Use of rice oscsa gene and method for increasing rice resistance to copper stress

Abstract

The application belongs to the field of biology and discloses a rice OsCSA gene and a method for improving the copper stress resistance of rice, and more specifically discloses OsCSA application of the gene in improving the copper stress resistance of rice, through transcriptome analysis of rice under copper stress and verification under different experimental conditions under copper stress, it is found that OsCSA the gene has a close relationship with accumulation of melatonin in rice, and it is proved that OsCSA the gene and the melatonin have the ability to improve the copper stress resistance level of rice. Meanwhile, the application also discloses OsCOMT9 application of the gene and / or OsCOMT12 application of the gene and a method for improving the copper stress resistance of rice.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biology, in particular to a rice OsCSA, OsCOMT9, OsCOMT12 gene and a method for improving the copper stress resistance of rice. BACKGROUND

[0002] Copper (Cu) is an essential trace nutrient element for plant growth and development, but excessive copper in the growth environment can cause toxic effects on plants. Cu is a cofactor for some enzymes, which plays a key role in many biological processes, including photosynthetic and respiratory electron transport, remodeling of cell walls, etc. A small amount of Cu promotes the growth and development of plants, but high concentrations of Cu in the soil can reduce rice root activity, biomass, plant height, panicle length, grain number, and dry weight. Lidon et al. found that high concentrations of Cu can reduce rice grain yield and delay the growth period, causing rice to be in a poor growth and development state for a long time, and the accumulation of dry matter is significantly reduced. Currently, research on the effects of heavy metal stress on the growth of crops such as rice in China mainly focuses on cadmium (Cd), and there is relatively little research on the molecular mechanisms of rice response to Cu stress and resistance improvement.

[0003] Related literature on rice response to copper stress can be found in:

[0004] Publication No. CN115491381A, entitled Rice Copper Stress Response Gene OsCORK1 and its encoded protein and application;

[0005] There is very little literature on rice response to copper stress, indicating that researchers in the field have not conducted in-depth research in this direction.

[0006] The technical problem solved by the present application is: how to improve / improve the ability of rice to resist copper stress. SUMMARY

[0007] The first object of the present application is to provide OsCSA a new application of the gene, through transcriptomic analysis of rice under copper stress and verification under different experimental conditions under copper stress, we found that OsCSA the gene is closely related to the accumulation of melatonin in rice, and it is proved that OsCSA the gene promotes the synthesis of melatonin in rice, and has the ability to improve the copper stress resistance level of rice.

[0008] At the same time, the present application also discloses OsCSA downstream targets OsCSA application of the gene and a method for improving the copper stress resistance of rice.

[0009] To achieve the above-mentioned first object, the present application provides the following technical solutions:

[0010] RiceOsCOMT12 The gene has one of the following uses:

[0011] Application in improving the copper stress resistance of rice, application in rice breeding screening.

[0012] In addition, by overexpressing OsCSA The gene can improve the copper stress resistance of rice, and based on this rule, a method for improving the copper stress resistance of rice is proposed, that is, overexpressing the rice OsCSA Gene.

[0013] Meanwhile, the application also provides a method for improving the copper stress resistance of rice, which externally applies melatonin to rice in an appropriate concentration.

[0014] It should be noted that there are many existing studies on the ability of melatonin to improve the ability of rice to cope with environmental stress, such as:

[0015] Patent application with the title of application of melatonin gold nanoparticles in relieving cadmium stress of rice, with the publication number CN113179889A;

[0016] Patent application with the title of application of exogenous melatonin in relieving metal oxide nanoparticle stress of rice, with the publication number CN112970539A;

[0017] Patent application with the title of a method for improving seed germination of rice under salt stress and application, with the publication number CN119111536A;

[0018] Patent application with the title of new application of melatonin in improving the resistance of plants to waterlogging stress, with the publication number CN105076136A;

[0019] Generally speaking, those skilled in the art will consider melatonin as a reducing substance, as described in CN119111536A, which found that both melatonin and vitamin C can improve the ability of plants to resist waterlogging stress, and vitamin C is a typical reducing agent.

[0020] In the continuous research of the present application, it is found that in addition to the reducing ability, melatonin can also directly reduce the Cu content in the body of rice (the copper concentration in the root system and the aboveground part is reduced by 22.72% and 22.49% respectively), thereby realizing the improvement of copper stress resistance, which is superior to common heavy metal conditioners such as glutamic acid and zinc sulfate, mainly reflected in the copper stress relief experiment using glutamic acid, zinc sulfate and melatonin respectively, and the present application only found that melatonin has a more significant effect.

[0021] In the above method, the melatonin of appropriate concentration (30 μM in rice culture solution is optimal) is directly applied to the root of rice, and it is particularly important to note that the concentration of melatonin is crucial in improving the copper stress resistance of rice. The present application finds that a lower concentration of melatonin (10 μM) has little effect on alleviating copper stress, and a higher concentration of melatonin (≥70 μM) not only has no effect on improving resistance, but also aggravates the damage of copper stress to rice.

[0022] In addition, the present application also discloses a rice OsCSA Downstream target OsCSA gene and / or OsCOMT9 application of the gene in improving the copper stress resistance of rice.

[0023] The present application finds that the melatonin synthesis related genes OsCOMT12 、 OsCOMT6 、 OsCOMT9 、 OsCOMT12 and OsASMT17 may be OsCOMT33 candidate target genes, and the preliminary verification by EMSA experiment finds that OsCSA interacts most obviously with the promoters of OsCSA and OsCOMT9 , and the gene expression mode research shows that OsCOMT12 may play a function under the copper stress condition by regulating the expression levels of OsCSA and OsCOMT9 , and the yeast one-hybrid, competitive EMSA and tobacco LUC experiments prove that OsCOMT12 directly binds to the promoter of OsCSA and activates the transcription thereof.

[0024] Therefore, OsCOMT12 the downstream target OsCSA gene and / or OsCOMT9 gene can improve the copper stress resistance of rice.

[0025] The present application also discloses OsCOMT12 application of the gene and / or OsCOMT9 gene in the breeding and screening of rice.

[0026] The present application also discloses a method for improving the copper stress resistance of rice by improving the expression amount of OsCOMT12 gene and / or OsCOMT9 gene.

[0027] Compared with the prior art, the present application has the following prominent features:

[0028] 1. The present application proves that OsCOMT12 gene has the ability to improve the copper stress resistance of rice.

[0029] 2. This invention verifies that appropriate concentrations of melatonin can enhance the resistance of rice to copper stress.

[0030] 3. This invention demonstrates that copper stress treatment inhibits transcription factors. OsCSA The expression, and OsCSA Through with OsCSA The GTTA element in the promoter binds, promoting OsCOMT12 The transcription of melatonin ultimately increases melatonin accumulation, reduces the body's copper content, and enhances rice's resistance to copper stress. Attached Figure Description

[0031] OsCOMT12 Phenotypic diagram of the effect of exogenous application of common heavy metal conditioners on the copper stress response of rice;

[0032] Figure 1A Bar charts showing plant height under normal culture, copper stress, and exogenous addition of glutamate, melatonin, and zinc sulfate;

[0033] Figure 1B Bar charts showing the fresh weight of the aboveground parts after normal culture, copper stress, and treatment with exogenous addition of glutamate, melatonin, and zinc sulfate;

[0034] Figure 1C Phenotypic diagrams of rice seedlings under different treatments;

[0035] Figure 2A Bar chart showing plant height of rice seedlings under different treatments;

[0036] Figure 2B Bar chart showing root length of rice seedlings under different treatments;

[0037] Figure 2C Bar chart showing the aboveground fresh weight of rice seedlings under different treatments;

[0038] Figure 2D Bar chart showing the fresh weight of roots of rice seedlings under different treatments;

[0039] Figure 2E Bar chart showing aboveground dry weight of rice seedlings under different treatments;

[0040] Figure 2F Bar chart showing the root dry weight of rice seedlings under different treatments;

[0041] Figure 2G Bar chart showing the root copper concentration of rice seedlings under different treatments;

[0042] Figure 2H Bar chart showing the aboveground copper concentration of rice seedlings under different treatments;

[0043] Figure 2IBar chart of melatonin content in shoots of rice seedlings under different treatments;

[0044] Figure 2J Heatmap of gene clustering based on FPKM values under CK and Cu treatments;

[0045] Figure 3A Volcano plot of differentially expressed genes (log2FoldChange >1.5, P-value < 0.05) under CK and Cu treatments;

[0046] Figure 3B GO enrichment analysis of differentially expressed genes under CK and Cu treatments;

[0047] Figure 3C Heatmap of MYB transcription factor family genes;

[0048] Figure 4A qRT-PCR verification of expression levels of MYB transcription factors;

[0049] Figure 4B Identification of positive seedlings of overexpression materials (detection of GFP in plants); Figure 5A

[0050] qRT-PCR analysis of transcription levels; OsCSA Figure 5B Phenotype of WT and overexpression plants under CK and copper stress treatments;

[0051] OsCSA Expression levels of MYB transcription factors in WT and overexpression plants under CK and copper stress treatments; Figure 5C

[0052] Melatonin content in WT and overexpression plants under CK and copper stress treatments; OsCSA Figure 5D OsCSA H2O2 and MDA contents in WT and overexpression plants under CK and copper stress treatments;

[0053] OsCSA Identification of enrichment regions based on DNA affinity purification sequencing; Figure 5E

[0054] Results of two technical repeat experiments showing OsCSA Figure 5F

[0055] OsCSA Figure 6A

[0056] OsCSA Figure 6B ​​​​​​​​Venn diagram of the number of unique sites and common sites combined;

[0057] OsCSA For Figure 6C GO enrichment analysis of candidate target genes combined;

[0058] OsCSA For Figure 6D KEGG enrichment analysis of candidate target genes combined;

[0059] OsCSA For EMSA verification Figure 7A Resulting graph of the interaction of genes related to melatonin synthesis;

[0060] OsCSA For the expression of WT and Figure 7B Overexpression strains under different treatments OsCSA and OsCOMT9 Resulting graph of the expression amount;

[0061] OsCOMT12 For Figure 8A DNA binding site map of

[0062] OsCSA For Figure 8B Visualization and analysis of potential target genes;

[0063] OsCOMT9 For the distribution of GTTA in Figure 8C Promoter schematic diagram;

[0064] OsCOMT9 For Figure 8D DNA binding site map of

[0065] OsCSA For Figure 8E Visualization and analysis of potential target genes;

[0066] OsCOMT12 For the distribution of TAAC in Figure 8F Promoter schematic diagram;

[0067] OsCOMT12 For Figure 9A and OsCOMT9 Promoter self-activation activity analysis in yeast system;

[0068] OsCOMT12 For yeast single hybrid verification Figure 9B Interaction with OsCSA and OsCOMT9 Promoter graph;

[0069] OsCOMT12 For Figure 10 Combined OsCSAFigure showing results of competitive EMSA experiment for the promoter

[0070] OsCOMT12 Figure showing schematic diagram of important structures of effector vector and reporter vector

[0071] Figure 11A Figure showing fluorescence imaging of LUC activity in N. benthamiana leaves Figure 11B Transcriptional activation OsCSA Figure showing fluorescence imaging of LUC activity in N. benthamiana leaves

[0072] OsCOMT12 Figure showing quantitative results of LUC activity in N. benthamiana leaves

[0073] Figure 11C Figure showing phenotypes of rice under copper stress treatment with different concentrations of melatonin (MT) applied exogenously

[0074] Figure 12 Figure showing plasmid map of pET30a-HaloTag-CSA

[0075] Figure 13A Figure showing plasmid map of pGADT7-CSA

[0076] Figure 13B Figure showing plasmid map of pAbAi- Figure 13C Figure showing plasmid map of pAbAi-

[0077] proOsCOMT9 Figure showing plasmid map of pAbAi- Figure 13D Figure showing plasmid map of pAbAi-

[0078] proOsCOMT12 Figure showing plasmid map of pGreenII 62-SK-CSA

[0079] Figure 13E Figure showing plasmid map of pGreenII 0800-LUC- Figure 13F Figure showing plasmid map of pGreenII 0800-LUC-

[0080] OsCOMT12 Figure showing plasmid map of pMD-18T-CSA DETAILED DESCRIPTION

[0081] The technical solutions in the embodiments of the present application will be described clearly and completely below. Obviously, the described embodiments are only some of the embodiments of the present application, but not all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the protection scope of the present application.

[0082] The experimental materials and reagents used are conventional consumables and reagents available through commercial channels, unless otherwise specified. The primer sequences involved in the present application can be seen in Table 1 and Table 2 as follows.

[0083] Table 1 Primer sequence list

[0084] Figure 13G Primer Name Sequence Information (5'-3') TTTA OE-OsCSA-F CATCCATCCATTCCAGCAT]]> GGATCC AACG OE-OsCSA-R TTGATTTCCAAACGCACA GAGCTC pET30a-HaloTag-OsCSA-F cgctcgagatttccggcggatccATGGCTCACGAAA pET30a-HaloTag-OsCSA-R tgctcgagtgcggccgcaagcttTTAGTGGTGGTGGTGGTGATGCGTCGCA pGADT7-OsCSA-F catacgacgtaccagattacgctcatATGGCTCACGAAATGATGGG pGADT7-OsCSA-R agtatctacgattcatctgcagctcgagTTACGTCGCACCTACACCCA pAbAi-proOsCOMT9-F aagcttgaattcgagctcGAATGGTATTTGGGCATGTGCATT pAbAi-proOsCOMT9-R tttatatacatacagagcacatgcctcgagCCCAACTTCCTATAA pAbAi-proOsCOMT12-F aagcttgaattcgagctcGACGAACCCAACTTGAAA pAbAi-proOsCOMT12-R tatacatacagagcacatgcctcgagTGGAAAGAGCAAAA SK-OsCSA-F tgagctccaccgcggtggcggccgctctagaATGGCTCACGAAATGATGGG SK-OsCSA-R cggtatcgataagcttgatatcgaattcTTACGTCGCACCTACACCCAGG LUC-proOsCOMT12-F cgaggtcgacggtatcgataagcttGACGAACCCAACTTGAAA LUC-proOsCOMT12-R ttcgatctccaccgcggtggcggccgcTGGAAAGAGCAAAAGTTT pMD-18T-OsCSA-F tattctcccacagtgggaaaggatccATGGCAGAAATCGGTACTGG pMD-18T-OsCSA-R aagtaattaatccttatttagaattcTTAGTGGTGGTGGTGGTGAT proOsCOMT12-Bio-F CGTTAGATTTCCGTTAATAAAACTC proOsCOMT12-R GAGTTTTATTAACGGAAATCTAACG MproOsCOMT12-Bio-F CGTTAGAGGGGTCTGGGGAAAACTC MproOsCOMT12-R GAGTTTTCCCCAGACCCCTCTAACG

[0085] Table 2 Primer sequence list

[0086] Primer name Sequence information (5'-3') OsUBQ5-F CTCGCCGACTACAACATCCA OsUBQ5-R TCTTGGGCTTGGTGTACGTCTT OsCSA-F GAAGCTTGCTGTGGATCAGAGA OsCSA-R GCGGATGGCCGAAGAAG OsMYB55-F AACTACCTGAGGCCGGACAT OsMYB55-R ACCACCTGCTTCCAATCGAG OsMYB61-F TCCTTGGGAACAGGTGGTCT OsMYB61-R GTGGGTGTTGGGATCAATGC OsRLM1-F CAACTACCTCAGGCCAGACC OsRLM1-R CCACCTGTTCCCGAGGATCT Os01g50720-RT-F CCTAGGCAACAGGTGGTCG Os01g50720-RT-R CCTCAGCTTCTTCTTGAGGCA OsCOMT9-F CTGTCTTCCTCAAGTGGGTTCT OsCOMT9-R CTGCTCCGACCACTATGTCC OsCOMT12-F CCCTCCTGCTTAAGTTTGTGC OsCOMT12-R CAATTGTTGGGTTCCTTGGCA

[0087] Related experimental methods are described:

[0088] 1.1 Plant material, growth conditions and treatment

[0089] The full-length coding sequence of OsCSA gene (SEQ ID NO. 1) was amplified with cDNA of rice (Oryza sativa L.) variety Wuyun NO. 7 as template, and restriction enzyme sites BamH I and Sac I were added to the 5' end of the primer for amplifying OsCSA gene (see Table 1 for details) so as to be subsequently connected to expression vector pTCK303 (Shanghai Caiyou Industry Co., Ltd.). The obtained fragment was connected to pMD19-T cloning vector (Shanghai Baishai Biotechnology Co., Ltd.), and after enzyme digestion and sequencing, the cloning vector of the gene and the expression vector pTCK303 were double-digested with BamH I and Sac I respectively, and then the purified and recovered gene fragment was connected with the linearized pTCK303 vector using T4 ligase to obtain the expression vector OE-OsCSA. The vector was electroporated into Agrobacterium EHA105, and infected into Nipponbare callus, and the genetic transformation method is described in detail in Chen et al. [Chen G, Hu J, Lian J, et al. Functional characterization of OsHAK1 promoter in response to osmotic / drought stress by deletion analysis in transgenic rice. Plant Growth Regulation, 2019, 88(3): 241-251], and overexpression transgenic rice was created. OsCSA OsCSA The copy number of T0 generation was identified by southern blotting, and single copy lines were selected for GUS staining. All the plants identified by GUS staining were positive (i.e. homozygous lines), which were used for subsequent phenotype screening and OsCSA physiological and molecular function analysis experiments of the gene. OsCSA

[0090] ​​For copper stress and exogenous application of glutamate, zinc sulfate and melatonin treatment: After sterilization, the seeds of Wu Yunj 7 were soaked in water for two days, then germinated in a 37°C incubator for one day. The germinated seeds were transferred to a PCR plate with a hole and placed in a 1.6 L hydroponic container in a climate chamber for one week, and then cultured in IRRI nutrient solution for two weeks. The nutrient solution was replaced every two days, and the pH was maintained at 5.8. Then, 100 μM copper (Cu), 1 mM glutamate (Glu), 100 μM copper + 1 mM glutamate (Cu + Glu), 30 μM melatonin (MT), 100 μM copper + 30 μM melatonin (Cu + MT), 50 μM zinc sulfate (ZnSO4), and 100 μM copper + 50 μM zinc sulfate (Cu + Zn) were treated for 3-5 days. The artificial climate chamber culture conditions were: 28°C light for 14 h, 25°C dark for 10 h, and relative humidity of 70%. The treated samples were dried and stored frozen according to the requirements of the determination index.

[0091] 1.2 Determination of copper and melatonin content

[0092] For determination of copper content, the collected samples were killed in an oven at 105°C for half an hour, then adjusted to 65°C and dried to constant weight. The dried samples were added to a digestion tube containing 5 mL nitric acid and 2 mL hydrogen peroxide, digested until the solution was clear, diluted to 25 mL, and the copper content was determined by inductively coupled plasma mass spectrometry (iCAP Qnova Series ICP-MS, ThermoFisher Scientific, USA). Each treatment was repeated 3 times.

[0093] Melatonin was determined by high performance liquid chromatography (HPLC). The treated samples were quickly frozen with liquid nitrogen and stored in a -80°C freezer for detection of melatonin. About 0.2 g of sample was weighed, 1 mL of 80% methanol was added, ground, and soaked overnight, and the supernatant was obtained by centrifugation. HPLC determination method: instrument Rigol L3000 high performance liquid chromatograph, Kromasil C18 reversed phase chromatographic column (250 mm x 4.6 mm, 5 μm), mobile phase preparation: A, methanol, B, 0.1 M potassium dihydrogen phosphate solution. The sample size was 10 μL, the flow rate was 1 mL / min, the column temperature was 30°C, the sample running time was 45 min, the excitation wavelength was 278 nm, and the emission wavelength was 338 nm.

[0094] 1.3 Transcriptomic analysis

[0095] Three biological replicates of RNA samples from wild type young leaves under normal (CK) and Cu treatment were collected and rapidly frozen in liquid nitrogen, and then stored in -80 °C refrigerator for transcriptome detection. Sample extraction and sequencing were performed by Shanghai Pinengnuo Biological Technology Co., Ltd. The raw sequencing data was filtered by fastp (0.22.0) software to obtain high-quality data (Clean Data) for next step analysis. The number of mapped genes and fragments per million mapped reads were calculated by StringTie (v2.2.1) software to quantify gene expression. DESeq.2 software was used to screen for differentially expressed genes (DEGs), and the Log2(TPM+1) method was used to standardize gene expression levels. The volcano plot of differentially expressed genes under CK and Cu treatment was drawn by Volcano (https: / / www.genescloud.cn / chart / Volcano). Gene ontology (Go) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis was performed using the online website (https: / / www.genescloud.cn / chart / ).

[0096] 1.4 qRT-PCR analysis

[0097] Total RNA was extracted from rice leaves according to the instructions of the RNA extraction kit of Promega (Beijing) Biotechnology Co., Ltd. The quality and concentration of total RNA were detected by ultramicro UV spectrophotometer Nano-300 (OuSheng, China), and then cDNA was synthesized by reverse transcription using GoScript™ Reverse Transcription Mix, Random Primers kit (Promega). TB Premix EX Taq II reagent was used for RT-qPCR analysis on a real-time fluorescence quantitative PCR instrument (CFX Opus 384, Bio-RAD, USA). OsUBQ5 was used as an internal reference gene. The expression level of the gene was calculated according to the method of 2 -△△Ct The primer information is shown in Table 2.

[0098] 1.5 Determination of reactive oxygen species level

[0099] According to the instructions of the hydrogen peroxide (H2O2) and malondialdehyde (MDA) kits of Suzhou Keming Biological Technology Co., Ltd., H2O2 and MDA were determined, respectively.

[0100] 1.6 DNA affinity purification sequencing (DAP-Seq) analysis

[0101] DAP-Seq sequencing experiments were performed by Zoonbio Biotechnology Co., Ltd. (Nanjing, China). The optimized full-length OsCSA coding sequence was cloned and constructed into pET30a-HaloTag vector (New England Biolabs, Ipswich, MA, USA) for protein expression. The expressed Figure 13A -HaloTag fusion protein was purified and captured by MagneHaloTag Beads (Zoonbio Biotechnology Co., Ltd.). Genomic DNA of rice leaf samples was isolated by Plant Genomic DNA Extraction Kit (Zoonbio Biotechnology Co., Ltd.) and constructed into DNA library. OsCSA The HaloTag fusion protein was incubated with DAP-Seq DNA library, and the final bound DNA fragments were sequenced on Illumina HiSeq™ 4000 platform. The DAP-Seq data were analyzed by MACS2 (version 2.12) software to identify the binding sites (q-value < 0.05). The gene annotation and Motif search related to the binding sites were performed by Chip-seeker software and MEMEsuite website (http: / / meme-suite.org / ), respectively. The primer information is shown in Table 1. OsCSA OsCSA

[0102] 1.7 Yeast one-hybrid

[0103] Yeast one-hybrid experiments were performed by Matchmaker Gold Yeast One-Hybrid Library Screening System (Clontech, San Francisco, CA, USA) kit. The optimized full-length OsCSA coding sequence (SEQ ID NO. 2) was cloned into pGADT7 vector as the capture protein pGADT7- OsCSA ( Figure 13B ), and the partial promoter sequence (SEQ ID NO. 3, 195 bp) and OsCOMT9 partial promoter sequence (SEQ ID NO. 4, 156 bp) containing the binding elements predicted by DAP-Seq were inserted into pAbAi vector as the bait vectors pAbAi- OsCOMT12 ( proOsCOMT9 ) and pAbAi- Figure 13C , respectively.​​proOsCOMT12 ( Figure 13D ). pGADT7- OsCSA and pAbAi- proOsCOMT9 or pAbAi- proOsCOMT12 The vector was co-transformed into the Y1HGold yeast strain, plated on SD / -Leu solid culture plates, and incubated upside down at 30°C for 3-4 days. After colonies grew, clones grown on the SD / -Leu solid culture plates were picked, sequenced, and then spotted onto SD / -Leu and SD / -Leu+AbA media, respectively, and incubated upside down at 30°C for 3-4 days. Primer information is detailed in Table 1.

[0104] 1.8 Dual-luciferase activity assay

[0105] Optimized OsCSA The coding sequence was cloned into the pGreenII 62-SK vector ( Figure 13E As an effector, it will contain binding elements predicted by DAP-Seq. OsCOMT12 A portion of the promoter sequence (SEQ ID NO.5, 170 bp in length) was inserted into the pGreenII 0800-LUC vector as a reporter vector. Figure 13F The vector was transformed into Agrobacterium strain GV3101 (pSoup-p19). A 1:1 mixture of effector and reporter vectors was injected into leaves of approximately 4-week-old *Nicotiana benthamiana* plants and cultured in the dark for 1.5 days. Leaf samples were collected and the *Luciferase* response intensity (LUC) and *Renus luteum* response intensity (REN) were measured using the Dual-Luciferase® ReporterAssay System (Promega). The *Luciferase* and *Renus luteum* signals were measured using a GloMax 20 / 20 chemiluminescence analyzer (Fusion FX7, VILBER), and the LUC and REN values, as well as their LUC / REN ratios, were recorded as the final results. Each treatment was performed in 6 biological replicates. Primer information is detailed in Table 1.

[0106] 1.9 Electrophoretic mobility shift assay (EMSA)

[0107] Optimized OsCSA The coding sequence was cloned into the pMD-18T vector with a His tag. Figure 13G Purified protein was obtained after cell-free expression. OsCSA -6xHis. This will include the combined elements. OsCOMT12The promoter fragment was designed as a biotin-labeled probe, and the unlabeled one was used as a competitive probe. A mutant probe was also designed. All the probes were synthesized by Nanjing Zhongding Biological Technology Co., Ltd. EMSA experiments were performed using a LightShift chemiluminescence EMSA kit (Thermo Fisher Scientific, Waltham, MA, USA). The primer information is shown in Table 1.

[0108] Example 1

[0109] Effects of exogenous application of common heavy metal conditioners on the response of rice to copper stress

[0110] The experimental method is described in 1.1.

[0111] In this example, the rice japonica variety Wuyunjinq 7 was selected as the research object. Under the condition of 100 μM copper stress, 1 mM glutamate (Glu), 30 μM melatonin (MT), and 50 μM zinc sulfate (Zn) were added exogenously for research.

[0112] Reference Figures 1A to 1C It was found that under copper stress treatment, the rice leaves wilted and turned yellow, and the plant height and aboveground fresh weight were significantly reduced by 21.70% and 44.59%, respectively, compared with normal culture (control, CK).

[0113] There was no significant difference in the growth state of exogenous glutamate, melatonin, and zinc sulfate and CK.

[0114] Under copper stress treatment, there was no significant difference in phenotype between the rice with exogenous addition of glutamate and zinc sulfate and the rice without addition of glutamate and zinc sulfate (i.e., copper treatment) in terms of plant height and aboveground fresh weight.

[0115] Under copper stress treatment, the phenotype and plant height of the rice with exogenous addition of melatonin were significantly different from those of the rice under copper treatment, and the aboveground fresh weight was 28.95% higher than that of the rice under copper treatment.

[0116] The above phenomena indicate that the exogenous addition of melatonin has the most significant effect on the alleviation of copper stress.

[0117] Figure 1APhenotypic diagram of the effects of applying common heavy metal regulators to exogenous on the phenotype of rice under copper stress response; wherein, CK: normal nutrient solution; Cu: nutrient solution containing 100 μM copper; Glu: nutrient solution containing 1 mM glutamic acid; Cu+Glu: nutrient solution containing 100 μM copper and 1 mM glutamic acid; MT: nutrient solution containing 30 μM melatonin; Cu+MT: nutrient solution containing 100 μM copper and 30 μM melatonin; Zn: nutrient solution containing 50 μM zinc sulfate; Cu+Zn: nutrient solution containing 100 μM copper and 50 μM zinc sulfate.

[0118] Figure 1B Columnar diagram of plant height after normal culture, copper stress, and exogenous addition of glutamic acid, melatonin, and zinc sulfate treatment.

[0119] Figure 1C Columnar diagram of aboveground fresh weight after normal culture, copper stress, and exogenous addition of glutamic acid, melatonin, and zinc sulfate treatment; the values represent the average of three repetitions ± SE, and there is a significant difference (P<0.05) between different letters. Scale = 10 cm.

[0120] In order to further prove the alleviating effect of melatonin on copper stress in rice, the phenotype and related physiological indicators of rice after normal culture, copper stress, and exogenous addition of melatonin treatment were determined. It was found that copper stress treatment affected the growth of rice and significantly reduced the biomass of the plant (dry weight of aboveground and root systems). Exogenous addition of melatonin could restore the growth of rice and effectively reduce the negative effects of copper stress ( Figure 2A ).

[0121] Compared with CK, the plant height, root length, aboveground fresh weight, root fresh weight, aboveground dry weight, and root dry weight of rice under copper stress treatment were reduced by 14.51%, 13.21%, 57.52%, 53.50%, 19.63%, and 32.14% ( Figures 2B to 2G ), respectively, while the copper concentration in the root system and aboveground part was increased by 94.47% and 57% ( Figure 2H and Figure 21 ).

[0122] Exogenous addition of melatonin had no significant difference in phenotype compared with CK, while the melatonin concentration in the aboveground part was significantly increased ( Figure 2J ). Exogenous addition of melatonin significantly reduced copper toxicity, and the plant height, root length, aboveground fresh weight, root fresh weight, aboveground dry weight, and root dry weight of rice under Cu+MT condition were increased by 34%, 4.57%, 130%, 108%, 107%, and 50% compared with Cu treatment, respectively, while the copper concentration in the root system and aboveground part was reduced by 22.72% and 22.49% ( Figure 2B -I).

[0123] The above results show that melatonin plays a key role in the response and tolerance of rice to copper stress.

[0124] Figure 2A Phenotype of rice seedlings under different treatments.

[0125] Figure 2B Column chart of plant height of rice seedlings under different treatments;

[0126] Figure 2C Column chart of root length of rice seedlings under different treatments;

[0127] Figure 2D Column chart of fresh weight of aboveground part of rice seedlings under different treatments;

[0128] Figure 2E Column chart of fresh weight of root system of rice seedlings under different treatments;

[0129] Figure 2F Column chart of dry weight of aboveground part of rice seedlings under different treatments;

[0130] Figure 2G Column chart of dry weight of root system of rice seedlings under different treatments;

[0131] Figure 2H Column chart of copper concentration of root system of rice seedlings under different treatments;

[0132] Figure 21 Column chart of copper concentration of aboveground part of rice seedlings under different treatments;

[0133] Figure 2J Column chart of melatonin content of aboveground part of rice seedlings under different treatments.

[0134] The results are expressed as the mean of each group (n = 5), with error bars representing the standard error (SE). Different letters indicate significant differences (P < 0.05). Scale = 10 cm.

[0135] Example 2

[0136] Transcriptome analysis

[0137] In this example, wild-type rice (variety: Wuyunjing 7) was subjected to 100 μM copper stress treatment and transcriptome analysis.

[0138] The percentage of Q30 bases ranged from 91.94% to 93.45% (Table 3), and the percentage of aligned reads ranged from 95.82% to 96.00% (Table 4) after correction, indicating that the results of the transcriptome data were accurate.

[0139] Table 3 Quality control table of data obtained in RNA-seq analysis

[0140]

[0141] Table 4 High-quality reads alignment to the reference genome in RNA-seq analysis

[0142] Sample Name Number of Reads Rate of Alignment Rate of Unique Alignment Rate of Multiple Alignment CK-1 39546078 37965763 (96.00%) 1181108 (3.11%) 36784655 (96.89%) CK-2 41251106 39551286 (95.88%) 1209489 (3.06%) 38341797 (96.94%) CK-3 40204954 38522528 (95.82%) 1146173 (2.98%) 37376355 (97.02%) Cu-1 40360414 38724667 (95.95%) 1059556 (2.74%) 37665111 (97.26%) Cu-2 46872840 44976011 (95.95%) 1232816 (2.74%) 43743195 (97.26%) Cu-3 40485732 38852248 (95.97%) 1093108 (2.81%) 37759140 (97.19%)

[0143] By analyzing the transcriptome data of CK and copper treatment (Cu) samples, a total of 5884 differentially expressed genes (DEGs) were identified, including 2973 down-regulated genes and 2911 up-regulated genes (P-value < 0.05, log2FoldChange > 1.5) Figure 3A and Figure 3B ).

[0144] GO enrichment analysis is widely used to study the biochemical metabolic pathways related to DEGs. For GO enrichment analysis, the DEGs of rice were divided into three parts: Biological Process (BP), Cellular Component (CC) and Molecular Function (MF). GO enrichment showed that these differential genes mainly participated in responding to stimulus, endogenous stimulus and abiotic stimulus, and played an important function in some metabolic processes Figure 3C ).

[0145] Figure 3A is the gene cluster heat map based on FPKM values under CK and Cu treatment;

[0146] Figure 3B is the volcano plot of differential genes (log2FoldChange > 1.5, P-value < 0.05) under CK and Cu treatment;

[0147] Figure 3C is the GO enrichment analysis diagram based on differential genes under CK and Cu treatment.

[0148] Transcription factors are important elements for plants to regulate environmental adaptability at the transcriptional level. Some transcription factor families have been found to be involved in the regulation of heavy metal stress response in rice, but there are few reports on the relationship between MYB transcription factor family and copper stress resistance. Therefore, we prefer to mine key MYB transcription factors responding to copper stress. Cluster analysis of the screened differential MYB transcription factors (log2FoldChange > 1.5, P-value < 0.05) found that there were 31 ( Figure 4A), accounting for 8.86% of all transcription factors. Among them, the expression of five genes, OsCSA (LOC_Os01g16810), OsMYB55 (LOC_Os05g48010), OsMYB61 (LOC_Os05g04820), OsRLM1 (LOC_Os05g46610) and LOC_Os01g50720, was significantly reduced under copper stress, and the accuracy of the results was verified by qRT-PCR. In addition, it was found that OsCSA The expression level under copper stress was down-regulated by 4.43 times, which was the most obvious among the five MYB transcription factors Figure 4B ).

[0149] This shows OsCSA that the genes are closely related to the response of rice to copper stress.

[0150] Figure 4A The heat map of the MYB transcription factor family genes;

[0151] Figure 4B The expression level of the MYB transcription factor family genes under copper stress was down-regulated by 4.43 times, which was the most obvious among the five MYB transcription factors

[0152] Example 3

[0153] OsCSA Positive regulation of rice tolerance to copper stress

[0154] The experimental method is referred to in Section 1.1, and the method of Agrobacterium-mediated transformation is used to create OsCSA overexpression plants Figure 5A and Figure 5B The expression level of OsCSA in transgenic positive plants is significantly higher than that in WT Figure 5D , indicating that OsCSA constitutive overexpression materials are successfully constructed.

[0155] Under CK conditions, there is no obvious difference in phenotype between wild type (WT) and OsCSA overexpression plants; under copper stress treatment, WT is severely damaged, showing leaf curling, drying and yellowing, while OsCSA overexpression plants have significantly higher copper stress resistance than WT Figure 5C . It is also found that the melatonin content in the overexpression plants is significantly higher than that in WT Figure 5E under copper stress treatment, while the MDA and H2O2 contents are significantly lower than those in WT Figure 5F .

[0156] The above results show that OsCSA overexpression plants may enhance the tolerance to copper stress by increasing the content of melatonin in rice.

[0157] Figure 5A Figure 6 OsCSA Figure of identification results of overexpression material positive seedlings (detecting GFP in plants);

[0158] Figure 5B Figure of transcription level results of qRT-PCR analysis OsCSA

[0159] Figure of phenotype of WT and overexpression plants under CK and copper stress treatment; Figure 5C OsCSA Figure of phenotype of WT and overexpression plants under CK and copper stress treatment;

[0160] Figure 5D Figure of expression level of in WT and overexpression plants under CK and copper stress treatment; OsCSA OsCSA

[0161] Figure 5E Figure of content results of melatonin in WT and overexpression plants under CK and copper stress treatment; OsCSA

[0162] Figure of content results of H2O2 and MDA in WT and overexpression plants under CK and copper stress treatment. Figure 5F OsCSA Example 4

[0163] Research on transcriptional regulatory mechanism involved in melatonin synthesis

[0164] OsCSA 4.1 Identification of binding sites

[0165] OsCSA DNA binding sites of were identified in the whole genome of rice by DAP-Seq technology. A total of 12168 reliable DNA binding sites were found. More than half (51.53%) of the DNA binding sites were distributed in the promoter and intergenic region, 7.14% in the exon region, and 19.24% in the intron region. Venn diagram shows the number of unique and common DNA binding sites between two repeated experiments.

[0166] GO enrichment analysis revealed that the candidate target genes bound by were mainly concentrated in Multicellular organism development and Reproductive process. OsCSA OsCSA OsCSA Figure 6A OsCSA Figure 6B OsCSA Figure 6C ​​​​​​​​​​KEGG enrichment analysis showed that the candidate target genes were mainly concentrated in the biosynthesis of valine, leucine and isoleucine (Valine, leucine and isoleucine biosynthesis), fatty acid metabolism (Fatty acid metabolism), diterpenoid biosynthesis, and the biosynthesis pathway of various plant secondary metabolites (Diterpenoid biosynthesis, Biosynthesis of various plant secondary metabolites) Figure 6D ).

[0167] Figure 6A To identify the candidate target genes based on DNA affinity purification sequencing OsCSA The figure of the enrichment region;

[0168] Figure 6B To show the number of unique sites and common sites combined in two technical repeat experiments OsCSA Venn diagram of the number of unique sites and common sites combined

[0169] Figure 6C To show the number of unique sites and common sites combined OsCSA GO enrichment analysis chart of the candidate target genes combined

[0170] Figure 6D To show the number of unique sites and common sites combined OsCSA KEGG enrichment analysis chart of the candidate target genes combined

[0171] 4.2 OsCSA Preliminary determination of candidate targets

[0172] Given that the melatonin content of the overexpression strain above ground was significantly higher than that of WT under copper treatment OsCSA ), and KEGG enrichment analysis showed that the candidate targets of Figure 5E were mainly concentrated in the biosynthesis pathway of plant secondary metabolites OsCSA ), and melatonin belongs to plant secondary metabolites, we narrowed down the range of Figure 6D candidate targets to genes related to melatonin synthesis, and proposed the hypothesis that OsCSA by regulating the expression of genes related to melatonin synthesis, the content of melatonin and the copper stress resistance of rice were affected. OsCSA

[0173] Screening of candidate target genes containing binding sites obtained by DAP-Seq analysis, among which OsCOMT6, OsCOMT9, OsCOMT12, OsASMT17 and OsCOMT33 were found to be related to melatonin synthesis.

[0174] Preliminary verification by EMSA experiment found that OsCSA and OsCOMT9 were related to melatonin synthesis.​OsCOMT12 The interaction of promoters is most pronounced. Figure 7A ); detection in the aboveground parts of wild-type rice under copper stress and exogenous melatonin treatment. OsCOMT9 and OsCOMT12 The expression levels of two genes were analyzed, and it was found that copper stress significantly inhibited the expression of both genes, while exogenous application of melatonin significantly increased their expression. OsCOMT9 The expression level was restored to that under normal culture conditions. Furthermore, in OsCSA Detection in overexpressing plants OsCOMT9 and OsCOMT12 The expression levels of the two genes were found to be different under both normal and Cu treatment conditions. OsCSA The expression levels in the overexpression lines were significantly higher than those in the WT line. Figure 7B ),show OsCSA Possibly through positive regulation OsCOMT9 and OsCOMT12 The expression of [a specific substance] mediates the copper stress response in rice.

[0175] Figure 7A EMSA Validation OsCSA A diagram showing the results of interactions between genes related to melatonin synthesis;

[0176] Figure 7B For different processing WT and OsCSA Overexpression lines OsCOMT9 and OsCOMT12 The expression level results are shown in the figure.

[0177] 4.3 OsCSA Interaction verification with candidate targets

[0178] First, by using MEME software and performing visualization analysis, the following were identified: OsCSA The new motif sequence at the binding site—“GTTA / TAAC” ( Figure 8A ). OsCOMT9 and OsCOMT12 The promoter contains this element ( Figure 8C and Figure 8F ),show OsCOMT9 and OsCOMT12 may be OsCSA Downstream target genes.

[0179] Figure 8A for OsCSA A map of DNA binding sites;

[0180] Figure 8B for OsCOMT9 Visualization and analysis diagrams of potential target genes;

[0181] Figure 8C For GTTA in OsCOMT9Schematic diagram of distribution in promoter

[0182] Figure 8D For OsCSA DNA binding site map

[0183] Figure 8E For OsCOMT12 Visualization and analysis map of potential target genes

[0184] Figure 8F For TAAC in OsCOMT12 Schematic diagram of distribution in promoter

[0185] Using yeast one-hybrid experiment to further determine OsCSA whether directly involved in regulating the transcription of OsCOMT9 and OsCOMT12 In rice, first, whether there is self-activation activity of OsCOMT9 and OsCOMT12 promoters in yeast system was detected (experimental method reference 1.7), it was found that OsCOMT9 and OsCOMT12 promoters could grow normally on SD / -Leu plate, and could not grow single colony by adding 100-900 ng / mL of AbA (Aureobasidin A, AbA) Figure 9A , indicating that OsCOMT9 and OsCOMT12 promoters may have self-activation phenomenon, and the occurrence of self-activation can be inhibited after adding 100 ng / mL AbA. Therefore, the concentration of 100 ng / mL AbA was selected for subsequent verification experiment, and it was preliminarily confirmed that the transcription factor OsCSA and OsCOMT9 and OsCOMT12 promoters grew obvious single colony on SD / -Leu plate, indicating that the transformation was successful Figure 9B ). The single colony of pGADT7- OsCSA co-transformed with pAbAi- proOsCOMT9 could not grow normally on SD / -Leu+100 ng / mL AbA plate, while the single colony of pGADT7- OsCSA co-transformed with pAbAi- proOsCOMT12 could grow normally on SD / -Leu+100 ng / mL AbA plate, indicating that OsCSA only interacted with the promoter of OsCOMT12 . Figure 9B .

[0186] Figure 9A For OsCOMT9 and OsCOMT12 self-activation activity analysis diagram of promoters in yeast system

[0187] Figure 9B Validation of yeast single-hybridization OsCSA and OsCOMT9 and OsCOMT12 Interaction diagram of promoters.

[0188] The competitive EMSA experiment (experimental method reference 1.9) was used to further verify whether OsCSA is related to... OsCOMT12 The promoter binds directly, and it is found that OsCSA-His Fusion proteins can combine with in vitro OsCOMT12 The promoter probe binds but not to the mutant probe, and by adding an unlabeled probe, it competes with the biotin-labeled probe, indicating that... OsCSA and OsCOMT12 direct interaction between promoters ( Figure 10 ).

[0189] Figure 10 for OsCSA Combination OsCOMT12 Figure showing the results of a competitive EMSA experiment on the promoter.

[0190] In addition, the dual-luciferase activity assay (LUC) was used to confirm the results (see experimental method 1.8). OsCSA Transcription activation or transcriptional repression OsCOMT12 The expression of pGreenII 0800-LUC-OsCOMT12+pGreenII 62-SK-CSA was found to induce a stronger LUC signal compared to pGreenII 0800-LUC-OsCOMT12+pGreenII 62-SK. Figure 11C ),show OsCSA Through with OsCOMT12 The promoter binds directly, activating transcription.

[0191] Figure 11A A schematic diagram of the important structures of effector and reporter vectors;

[0192] Figure 11B In Benedict's tobacco leaves OsCSA Transcription activation OsCOMT12 Fluorescence imaging;

[0193] Figure 11C This is a graph showing the quantitative results of LUC activity in Benedict's tobacco leaves.

[0194] Example 5

[0195] The appropriate concentration of melatonin (30 μM in rice culture solution is the best) is directly applied to the root of rice (copper stress condition, refer to example 1), and it is particularly important to note that the concentration of melatonin is crucial to improve the copper stress resistance of rice. The present application finds that a lower concentration of melatonin (10 μM) has little effect on relieving copper stress, and a higher concentration of melatonin (≥70 μM) not only has no effect on improving resistance, but also aggravates the damage of copper stress to rice. The phenotypes of each group are shown in the following table. Figure 12 ;

[0196] Figure 12 The phenotypes of rice with different concentrations of exogenous melatonin (MT) under copper stress treatment.

[0197] Summary:

[0198] 1. The present application proves that OsCSA the gene has the ability to improve the copper stress resistance of rice.

[0199] 2. The present application verifies that the appropriate concentration of melatonin has the ability to improve the copper stress resistance of rice.

[0200] 3. The present application proves that copper stress treatment inhibits the expression of transcription factor OsCSA , and OsCSA promotes the transcription of OsCOMT12 by binding to the GTTA element in the promoter, ultimately increases the accumulation of melatonin, reduces the Cu content in the body, and improves the copper stress resistance of rice. OsCOMT12

[0201] 4. The present application proves that 30 μM-50 μM melatonin can effectively relieve copper stress by applying different concentrations of exogenous melatonin to rice under copper stress.​

Claims

1. Overexpression OsCSA application of the gene in improving the resistance of rice to copper stress, the gene OsCSA The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. Overexpression OsCSA A method for increasing the tolerance of rice to copper stress, said method comprising the step of overexpressing in a rice plant a gene having the nucleotide sequence of SEQ ID NO.

1. OsCSA A method for increasing the tolerance of rice to copper stress, said method comprising the step of overexpressing in a rice plant a gene having the nucleotide sequence of SEQ ID NO. 1.

Images