1-2—at the Damao base of the Sanya Cotton Research Institute. After harvesting in March 2022, we selected five plump ears from each genotype, choosing kernels with a square shape from the middle section of the ear. We then photographed the kernels and measured their protein content. Cross-sectional and longitudinal sections of mature fie1-1 and fie1-2 kernels showed that the central floury endosperm region of the kernel was smaller, while the peripheral hard endosperm region was larger. Figure 2 (AD). Endosperm samples were collected 10 days after pollination from the three materials, and the expression level of the ZmFie1 gene was detected. It was observed that the ZmFie1 gene expression level was significantly downregulated in the fie1-1 and fie1-2 mutants, reaching only 5%-10% of the wild-type expression level. Figure 2 (E), from which we can confirm that these two mutants are deletion mutants. Seeds 18 days after pollination were fixed in glutaraldehyde, and observed by ultrathin sections and transmission electron microscopy. We found that the protein body diameter of fie1-1 seeds was slightly increased, while the number of protein bodies was slightly decreased. Figure 2 (FJ). After milling and mixing the kernels from each mature ear, samples were taken to determine the content of alcohol-soluble protein and non-alcohol-soluble protein, as well as the total protein content. Electrophoresis and quantitative results showed that the content of 22kD and 19kD alcohol-soluble protein increased, and the total protein content also increased. Figure 2 (G, H).

[0118] In summary, the zmfie1 mutant exhibits a phenotype characterized by increased content of prolysin, decreased proportion of floury endosperm, and increased grain hardness.

[0119] Example 4: Single-ear test to confirm the phenotype of increased gliadin content in the zmfie1 mutant

[0120] Because the protein content of maize ears is greatly affected by the environment, we used a single-ear testing method to confirm the phenotype of the zmfie1 mutant. We used zmfie1-2 heterozygous self-pollinated ears, weighed each kernel for testing, and then longitudinally sectioned the kernels to determine the proportion of floury endosperm. Half of the kernels were used for DNA extraction to identify the genotype, and the other half were used to determine the content of prolamins (...). Figure 3 (AC). Genotyping results of the two ears showed that the grain number of the wild type, heterozygote, and mutant conformed to the single-gene inheritance pattern. Figure 3 (D). Ultimately, we found that 1-2 kernels per spike had slightly lower kernel weight, increased floury endosperm area, and increased Zein content. Figure 3 (E). Single-ear test data confirmed the zmfie1 mutant phenotype of increased prolysin content and reduced endosperm area of ​​floury grains.

[0121] Example 5: Analysis of the role of the ZmFie1 gene in regulating maize endosperm gliadin content and kernel firmness

[0122] Fie1 is a member of the PRC2 complex and is presumed to regulate gene expression by catalyzing the trimethylation (H3K27me3) of lysine at position 27 of histone H3 in chromatin at certain specific sites. This example explores which loci ZmFie1 regulates the H3K27me3 modification level, ultimately affecting the expression of the Zein gene.

[0123] We collected endosperm samples from WT and fie1-1 mutants 10 days after pollination and used Anti-H3K27me3 ChIP-seq technology to detect and compare the chromatin modification status between the two materials. We first obtained the difference peaks in H3K27me3 modification between the WT and fie1-1 mutant materials, with 4339 peaks lost and 4953 peaks obtained. Figure 4 (A) Few lost peaks but high P-values ​​indicate a direct impact from Fie1 loss. Many gained peaks but low P-values, mostly small peaks, may be an indirect effect of Fie1 loss and Fie2 ectopic upregulation. Using the same batch of materials for RNA-seq, since the effect of PRC2 on gene expression is broad yet small, a Q-value < 0.05 was used to screen for differentially expressed genes, resulting in 3904 upregulated and 3620 downregulated genes. Intersection of the lost peaks and upregulated / downregulated genes in ChIP-seq yielded 335 upregulated intersections and 179 downregulated intersections. Figure 4 (B). Using the Loss Peak gene set 2463, we examined the RNA-seq data and found that the expression level in the fie1-1 mutant was slightly lower than that in the WT mutant. Figure 4 (C, t-test, pairwise test). Specifically, comparing the differences in H3K27me3 modification between the WT and fie1-1 mutants using the IGV schematic diagram, it can be seen that the loss of K27 modification at the zein locus in the Ch4 tandem repeat region is very obvious, accompanied by upregulation of gene expression ( Figure 4 (D, E)

[0124] Therefore, we can conclude that the reduction of chromatin H3K27me3 modification at the maize endosperm gliadin site mediated by ZmFie1 significantly increases the expression level of gliadin, ultimately increasing the content of 22kD and 19kD gliadin in the endosperm, resulting in maize kernels with improved hardness.

[0125] The embodiments described above are merely preferred embodiments for fully illustrating the present invention, and the scope of protection of the present invention is not limited thereto. Equivalent substitutions or modifications made by those skilled in the art based on the present invention are all within the scope of protection of the present invention.

[0126] It should be noted that the listing and discussion of previously disclosed documents in this specification should not be construed as an admission that such documents are prior art or common general knowledge.

[0127] Acknowledgments: This research project was supported by the Ministry of Agriculture and Rural Affairs of the People's Republic of China and is a major project of the Ministry of Agriculture and Rural Affairs Science and Technology Innovation 2030 Program, titled: High-yield new gene mining and breeding value evaluation, project number: 2023ZD04068.

[0128] References

[0129] Cheng,

[0130] Dong, J., Y. Feng, D. Kumar, W. Zhang, T. Zhu, MCLuo and J. Messing (2016). "Analysis of tandem gene copies in maize chromosomal regions reconstructed from long sequence reads." Proc Natl Acad Sci US A113(29):7949-7956.

[0131] Grossniklaus, U., JPVielle-Calzada, MAHoeppner and WBGagliano(1998). "Maternal control of embryogenesis by MEDEA, a polycomb group gene in Arabidopsis." Science 280(5362):446-450.

[0132] Gutierrez-Marcos,J.F.,L.M.Costa,M.Dal Pra,S.Scholten,E.Kranz,P.Perezand H.G.Dickinson(2006)."Epigenetic asymmetry of imprinted genes in plantgametes."Nat Genet 38(8)876-878.

[0133] Huang,X.,Z.Lu,X.Wang,Y.Ouyang,W.Chen,K.Xie,D.Wang,M.Luo,J.Luo andJ.Yao(2016)."Imprinted gene OsFIE1 modulates rice seed development byinfluencing nutrient metabolism and modifying genome H3K27me3."Plant J 87(3):305-317.

[0134] Miclaus,M.,J.H.Xu and J.Messing(2011)."Differential gene expressionand epiregulation of alpha zein gene copies in maize haplotypes."PLoS Genet 7(6):e1002131.

[0135] Moose,S.P.,J.W.Dudley and T.R.Rocheford(2004)."Maize selection passesthe century mark:a unique resource for 21st century genomics."Trends PlantSci 9(7):358-364.

[0136] Ni,J.,X.Ma,Y.Feng,Q.Tian,Y.Wang,N.Xu,J.Tang and G.Wang(2019)."Updating and interaction of polycomb repressive complex 2components in maize(Zea mays)."Planta 250(2):573-588.

[0137] Ohad,N.,R.Yadegari,L.Margossian,M.Hannon,D.Michaeli,J.J.Harada,R.B.Goldberg and R.L.Fischer(1999)."Mutations in FIE,a WD polycomb groupgene,allow endosperm development without fertilization."Plant Cell 11(3):407-416.

[0138] Song,R.and J.Messing(2003)."Gene expression of a gene family in maizebased on noncollinear haplotypes."Proc Natl Acad Sci U S A 100(15):9055-9060.

[0139] Springer,N.M.,O.N.Danilevskaya,P.Hermon,T.G.Helentjaris,R.L.Phillips,H.F.Kaeppler and S.M.Kaeppler(2002)."Sequence relationships,conserveddomains,and expression patterns for maize homologs of the polycomb groupgenes E(z),esc,and E(Pc)."Plant Physiol 128(4):1332-1345.

[0140] Woo,Y.M.,D.W.Hu,B.A.Larkins and R.Jung(2001)."Genomics analysis ofgenes expressed in maize endosperm identifies novel seed proteins andclarifies patterns of zein geneexpression."Plant Cell 13(10):2297-2317.

[0141] Wu,X.,L.Xie,X.Sun,N.Wang,E.J.Finnegan,C.Helliwell,J.Yao,H.Zhang,X.Wu,P.Hands,F.Lu,L.Ma,B.Zhou,A.Chaudhury,X.Cao and M.Luo(2023)."MutationinPolycomb repressive complex 2 gene OsFIE2 promotes asexual embryo formationin rice."NatPlants 9(11):1848-1861.

[0142] Wu,Y.and J.Messing(2017).Understanding and improving protein traitsin maize.InAchieving sustainable cultivation of maize Vol 1:From improvedvarieties to local applications,.D.Watson,ed(Cambridge,UK Burleigh DoddsScience Publishing).

[0143] Xu,J.H.and J.Messing(2008)."Organization of the prolamin gene familyprovides insightinto the evolution of the maize genome and gene duplicationsin grass species."Proceedings ofthe National Academy of Sciences of theUnited States of America 105(38):14330-14335.

[0144] Yadegari,R.,T.Kinoshita,O.Lotan,G.Cohen,A.Katz,Y.Choi,A.Katz,K.Nakashima,J.J.Harada,R.B.Goldberg,R.L.Fischer and N.Ohad(2000)."Mutationsin the FIE and MEAgenes that encode interacting polycomb proteins causeparent-of-origin effects on seeddevelopment by distinct mechanisms."PlantCell 12(12):2367-2382.

[0145] Yang,T.,X.Wu,W.Wang and Y.Wu(2023)."Regulation of seed storageprotein synthesisin monocot and dicot plants:A comparative review."Mol Plant16(1):145-167。

Claims

1. Application of gene Fie1 in regulating the content of maize endosperm gliadin and / or kernel hardness.

2. The application as described in claim 1, characterized in that, The Fie1 gene is used to breed maize varieties with high endosperm gliadin content and / or high kernel firmness and / or to create maize germplasm resources.

3. The application as described in claim 1, characterized in that, Increasing the endosperm gliadin content and / or kernel firmness in maize by inhibiting the expression of the Fie1 gene.

4. The application as described in claim 3, characterized in that, Fie1 gene inhibition is implemented in the following manner: (1) Knock out the Fie1 gene in the maize chromosome; (2) Downregulate the expression level of gene Fie1 in maize chromosomes; (3) Replace the Fie1 gene on the chromosome of wild-type maize with a Fie1 mutant that has lost or downregulated coding function; and / or (4) Block, inhibit or interfere with the expression of the Fie1 gene in the chromosome of wild-type maize.

5. The application as described in claim 4, characterized in that, Method (2) is selected from the following group: (2-1) Mutations in the promoter region and / or coding region of the Fie1 gene lead to downregulation of the expression level of the Fie1 gene; (2-2) Mutation of upstream regulators of the Fie1 gene leads to downregulation of Fie1 gene expression level; or (2-3) The function of the Fie1 gene was altered by introducing an interacting protein of ZmFie1 into wild-type maize.

6. The application as described in claim 5, characterized in that, Method (3) is selected from the following group: (3-1) Base mutations occur in the coding region, resulting in the loss of function of the encoded protein Fie1; (3-2) A frameshift mutation occurs in the coding region, resulting in the loss of function of the encoded protein Fie1.

7. The application as described in claim 6, characterized in that, The mutation in the coding region described in method (3-2) is a frameshift mutation, selected from the following group of forms: (a) A frameshift mutant in which the coding region of gene Fie1 (NCBI number Zm00001d049608), i.e., the CDS nucleotide sequence SEQ ID NO:2, has an insertion of base A at position 747, causing premature termination of protein translation; (b) A frameshift mutant in which 29 bases ATTTAAACTGATAAAAAAGACAATCTTTT are inserted at position 743 of the coding region of gene Fie1 (NCBI number Zm00001d049608), i.e., the CDS nucleotide sequence SEQ ID NO:2, causing premature termination of protein translation.

8. The application as described in claim 6, characterized in that, The method described (3-2) involves overexpressing the inactivating gene with the nucleotide sequence SEQ ID NO:3 in maize. This inactivating gene is a frameshift mutant in which an A base is inserted at position 747 of the nucleotide sequence SEQ ID NO:2, causing premature termination of protein translation; or The method (3-2) involves overexpressing an inactivated gene with the nucleotide sequence SEQ ID NO:4 in maize. This inactivated gene is a frameshift mutant in which 29 bases ATTTAAACTGATAAAAAAGACAATCTTTT are inserted at position 743 of the nucleotide sequence SEQ ID NO:2, causing premature termination of protein translation.

9. A method for identifying maize varieties by the content of endosperm gliadin and / or kernel hardness, characterized in that, Includes the following steps: Genomic DNA was extracted from maize material, and the Fie1 gene was sequenced, and / or The determination was made to determine whether the protein expressed by the maize cells contained a polypeptide with the amino acid sequence shown in SEQ ID NO:

1. When the detection results show that the corresponding gene FIE1 coding region, i.e., the CDS nucleotide sequence, in the maize genome is not SEQ ID NO:2, or when the protein expressed by maize cells does not contain the protein FIE1 with an amino acid sequence as shown in SEQ ID NO:1, it suggests that maize has a tendency to have high endosperm gliadin content and / or high kernel hardness, and this maize variety is considered as a candidate for a variety with high endosperm gliadin content and / or high kernel hardness.

10. A kit for carrying out the method as described in claim 9, characterized in that, The following PCR primers are included for amplifying the Fie1 gene: Forward primer W1056: 5'-acttgccccgaagataacactcat-3' (SEQ ID NO:5), Reverse primer W1057: 5'-acaattaagatacgcggtcaaggc-3' (SEQ ID NO:6), or Reverse primer W1058: 5'-catgccacaacttgcaaaaatccc-3' (SEQ ID NO:7).