Soybean alkali-inducible promoters and uses thereof

Abstract

The soybean alkali-inducible promoter and application thereof belong to the technical field of genetic engineering. In order to mine the soybean alkali-inducible promoter, the present application finds through research that GmWRKY53 The gene is significantly induced by alkali stress, and overexpression of the gene can significantly improve the alkali stress resistance of soybean. GmWRKY53 The promoter of the gene pGmWRKY53 Can drive the specific expression of a reporter gene in the root vascular bundle of soybean, and is an alkali-inducible promoter. Compared with the use of a constitutive promoter p35S To drive GmWRKY53 The overexpression of the gene, the use of pGmWRKY53 To drive GmWRKY53 The overexpression of the gene can improve the survival rate of the transgenic strain under alkali stress at the seedling stage by more than 20%. The soybean alkali-inducible promoter provided by the present application pGmWRKY53 Can be used for breeding alkali-resistant transgenic soybean, improving the salt-alkali stress resistance of soybean, and further improving the yield of soybean planted in saline-alkali land.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to the soybean alkali-inducible promoter and its applications. Background Technology

[0002] Soybeans Glycine max As an important source of oil and protein, soil plays a crucial role in ensuring food security and sustainable agricultural development. However, the global problem of soil salinization seriously threatens its yield and quality. Soda-saline soils, in particular, are rich in alkali metal salts such as sodium carbonate (Na₂CO₃) and sodium bicarbonate (NaHCO₃). When these salts dissolve, they produce large amounts of alkaline ions (such as CO₃²⁻). 2- HCO3 - and OH - This leads to a significant increase in soil pH. Soybeans are highly sensitive to alkaline stress and have poor tolerance to alkali. High pH environments severely inhibit soybean root development, weaken their ability to absorb and utilize nutrients, and disrupt the balance of ionic and mineral nutrients within the roots. This results in stunted plants, yellowing leaves, flower and pod drop, ultimately leading to substantial yield reduction or even crop failure. Therefore, when planting soybeans in soda-alkali soils, developing alkali-tolerant varieties is an important breeding objective.

[0003] In recent years, some progress has been made in the screening of alkali-tolerant soybean germplasm resources, cloning of alkali-tolerant genes, and functional analysis. However, the molecular mechanisms of their regulation and how to efficiently utilize these genes to cultivate alkali-tolerant soybean varieties still require in-depth exploration. Transgenic technology is an effective means of studying gene function and cultivating salt-tolerant crops, and the selection of promoters directly affects the expression pattern of exogenous genes and the genetic transformation effect. Constitutive promoters, such as the cauliflower mosaic virus 35S promoter (…), are important considerations. p35S Salt-tolerant genes can be continuously expressed in all plant tissues and at all stages of growth and development after being introduced, which can improve crop salt tolerance. However, continuous expression leads to energy waste and is often accompanied by phenotypic effects affecting plant development. In contrast, inducible promoters can activate the expression of downstream genes under specific stress conditions, precisely control the spatiotemporal expression of downstream genes under alkali stress, avoid the negative effects of continuous expression of alkali-tolerant genes on plants, and can quickly activate defense mechanisms when stress occurs. However, current research progress mainly focuses on salt (NaCl)-inducible promoters. For example, GmNAC4 Salt-inducible promoters of genes can increase the expression levels of reporter genes in Arabidopsis and soybean under salt stress (see application number CN201410621142.X, invention title: A Soybean Shengdou No. 9). GmNAC4 (Chinese invention patent for gene salt-induced promoter). GmNTL1 The promoter can also efficiently initiate or upregulate target gene expression under salt stress conditions (see application number CN202311560114, invention name: a soybean Shengdou No. 9). GmNTL1 (Chinese patent applications for salt-inducible promoters and their applications). In contrast, alkali-specific inducible promoters remain to be explored. Therefore, isolating and identifying alkali-inducible promoters and studying their expression responses to alkali stress will not only help to elucidate the molecular mechanisms of soybean alkali stress tolerance, but also provide applicable promoter reference sequences for related research, laying a theoretical foundation for the creation of new alkali-tolerant soybean germplasm.

[0004] WRKY transcription factors are key components of plant responses to salt and alkali stress and play an important role in plant salt and alkali tolerance mechanisms. They regulate multiple key pathways by specifically binding to the W-box cis-acting element ((T)TGAC(C / T)) in the promoter region of target genes: (1) Maintaining ion homeostasis: Activating the expression of genes such as SOS pathway (e.g., SOS1 Na⁺ / H⁺ antitransporter), NHX family vacuolar membrane Na⁺ / H⁺ antitransporter, and HKT family Na⁺ transporter, promoting Na⁺ efflux or compartmentalization into vacuoles, thereby reducing cytoplasmic Na⁺ toxicity. (2) Enhancing antioxidant capacity: Upregulating genes for antioxidant enzymes such as SOD, POD, and CAT, as well as genes for the synthesis of non-enzymatic antioxidants (e.g., glutathione), clearing excess reactive oxygen species (ROS), and reducing oxidative damage. (3) Participating in signal transduction: Regulating key stress signaling pathways such as ABA, MAPK, and calcium signaling, amplifying or finely regulating the stress response network. Therefore, screening for alkali-inducible promoters that can drive the expression of soybean WRKY transcription factor genes under alkali stress is of great significance for breeding alkali-tolerant transgenic soybeans. Summary of the Invention

[0005] To explore soybean alkaloid-inducible promoters, this invention cloned and analyzed... GmWRKY53 Gene promoter pGmWRKY53 This provides a soybean alkali-inducible promoter. pGmWRKY53 The soybean alkali-inducible promoter provided by this invention can be used to cultivate alkali-tolerant transgenic soybeans, thereby improving soybean resistance to saline-alkali soil stress and ultimately increasing soybean yield in saline-alkali soil. This invention has significant theoretical and practical value for elucidating the molecular mechanism of soybean alkali stress tolerance and its application in breeding improvement.

[0006] To solve the above-mentioned technical problems and achieve the corresponding technical effects, the present invention provides the following technical solution:

[0007] The first objective of this invention is to provide a soybean alkali-inducible promoter. pGmWRKY53 The soybean alkali-inducible promoter pGmWRKY53 The nucleotide sequence is shown in SEQ ID NO.8.

[0008] A second objective of this invention is to provide the above-mentioned soybean alkali-inducible promoter. pGmWRKY53The application of the soybean alkaloid-inducible promoter is... pGmWRKY53 Used to improve the resistance of soybeans to alkali stress.

[0009] A third objective of this invention is to provide the above-mentioned soybean alkali-inducible promoter. pGmWRKY53 The application utilizes the soybean alkaloid-inducible promoter. pGmWRKY53 Develop alkali-tolerant genetically modified soybeans.

[0010] In one embodiment of the present invention, a soybean alkaloid-inducible promoter pGmWRKY53 Inducing alkali tolerance genes in soybeans under alkali stress GmWRKY53 The soybean alkali tolerance gene is expressed. GmWRKY53 The nucleotide sequence is shown in SEQ ID NO.3.

[0011] A fourth objective of this invention is to provide a recombinant vector containing the aforementioned daidzein-inducible promoter. pGmWRKY53 .

[0012] A fifth objective of this invention is to provide an application of the aforementioned recombinant vector, wherein the recombinant vector is used to improve the resistance of soybeans to alkali stress.

[0013] The sixth object of the present invention is to provide an application of the above-mentioned recombinant vector, wherein the application is to use the recombinant vector to cultivate alkali-tolerant transgenic soybeans.

[0014] A seventh object of the present invention is to provide a recombinant bacterium containing the above-mentioned soybean alkali-inducible promoter. pGmWRKY53 Or the aforementioned recombinant carrier.

[0015] The eighth object of the present invention is to provide an application of the above-mentioned recombinant bacteria, wherein the recombinant bacteria are used to improve the resistance of soybeans to alkali stress.

[0016] The ninth object of the present invention is to provide an application of the above-mentioned recombinant bacteria, wherein the application is to use the recombinant bacteria to cultivate alkali-resistant transgenic soybeans.

[0017] The beneficial effects of this invention are:

[0018] This invention discovers GmWRKY53 The gene is significantly induced by alkaline stress, and its overexpression can significantly improve the alkaline stress tolerance of soybeans. Under alkaline stress, GmWRKY53 gene promoters pGmWRKY53 It is a base-inducible promoter that can drive the specific expression of reporter genes in the vascular bundles of soybean roots. This contrasts with the use of constitutive promoters. p35S drive GmWRKY53 Compared to gene overexpression, using promoters pGmWRKY53 drive GmWRKY53The transgenic lines obtained by overexpressing the gene showed a survival rate increase of over 20% under alkali stress during the seedling stage. This invention provides an alkali-inducible promoter for soybean. pGmWRKY53 This invention can be used to breed alkali-tolerant transgenic soybeans, thereby improving soybean resistance to saline-alkali soil stress and ultimately increasing soybean yield in saline-alkali soil. The technical solution provided by this invention has significant theoretical and practical value for elucidating the molecular mechanism of soybean alkali stress tolerance and its application in breeding improvement. Attached Figure Description

[0019] Figure 1 Soybean roots treated with alkaline solution for different durations GmWRKY53 Image showing the results of gene expression level detection;

[0020] Figure 2 Phenotypic diagrams of soybean transgenic lines and their recipients under water and alkali stress treatments; among them, Figure 2 In the diagram, A represents the phenotypic pattern of the receptor Willmas82 after water treatment. Figure 2 In the diagram, B represents the phenotypic pattern of the soybean transgenic line OE-5 after water treatment. Figure 2 In the diagram, C represents the phenotypic pattern of the soybean transgenic line OE-7 after water treatment. Figure 2 In the diagram, D represents the phenotypic pattern of soybean transgenic line OE-11 after water treatment. Figure 2 E in the diagram represents the phenotype of the receptor Willmas82 after treatment with 75 mM alkaline solution. Figure 2 In the diagram, F represents the phenotypic pattern of soybean transgenic line OE-5 after treatment with 75 mM alkaline solution. Figure 2 In the diagram, G represents the phenotypic pattern of soybean transgenic line OE-7 after treatment with 75 mM alkaline solution. Figure 2 In the diagram, H represents the phenotypic pattern of soybean transgenic line OE-11 after treatment with 75 mM alkaline solution;

[0021] Figure 3 This is a schematic diagram of a vector containing the GUS reporter gene and the constructed vector pRUBY-pGmWRKY53::GmWRKY53; where, Figure 3 In the diagram, A represents a vector containing the GUS reporter gene. Figure 3 B in the diagram is a schematic diagram of constructing the vector pRUBY-pGmWRKY53::GmWRKY53;

[0022] Figure 4 For overexpression GmWRKY53 Figure 1. GUS staining analysis results of soybean hairy roots treated with alkaline solution for different time periods after gene promoter treatment.

[0023] Figure 5 To utilize different promoters GmWRKY53Phenotypic diagram of transgenic soybean plants after treatment with alkaline solution; among which, Figure 5 In the diagram, A represents the phenotypic pattern of the soybean transgenic EV plant after water treatment. Figure 5 In the diagram, B represents the phenotypic pattern of the soybean transgenic plant p35S::GmWRKY53 after water treatment. Figure 5 In the diagram, C represents the phenotypic pattern of the soybean transgenic plant pGmWRKY53::GmWRKY53 after water treatment. Figure 5 In the diagram, D represents the phenotypic pattern of the soybean transgenic plant EV after treatment with 75 mM alkaline solution. Figure 5 In the diagram, E represents the phenotypic pattern of the soybean transgenic plant p35S::GmWRKY53 after treatment with 75 mM alkaline solution. Figure 5 F in the figure represents the phenotypic diagram of the soybean transgenic plant pGmWRKY53::GmWRKY53 after treatment with 75 mM alkaline solution;

[0024] Figure 6 To utilize different promoters GmWRKY53 The image shows the results of measuring the aboveground and underground fresh weight of transgenic soybean plants after treatment with an alkaline solution; among them, Figure 6 Figure A shows the aboveground fresh weight of soybean transgenic plants after treatment with alkaline solution. Figure 6 Figure B in the figure shows the results of the underground fresh weight measurement of soybean transgenic plants after treatment with alkaline solution. Detailed Implementation

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments and accompanying drawings. It should be noted that the embodiments mentioned below are only for explaining the invention and are not intended to limit the scope of the invention. The embodiments mentioned below are only some embodiments of the invention, not all embodiments. Those skilled in the art can refer to the content of this document and appropriately improve the process parameters to achieve the objectives of the invention. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the invention. The methods and applications of this invention have been described through preferred embodiments, and those skilled in the art can obviously modify or appropriately change and combine the methods and applications described herein without departing from the content and scope of this invention to realize and apply the technology of this invention. In the art, embodiments obtained by other those skilled in the art without creative effort are all protected by this invention.

[0026] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, and the materials, reagents, culture media and instruments used are conventional materials, reagents, culture media and instruments in the art, which can be obtained by those skilled in the art through commercial channels.

[0027] The synthesis of primers and sequencing of sequences used in this invention were both completed by Sangon Biotech (Shanghai) Co., Ltd.

[0028] The OK Clon DNA ligation kit used in this invention was purchased from Acori Biotech Co., Ltd., and the KOD One kit was also available. TM PCRMaster Mix-Blue was purchased from Toyobo (Shanghai) Biotechnology Co., Ltd., restriction endonucleases were purchased from NEB, and the AceQqPCR SYBR Green Master Mix (High ROX Premixed) kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.

[0029] The soybean variety used in this invention is Willam82, which was provided by the Northeast Institute of Geography and Agroecology, Chinese Academy of Sciences.

[0030] Example 1: Overexpression GmWRKY53 Obtaining soybean plants with the gene and identifying alkali-tolerant phenotypes

[0031] 1. Effects of alkaline solution treatment on soybean root tissue GmWRKY53 Effects of gene expression

[0032] Soybean root tissues were treated with 75 mM alkaline solution (Na2CO3 to NaHCO3 molar ratio of 5:1) for 0 h, 3 h, 6 h, and 12 h. Total RNA was extracted from the soybean root tissues after treatment and reverse transcribed into cDNA. Using the cDNA as a template, qPCR was performed using primers GmWRKY53qPCR-F (SEQ ID NO. 1) and GmWRKY53qPCR-R (SEQ ID NO. 2) to analyze the RNA in soybean root tissues. GmWRKY53 Gene expression levels changed with the duration of alkaline stress. qPCR was performed using the AceQ qPCR SYBR Green Master Mix (High ROX Premixed) kit purchased from Nanjing Novizan Biotechnology Co., Ltd. The reaction mixture consisted of: 10 μL SYBR Mix, 0.4 μL upstream primer, 0.4 μL downstream primer, 1 μL cDNA, and ddH2O to a final volume of 20 μL. Results showed that gene expression levels in soybean root tissue... GmWRKY53 The gene was significantly alkali-induced, with expression increasing 23-fold after 3 hours of alkali treatment, 42-fold after 6 hours of alkali treatment, and 50-fold after 12 hours of alkali treatment. Figure 1 ).

[0033] SEQ ID NO.1: TCAAACAAGGAGCCAGGTTG;

[0034] SEQ ID NO. 2: GAGTTTCTGCTCGAAGGGAGT.

[0035] 2. Overexpression GmWRKY53 Obtaining genetically modified soybean plants

[0036] 1) GmWRKY53 Cloning of gene fragments

[0037] According to soybeans GmWRKY53 Design of the nucleotide sequence of the gene's CDS region (as shown in SEQ ID NO.3) GmWRKY53 The upstream primer pRUBY-GmWRKY53-F (SEQ ID NO.4) and the downstream primer pRUBY-GmWRKY53-F (SEQ ID NO.5) were used for CDS sequence cloning of the gene. Using cDNA from soybean root tissue as a template, specific PCR amplification was performed using the above primers, employing KOD One primers purchased from Toyobo (Shanghai) Biotechnology Co., Ltd. TM The target fragment was cloned using PCR Master Mix-Blue high-fidelity enzyme. The KOD enzyme amplification system and procedure are shown in Tables 1 and 2. The amplified products were separated by agarose gel electrophoresis. The fragment size was confirmed to be consistent with the expected fragment size. The bands were recovered, purified, and sequenced for verification, indicating successful cloning. GmWRKY53 Gene fragments.

[0038] Table 1 KOD enzyme amplification system

[0039]

[0040] Table 2 KOD enzyme amplification program

[0041]

[0042] SEQ ID NO.3:

[0043] ;

[0044] SEQ ID NO.4: ttgactcgacaggattctagaATGGAGAATTATTCCATGTTGTTCTC;

[0045] SEQ ID NO.5: gtcatccttgtagtcccatggGAAGGGAGGTGTATATTTGCATCTGAC.

[0046] 2) Overexpression GmWRKY53 Construction of gene recombination vectors

[0047] The pRUBY vector (purchased from Shanghai Newp Biotechnology Co., Ltd., catalog number: V001191) was digested using restriction endonucleases XbaⅠ and NcoⅠ purchased from NEB, according to the digestion reaction system prepared in Table 3. The digestion was carried out at 37℃ for 2 hours to obtain the digested fragments. The digestion efficiency was detected by gel electrophoresis, and the vector fragments were recovered by gel electrophoresis. The fragments containing homologous arms obtained in step 1) were then... GmWRKY53The gene fragment and the enzyme-digested vector fragment were recombined using the OK Clon DNA ligation kit purchased from Acori Biotechnology Co., Ltd., to construct the overexpression vector pRUBY-p35S::GmWRKY53. The reaction system was configured according to Table 4, and the reaction procedure is shown in Table 5. The overexpression vector pRUBY-p35S::GmWRKY53 was transformed into E. coli DH5α competent cells, plated on LB solid medium containing 50 μg / mL kanamycin, and incubated overnight at 37°C. After colony PCR identification of positive clones, positive clones were picked and inoculated into liquid LB medium containing 50 μg / mL kanamycin, and incubated overnight at 37°C with shaking. The plasmid was extracted using a kit, and the plasmid was identified by PCR and sequenced, confirming the successful construction of the recombinant vector.

[0048] Table 3 Enzyme digestion system of the vector

[0049]

[0050] Table 4. Systems of the recombination reaction

[0051]

[0052] Table 5. Procedure for the recombination reaction

[0053]

[0054] 3) Preparation of recombinant Agrobacterium

[0055] The recombinant vector obtained in step 2) was transformed into Agrobacterium EHA105 competent cells, plated on LB solid medium containing 50 μg / mL kanamycin and 25 μg / mL rifampin, and cultured at 28°C for 2 days. After the colony was identified as a positive clone by PCR, the strain was preserved in glycerol with a final concentration of 15%.

[0056] 4) Preparation of genetically modified soybeans

[0057] Transgenic soybeans were obtained using Agrobacterium-mediated cotyledonary node transformation, which specifically included the following steps:

[0058] ① Seed disinfection and germination

[0059] Select healthy, plump Williams82 soybean seeds, disinfect them, sow them on germination medium, and culture them in a light culture room (25±2℃, 16 h light / 8 h dark) for 5-7 days until the seedlings develop unfolded cotyledons and short hypocotyls.

[0060] ②Explant preparation

[0061] Under sterile conditions, the cotyledonary nodes of the seedlings are cut off with a scalpel.

[0062] ③ Culture of recombinant Agrobacterium

[0063] The recombinant Agrobacterium obtained in step 3) was activated, then cultured to the logarithmic growth phase, the bacterial cells were collected by centrifugation, resuspended in infection medium, and the bacterial concentration was adjusted to OD. 600nm ≈0.5-0.8, used for infection.

[0064] ④ Agrobacterium infection

[0065] Immerse the prepared cotyledonary explants in Agrobacterium bacterial solution and gently shake for 15-30 minutes. Remove the explants, blot off excess bacterial solution with sterile filter paper, spread them evenly on co-culture medium, seal the culture dish with sealing film, and culture at 25°C in the dark for 2-4 days.

[0066] ⑤ Adventitious bud induction

[0067] After co-culture, the explants were transferred to a shoot induction / selection medium, which was replaced with fresh medium every 2-3 weeks. Under the action of the selection agent, untransformed cells died, while transformed cells survived and began to form resistant callus or buds.

[0068] ⑥ Bud elongation

[0069] Explants that produce resistant buds are transferred to bud elongation medium.

[0070] ⑦ Rooting

[0071] When the resistant shoots grow to 2-3 cm in height, cut them off from the base, insert them into the rooting medium, and culture them under light for 2-4 weeks until healthy roots grow.

[0072] 5) Alkali treatment

[0073] After identification, genetically stable overexpressing pRUBY-p35S::GmWRKY53 lines (OE-5, OE-7, and OE-11) and the receptor Willmas82 were planted in growth pots filled with vermiculite. After 14 days of normal growth, soybean seedlings were treated with alkali. Each pot was watered with 200 mL of 75 mM alkali solution (Na2CO3 to NaHCO3 molar ratio of 5:1) per day. The water control was watered with 200 mL of water per pot per day. After 10 days of treatment, alkali tolerance phenotypes were observed and corresponding indicators were measured.

[0074] The results showed that after water treatment, compared to the receptor Willmas82, the expression was overexpressed. GmWRKY53Soybean lines OE-5, OE-7, and OE-11 showed no significant differences in plant height, above-ground and below-ground fresh weight. However, under 75 mM alkaline solution stress, the growth of the receptor Willmas82 was significantly inhibited, resulting in stunted growth, yellowing leaves, and even wilting and death. Overexpression of Willmas82 was also observed. GmWRKY53 Soybean lines OE-5, OE-7, and OE-11, which expressed the gene, showed milder stress phenotypes under alkaline stress treatment, and the soybean plants did not exhibit leaf yellowing or death. This indicates overexpression of the gene. GmWRKY53 Genes can enhance soybean's tolerance to alkaline stress. However, compared to water treatment, the plant height, aboveground and belowground biomass of soybean lines OE-5, OE-7, and OE-11 were significantly reduced under alkaline solution stress treatment. Figure 2 ).

[0075] Example 2: GmWRKY53 Gene promoter pGmWRKY53 Alkali stress-induced activity analysis

[0076] 1. GmWRKY53 Gene promoter pGmWRKY53 amplification

[0077] DNA was extracted from root tissues of soybean variety Williams 82 at 5-7 days of germination using the CTAB method. Amplification was performed using pGmWRKY53-F (SEQ ID NO.6) and pGmWRKY53-R (SEQ ID NO.7) as primers, with DNA as a template. The target fragment was cloned using KOD One™ PCR Master Mix-Blue high-fidelity enzyme from Toyobo (Shanghai) Biotechnology Co., Ltd. The KOD enzyme amplification system and procedure are shown in Tables 1 and 2. The amplified sequence was then subjected to full-length sequencing, and the resulting promoter was obtained. pGmWRKY53 The sequence is shown in SEQ ID NO.8.

[0078] SEQ ID NO.6: ATTCACCGAATTAGTTGTGTTC;

[0079] SEQ ID NO.7: CGAAATCAAACCCAACACCAA;

[0080] SEQ ID NO.8:

[0081]

[0082] 2. Overexpression promoter pGmWRKY53 Preparation of soybean hairy roots

[0083] 1) Construction of overexpression vectors

[0084] by GmWRKY53 Gene promoter pGmWRKY53 As a template, the carrier is as follows Figure 3 As shown in A, primers pGmWRKY53-GUS-F (SEQ ID NO. 9) and pGmWRKY53-GUS-R (SEQ ID NO. 10) were used to amplify molecules containing homologous arms. pGmWRKY53 The fragment contains primers that contain approximately 15 bp homologous arms flanking the vector GUS insertion site.

[0085] SEQ ID NO.9: actgatagtttaaactctagaATTCACCGAATTAGTTGTGTTCCTT;

[0086] SEQ ID NO. 10: cctcagatctaccatactagtCCCCCCTTGGTGTTGGGT.

[0087] The vector pGUS-His was digested using NEB restriction endonucleases XbaⅠ and SpeⅠ, according to the reaction system shown in Table 3. The digestion products were then recovered using a gel. For vectors containing homologous arms... pGmWRKY53 The fragment PCR product was recovered by gel extraction and recombinantly constructed into the expression vector pGUS-His using the OK Clon DNA ligation kit to obtain the recombinant overexpression vector pGmWRKY53p-GUS.

[0088] 2) Preparation of recombinant Agrobacterium

[0089] The overexpression vector constructed in step 1) was transformed into E. coli DH5α competent cells, plated on LB solid medium containing 50 μg / mL kanamycin, and cultured overnight at 37°C. After colony PCR identification of positive clones, positive clones were picked and cultured overnight at 37°C with shaking in LB liquid medium containing 50 μg / mL kanamycin. Plasmids were extracted using a kit, and sequenced after plasmid PCR identification.

[0090] The correctly sequenced plasmid was transformed into Agrobacterium K599 competent cells, plated on LB solid medium containing 50 μg / mL kanamycin and 25 μg / mL rifampin, and incubated at 28°C for 2 days. After colony PCR identification as a positive clone, the strain was preserved in 15% glycerol.

[0091] 3) Construction of root development in genetically modified soybeans

[0092] The overexpression vector pGmWRKY53p-GUS was transferred into the soybean receptor Williams82 using Agrobacterium-mediated transient transformation of soybean hairy roots. The specific steps are as follows:

[0093] Seed sterilization and germination: Place 100 plump and smooth soybean seeds in a glass petri dish, and then place them in a sealed desiccator containing chlorine (97 mL sodium hypochlorite, 3 mL concentrated hydrochloric acid) for 4-6 hours. Then, remove the glass petri dish and place it in a clean bench to purge the chlorine. Germinate the sterilized soybean seeds with vermiculite at 25°C until needles grow.

[0094] Activation of recombinant Agrobacterium: Pick the recombinant Agrobacterium obtained in step 2) and inoculate it into 10 mL of YEP antibiotic culture medium. Incubate at 28°C and 180 r / min for 24 h. Spread 2 mL of the bacterial culture onto LB solid medium containing 50 μg / mL kanamycin and 25 μg / mL rifampin. Incubate at 28°C for two days.

[0095] Infection: After the soybean needles have unfolded, cut them 2 cm below the cotyledons. Scrape the activated recombinant Agrobacterium from the cut end of the stem, inoculate it, and reinsert it into vermiculite. Cover it with plastic wrap to keep it moist. Hairy roots will regrow in about 15 days.

[0096] 3. Alkali treatment

[0097] Soybean hairy roots were treated with a 75 mM alkaline solution (Na₂CO₃ to NaHCO₃ molar ratio of 5:1) by pouring the alkaline solution into vermiculite containing soybean hairy roots. Treatment times were 0 h, 3 h, 6 h, 12 h, 24 h, 48 h, 72 h, 96 h, and 120 h. Soybean hairy roots treated with the alkaline solution for different times were collected after treatment. The roots were then immersed in GUS staining solution and vacuum-treated for 30 min using a vacuum pump, followed by incubation at 37°C in the dark for 12 hours. After treatment, the roots were transferred to 70% ethanol for decolorization and preservation. Twenty roots were selected for GUS activation analysis and observed and photographed under a stereomicroscope. The basic GUS staining solution consists of: 50 mmol / L sodium hydrogen phosphate buffer (pH=7.0), 10 mmol / L EDTA, 0.1% (v / v) Triton X-100, 0.5 mmol / L potassium ferrohydride, and 0.5 mmol / L potassium ferrous hydride. The X-Gluc stock solution is prepared by dissolving X-Gluc in dimethyl sulfoxide (DMSO) to a final concentration of 100 mmol / L. Before use, take an appropriate amount of the basic staining solution and add it to the X-Gluc stock solution at a final concentration of 20 mmol / L. Mix thoroughly by inversion. Prepare fresh before use, or store protected from light at 4°C and use on the same day.

[0098] The results showed that, without alkaline stress treatment, the promoter... pGmWRKY53 Only a very small amount of GUS expression can be activated in the root. Compared to 0 h, after 3 h of alkaline stress, the promoter expression was significantly reduced. pGmWRKY53 Activation of GUS significantly increased expression in roots, and the promoter expression level increased with increasing alkaline stress treatment time. pGmWRKY53 The expression level of activated GUS gradually increases in the root, indicating that the promoter... pGmWRKY53 Activity is induced by alkaline stress, promoter pGmWRKY53 It is an alkaline stress-induced promoter ( Figure 4 ).

[0099] Example 3: Promoter pGmWRKY53 and p35S Comparison of applications in genetically modified alkali-tolerant soybeans

[0100] 1. Construction of vector pRUBY-pGmWRKY53::GmWRKY53

[0101] The promoter region of the vector pRUBY-p35S::GmWRKY53 constructed in Example 1 was modified. Specifically, using the genomic DNA of soybean variety Williams 82 as a template, the promoter was amplified using primers Promoter-pGmWRKY53-F (SEQ ID NO.11) and Promoter-pGmWRKY53-R (SEQ ID NO.12). pGmWRKY53 Fragments, obtaining those containing homologous arms pGmWRKY53 The PCR product was amplified using the procedure shown in step 1 of Example 2. The vector pRUBY-p35S::GmWRKY53 was digested with NEB restriction endonucleases HindIII and XbaI, using the same reaction system as in Table 3. The digestion products were then recovered via gel extraction. The PCR product containing the homologous arm was then... pGmWRKY53 The PCR products were gel-recovered, and the gel-recovered products were recombined with the enzyme-digested and gel-recovered vector fragments using the OK Clon DNA ligation kit to construct the vector pRUBY-pGmWRKY53::GmWRKY53 (see [link to kit]). Figure 3 (B in the middle).

[0102] SEQ ID NO.11: ttgactcgacaggattctagaATGGAGAATTATTCCATGTTGTTCTC;

[0103] SEQ ID NO. 12: ggaataattctccatccatggGAAGGGGAGTGTATATTTGCATCTGAC.

[0104] 2. Preparation of recombinant Agrobacterium

[0105] The vector pRUBY-pGmWRKY53::GmWRKY53 constructed in step 1 was transformed into E. coli DH5α competent cells, plated on LB solid medium containing 50 μg / mL kanamycin, and incubated overnight at 37°C. After colony PCR identification of positive clones, positive clones were picked and cultured overnight at 37°C with shaking in LB liquid medium containing 50 μg / mL kanamycin. Plasmids were extracted using a kit, and after plasmid PCR identification, sequencing was performed.

[0106] The correctly sequenced plasmid was transformed into Agrobacterium K599 competent cells, plated on LB solid medium containing 50 μg / mL kanamycin and 25 μg / mL rifampin, and incubated at 28°C for 2 days. After colony PCR identification as a positive clone, the strain was preserved in 15% glycerol.

[0107] Recombinant Agrobacterium containing pRUBY-p35S::GmWRKY53 and pRUBY (empty vector, EV) were prepared using the above method.

[0108] 3. Construction of root development in genetically modified soybeans

[0109] The vectors pRUBY-p35S::GmWRKY53, RUBY-pGmWRKY53::GmWRKY53, and pRUBY (empty vector, EV) were transferred into the soybean recipient Williams82 using Agrobacterium-mediated transient transformation of soybean hairy roots. The specific steps are as follows:

[0110] Seed sterilization and germination: Place 100 plump and smooth soybean seeds in a glass petri dish, and then place them in a sealed desiccator containing chlorine (97 mL sodium hypochlorite, 3 mL concentrated hydrochloric acid) for 4-6 hours. Then, remove the glass petri dish and place it in a clean bench to purge the chlorine. Germinate the sterilized soybean seeds with vermiculite at 25°C until needles grow.

[0111] Activation of recombinant Agrobacterium: The three recombinant Agrobacterium strains prepared in step 2 were picked and inoculated into 10 mL of YEP antibiotic culture medium and cultured at 28℃ and 180 r / min for 24 h. 2 mL of the bacterial culture was then spread onto LB solid medium containing 50 μg / mL kanamycin and 25 μg / mL rifampin and cultured at 28℃ for two days.

[0112] Infection: After the soybean needles have unfolded, cut the stem 2 cm below the cotyledons. Scrape activated recombinant Agrobacterium from the cut surface, inoculate with the inoculated material, and reinsert it into vermiculite. Cover with plastic wrap to retain moisture. Hairy roots will regrow in about 15 days. p35S::GmWRKY53, pGmWRKY53::GmWRKY53, and pRUBY(EV) chimeric transgenic plants were obtained.

[0113] 4. Alkali treatment

[0114] The three transgenic plants obtained in step 3 were treated with 75 mM alkaline solution (the molar ratio of Na2CO3 to NaHCO3 was 5:1). Each pot of the treatment group was watered with 200 mL of alkaline solution per day, while each pot of the water control group was watered with 200 mL of water per day. After 10 days of treatment, the alkali tolerance phenotype was observed and the corresponding indicators (above-ground fresh weight and underground fresh weight) were measured.

[0115] The results of alkali resistance phenotype observation and corresponding index determination are as follows: Figure 5 and Figure 6 As shown in the figure: Compared with the pRUBY(EV) chimeric transgenic plants, both p35S::GmWRKY53 and pGmWRKY53::GmWRKY53 chimeric transgenic plants showed obvious alkali tolerance after 10 days of treatment with 75 mM alkaline solution. However, the survival rate of pGmWRKY53::GmWRKY53 transgenic plants was 25% higher than that of p35S::GmWRKY53, and the aboveground and underground fresh weights were also increased by 12.8% and 19.8%, respectively, compared with p35S::GmWRKY53. This indicates that the chimeric transgenic plants are related to the constitutive promoter. p35S In comparison, base-inducible promoters pGmWRKY53 It can further improve the alkali tolerance of soybeans and improve the growth and development of soybean plants under alkali stress, making it more suitable for breeding transgenic alkali-tolerant soybean varieties.

[0116] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. Use of a soybean alkaline-inducible promoter pGmWRKY53 characterized in that The application is a soybean alkali-inducible promoter pGmWRKY53 for improving the alkali stress resistance of soybeans; the nucleotide sequence of the soybean alkali-inducible promoter pGmWRKY53 is shown as SEQ ID NO.

8.

2. Use of a soybean alkaline-inducible promoter pGmWRKY53 characterized in that The application is to utilize a soybean alkaline inducible promoter pGmWRKY53 to breed alkaline tolerant transgenic soybean pGmWRKY53 The nucleotide sequence of the alkaline inducible promoter is shown as SEQ ID NO.

8.

3. Use according to claim 1 or 2, characterized in that, The soybean alkali-inducible promoter pGmWRKY53 Inducing soybean alkali-tolerance gene under alkali stress GmWRKY53 Expression, the nucleotide sequence of the soybean alkali-tolerance gene GmWRKY53 The nucleotide sequence is shown as SEQ ID NO.

3.

4. Use of a recombinant vector, characterized in that The application is to use the recombinant vector to improve the alkali stress resistance of soybean; the recombinant vector contains a soybean alkali-inducible promoter with a nucleotide sequence as shown in SEQ ID NO. 8 pGmWRKY53 .

5. Use of a recombinant vector, characterized in that The application is to cultivate alkali-resistant transgenic soybean by using a recombinant vector; the recombinant vector contains a soybean alkali-inducible promoter as shown in SEQ ID NO. 8 pGmWRKY53 .

6. Use of a recombinant bacterium, characterized in that The application is to use the recombinant bacteria to improve the alkali stress resistance of soybean; the recombinant bacteria contain a soybean alkali-inducible promoter with a nucleotide sequence as shown in SEQ ID NO. 8 pGmWRKY53 or contain the recombinant vector in claim 4.

7. The application of a recombinant bacterium, characterized in that, The application is to cultivate alkali-resistant transgenic soybean by using the recombinant bacteria, wherein the recombinant bacteria contain the soybean alkali-inducible promoter with the nucleotide sequence as shown in SEQ ID NO. 8 pGmWRKY53 or contain the recombinant vector as shown in claim 4.

Images