Application of the DkHOS15 gene in regulating persimmon anthocyanin biosynthesis
By overexpressing the DkHOS15 gene in persimmon, constructing a recombinant vector, and performing gene transformation, the problem of unclear regulatory network for persimmon proanthocyanidin synthesis was solved, significant accumulation of soluble tannins was achieved, and the metabolic regulation of persimmon proanthocyanidins was enriched.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUAZHONG AGRI UNIV
- Filing Date
- 2025-08-29
- Publication Date
- 2026-06-30
AI Technical Summary
The regulatory network for anthocyanin synthesis in persimmon is unclear, which affects the improvement of sweet persimmon germplasm and the transformation of astringent persimmons into sweet persimmons. Existing technologies lack effective gene regulation methods.
By using the DkHOS15 gene to regulate the biosynthesis of persimmon proanthocyanidins through overexpression, a recombinant vector was constructed and gene transformation was achieved in persimmon tissue culture seedlings using Agrobacterium-mediated transformation, thereby promoting the synthesis of soluble tannins.
It enriched the transcriptional regulatory network of persimmon proanthocyanidin synthesis, significantly increased the accumulation of soluble tannins, and improved the metabolic pathway of persimmon proanthocyanidins.
Smart Images

Figure CN121046430B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, and in particular relates to the application of the DkHOS15 gene in regulating the synthesis of persimmon proanthocyanidins. Background Technology
[0002] Persimmon (Diospyros kaki Thunb., 2n=6x=90) is a plant belonging to the genus Diospyros L. of the family Ebenaceae. Persimmon originated in China, and major producing countries include China, Spain, Japan, and South Korea. In my country, the main persimmon producing areas are widely distributed across 23 provinces, municipalities, and autonomous regions in the Yellow River Basin, Yangtze River Basin, and their southern regions. Based on whether the fruit can naturally lose its astringency at maturity and its genetic characteristics, existing persimmon varieties are divided into completely sweet persimmons (PCNA), where the sweetness and astringency trait is inherited as a qualitative trait, and incompletely sweet persimmons (non-PCNA), where the sweetness and astringency trait is inherited as a quantitative trait. A report on PCNA types includes the Chinese-origin completely sweet persimmon (C-PCNA, Chinese PCNA) and the Japanese-origin completely sweet persimmon (J-PCNA, Japanese PCNA) (Akagi et al., 2011).
[0003] Proanthocyanidins (PAs, also known as condensed tannins) are a type of plant flavonoid, abundant in the vacuoles of "tannin cells" in persimmon fruits. They polymerize with proteins in the human oral cavity, producing astringency and causing a dry, astringent sensation (Taira, 1996). Based on their solubility in alcoholic solutions, they can be divided into soluble and insoluble tannins. The biosynthesis of proanthocyanidins involves four processes: the shikimic acid synthesis pathway, the common phenylpropane synthesis pathway, the core flavonoid-anthocyanin synthesis pathway, and the proanthocyanidin-specific synthesis pathway (Xie and Dixon, 2005).
[0004] Proanthocyanidin biosynthesis is extensively regulated by transcription. Current reports mainly focus on three transcription factors: MYB, bHLH, and WD40, which regulate the transcriptional expression of proanthocyanidin synthesis-related genes in the form of the MBW ternary protein complex (Koes et al. 2005; Lloyd et al. 2017; Yu et al. 2023). The WD40 protein structure is highly conserved, generally containing 4–16 tandem WD motifs. Each WD motif contains a conserved sequence of approximately 40 amino acid residues, starting with an N-terminal GH dipeptide (Gli-His, GH) and ending with a C-terminal WD (Trp-Asp, WD). The typical Gβ subunit endows the WD40 family with the function of mediating protein-protein interactions and regulating the assembly of protein complexes (Min, 2010).
[0005] The genetic background of cultivated persimmon (D. kaki Thunb.) is complex, and the regulatory network of persimmon proanthocyanidin synthesis remains unclear. Therefore, elucidating the molecular mechanisms of persimmon proanthocyanidin formation and regulation is of great significance for the germplasm improvement of sweet persimmons and the "sweetening" of astringent persimmons. Summary of the Invention
[0006] The purpose of this invention is to provide the application of the DkHOS15 gene in regulating the biosynthesis of proanthocyanidins in persimmon. This gene is a positive regulatory structural gene for proanthocyanidin synthesis and plays a role in promoting the accumulation of proanthocyanidins in persimmon fruit. Therefore, the accumulation pattern of persimmon proanthocyanidins can be regulated by controlling the expression of the DkHOS15 gene.
[0007] To achieve the above objectives, this invention provides the application of the DkHOS15 gene in regulating the biosynthesis of persimmon proanthocyanidins. The nucleotide sequence of the DkHOS15 gene is shown in SEQ ID NO.1.
[0008] Furthermore, in application, overexpression of the DkHOS15 gene in persimmon promotes the synthesis of soluble tannins in persimmon.
[0009] The present invention also provides a DkHOS15 protein that regulates the biosynthesis of persimmon proanthocyanidins. The amino acid sequence of the DkHOS15 protein is shown in SEQ ID NO.2, and its encoding gene is the DkHOS15 gene. The nucleotide sequence of the DkHOS15 gene is shown in SEQ ID NO.1.
[0010] This invention also provides the application of the above-mentioned DkHOS15 protein in regulating the biosynthesis of persimmon proanthocyanidins.
[0011] The present invention also provides a recombinant vector comprising the DkHOS15 gene as shown in SEQ ID NO.1.
[0012] Furthermore, this recombinant vector is a plant overexpression vector.
[0013] This invention also provides the application of the above-mentioned recombinant vector in regulating the biosynthesis of persimmon proanthocyanidins.
[0014] The present invention also provides a recombinant bacterium comprising the above-described recombinant vector.
[0015] This invention also provides the application of the above-mentioned recombinant bacteria in regulating the biosynthesis of persimmon proanthocyanidins.
[0016] This invention also provides a method for regulating the synthesis of persimmon proanthocyanidins, comprising the following steps:
[0017] S1. Construct a recombinant vector containing the recombinant vector of claim 5;
[0018] S2. Introduce the recombinant vector into Agrobacterium to obtain recombinant bacteria;
[0019] S3. Using Agrobacterium-mediated transformation, the recombinant bacteria were used to infect persimmon tissue culture seedlings, and transgenic plants were obtained through culture and screening.
[0020] This invention also provides the application of the above method in persimmon germplasm improvement.
[0021] Compared with the prior art, the present invention has the following advantages and technical effects:
[0022] (1) This invention used GWAS to screen the DkHOS15 gene by comparing the expression patterns of candidate genes within the AST linkage region with the tannin accumulation pattern in persimmon. The function of this gene in persimmon has not been studied, but it can positively regulate the biosynthesis of persimmon proanthocyanidins. The nucleotide sequence of the DkHOS15 gene is shown in SEQ ID NO.1, and the corresponding protein sequence is shown in SEQ ID NO.2. This invention enriches the transcriptional regulatory network of persimmon proanthocyanidin synthesis.
[0023] (2) The present invention identifies the function and regulatory mechanism of the DkHOS15 gene, which is of great significance for further enriching and improving the persimmon anthocyanin metabolism pathway.
[0024] The technical solution of the present invention will be further described in detail below with reference to the accompanying drawings and embodiments. Attached Figure Description
[0025] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments of the present invention will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0026] Figure 1 This is an analysis of the expression level of the DkHOS15 gene at different fruit development stages of persimmons with different astringency-reducing types. Non-PCNA represents non-completely sweet persimmons, and J-PCNA represents Japanese sweet persimmons.
[0027] Figure 2 This study measured the tannin content in persimmon leaves after transient overexpression of the DkHOS15 gene. In the figure, A represents the expression level of DkHOS15 after transient overexpression, B represents the soluble tannin content, C represents the insoluble tannin content, and "***" indicates significance.
[0028] Figure 3 This involves a yeast one-hybrid assay to verify the interaction between the DkHOS15 and DkMYB4 promoters.
[0029] Figure 4It is a detection method for transient expression of dual-luciferase activity in tobacco. Detailed Implementation
[0030] The technical solution of the present invention will be further described below through embodiments.
[0031] Unless otherwise defined, the technical or scientific terms used in this invention shall have the ordinary meaning as understood by one of ordinary skill in the art to which this invention pertains.
[0032] Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without inventive effort are within the scope of protection of this invention. Experimental methods in the following embodiments that do not specify specific conditions are generally determined according to national standards. Experimental instruments, equipment, and reagents in the following embodiments that do not specify their sources are all commercially available materials.
[0033] Unless otherwise defined or stated, all technical and scientific terms used in this invention have the same meaning as those skilled in the art. Furthermore, any methods and materials similar to or equivalent to those described herein can be applied to the methods of this invention. It should be noted that, unless otherwise specified, the embodiments and features described in this invention can be combined with each other.
[0034] The persimmons used in the experiments of this invention were all collected from the persimmon orchard of Huazhong Agricultural University (Wuhan, China).
[0035] Example 1
[0036] 1. RNA was extracted from fruits of different developmental stages of persimmon varieties 'Luotian Sweet Persimmon' (C-PCNA) and 'Yangfeng' (J-PCNA) with different astringency removal types, and then reverse transcribed into cDNA for real-time quantitative PCR experiments (qRT-PCR).
[0037] Total RNA was extracted from the fruit using the Magen Total RNA Extraction Kit (for plants with difficult extraction), and reverse transcription was performed using the PrimeScript™ RT reagent Kit with gDNAEraser (Takara Bio). qRT-PCR experiments were conducted using SYBR Premix Ex Taq II reagent (Takara Bio), prepared according to the manufacturer's instructions, and then analyzed using an ABI QuantStudio 7Flex Real-Time PCR instrument.
[0038] The reaction program was as follows: Stage 1 (1 cycle): 50℃ for 2 min, 95℃ for 10 min; Stage 2 (40 cycles): 95℃ for 10 s, 58℃ for 30 s, 72℃ for 30 s; Stage 3 (1 cycle): 95℃ for 15 s, 60℃ for 60 s, 95℃ for 15 s. Each gene amplification was accompanied by D. kaki Thunb. Actin (GenBank accession number No. AB219402) as an internal control gene. The nucleotide sequences of the DkHOS15 quantitative primers are shown in SEQ ID NO.3: GTACTGGCAAGTGC CTCCTT and SEQ ID NO.4: CAGGATCCCTGTGGCCATTT, and the nucleotide sequences of the DkACTIN quantitative primers are shown in SEQ ID NO.5: CATGGAGAAAATCTGGCATCATAC and SEQ ID NO.6: GAA GCACTGGGTGCTCTTCTG. All results are shown as mean (SD) with corresponding standard deviations.
[0039] Experimental results are as follows Figure 1 As shown, the expression pattern of DkHOS15 is highly correlated with the tannin accumulation pattern of sweet and astringent persimmons. The expression pattern basically conforms to the natural deastringency characteristics of sweet persimmons. It is highly expressed in astringent persimmons and lowly expressed in sweet persimmons, and the expression level gradually decreases as the fruit develops.
[0040] II. DkHOS15 gene-specific primers SEQ ID NO. 7: GAGACACGGGGACTCTAGAATGGTGTCGTTAACTTCGGCC and SEQ ID NO. 8: GGACTGACCACCCGGGGATCCCCTACATGCGGAAATCCAAGAC with restriction enzyme sites (Xba I and BamHI) were designed to amplify the DkHOS15 gene CDS sequence, which was then integrated into an overexpression vector driven by the CaMV 35S promoter. The overexpression recombinant vector exhibited Kan resistance in both bacteria and plants. The recombinant vector 35S:DkHOS15 was then transformed into Agrobacterium GV3101 strain via chemical transformation.
[0041]
[0042] The amino acid sequence of the protein encoded by the DkHOS15 gene is shown in SEQ ID NO.2.
[0043] (1) DkHOS15 overexpressing persimmon leaf material was obtained by transiently infecting persimmon leaves with Agrobacterium tumefaciens suspension containing the 35S:DkHOS15 recombinant vector and control group (Agrobacterium tumefaciens suspension containing empty vector). The specific experimental steps are as follows:
[0044] Agrobacterium activation: The DkHOS15 overexpression vector and the empty control vector were streaked and activated on LB solid medium containing 50 mg / L Rif and 50 mg / L Kan, and then the bacterial culture was shaken vigorously.
[0045] Preparation of Agrobacterium tumefaciens inoculum for DkHOS15 overexpression vector: Shake the bacterial culture until it turns pink to orange-yellow, then stop culturing and collect the cells by centrifugation. Resuspend the cells in osmotic buffer (containing 10 mM MES, 10 mM MgCl2, and 200 μM acetylsylcholine), and adjust the OD values of the overexpression vector and its empty bacterial culture. 600=0.75, incubated at room temperature for 2 hours (overexpression vector control group was empty overexpression vector);
[0046] Vacuum infiltration: The entire tissue culture seedling of "Gongcheng Water Persimmon" was immersed in Agrobacterium infection solution and placed in a vacuum device (0.8MPa) for 15 minutes. The bacterial solution was dried on sterile filter paper and then inoculated into subculture medium (DKW + 3% sucrose + 0.1mg / L IAA + 1.0mg / L ZT).
[0047] Leaf processing and preservation: Take one leaf, remove the veins, and weigh 0.1g of the processed leaf into a 2mL centrifuge tube. This leaf will be used to determine the soluble and insoluble tannin content separately. The remaining leaf will be preserved in a sealed bag for RNA extraction and subsequent quantitative analysis. Both leaf samples should be immediately flash-frozen in liquid nitrogen and stored at -80℃. Repeat the above steps to process the remaining leaves (process and preserve the leaves as quickly as possible).
[0048] (2) The contents of soluble and insoluble tannins in the leaves were determined. The specific experimental steps are as follows:
[0049] 1) Extraction and determination of soluble tannins:
[0050] ① Weigh 0.1g of leaf sample, grind thoroughly with liquid nitrogen, add 5mL of 70% acetone (containing 1% ascorbic acid), vortex mix well, and place on a shaking table to shake for 1 hour in the dark;
[0051] ② After centrifuging at 12000g for 10 minutes, transfer the supernatant to a new 10mL centrifuge tube; open the cap of the centrifuge tube containing the precipitate and allow the precipitate to air dry.
[0052] ③ Add an equal volume of chloroform (about 4 mL) to the supernatant, mix well for 5 min, centrifuge at 12000g for 10 min, and collect the supernatant;
[0053] ④ Repeat step ③;
[0054] ⑤ Add an equal volume of n-hexane to the supernatant containing soluble tannins, mix well and centrifuge (4000g, 10min). Transfer the lower layer to a new centrifuge tube. This is the final test solution containing soluble tannins.
[0055] ⑥ Take 1 mL of the test solution and add 1 mL of 0.2% DMACA solution, mix well, react in the dark for 20 min, and then measure the OD. 640 (Note: Before the reaction, a preliminary experiment should be conducted with the test solution to see if dilution with acetone is necessary before absorbance measurement.) Soluble tannins should be quantified according to the standard curve of catechins.
[0056] 2) Extraction and determination of insoluble tannins:
[0057] ① Add 5 mL of 5% hydrochloric acid-n-butanol solution to the dried precipitate residue in step ② of step 1), mix well, and sonicate at room temperature for 1 hour. If the sonication time is too long, the water temperature will easily rise. Be careful to control the water temperature and avoid it from getting too hot.
[0058] ② Centrifuge the sonicated solution (4000g, 10min) and collect the supernatant. Divide the supernatant into two equal portions: take 2mL of one portion into an OD... 550 Measure the absorbance; place another sample in a 15 mL centrifuge tube, boil for 1 hour (in a fume hood), cool to room temperature, and then measure the OD. 550 Absorbance. A standard curve was prepared using proanthocyanidin B1 after performing the same procedures as above to quantify insoluble tannins. The content of insoluble tannins was obtained by subtracting the two measured values.
[0059] The results are as follows Figure 2 As shown, transient overexpression of DkHOS15 in persimmon leaves significantly increased the expression level of DkHOS15. The tannin content in the leaves was measured, and the results showed that compared with the control group, the soluble tannin content in the experimental group was significantly increased, while the insoluble tannin content did not change significantly.
[0060]
[0061] (1) For yeast transformation, refer to the product manual of Y1HGold Chemically Competent Cell (Weidi Biotechnology). The specific steps for transformation are as follows:
[0062] 1) Linearization of pBait-AbAi vector
[0063] The pBait-AbAi vector that was correctly sequenced was linearized using the Bbs I enzyme.
[0064] 2) Y1HGold yeast competent cell transformation
[0065] ① Take 100 μL of Y1HGold competent cells thawed on ice, add 1-5 μg (volume less than 15 μL) of pre-cooled linear pBait-AbAi plasmid, 10 μL of carrier DNA (95-100℃ for 5 min, quick ice bath, repeat once), and 500 μL of PEG / LiAc, and mix by pipetting several times.
[0066] ②Incubate in a 30℃ water bath for 30 minutes (tumble 6-8 times after 15 minutes to mix thoroughly);
[0067] ③ Incubate in a 42℃ water bath for 15 minutes (tumble 6-8 times at 7.5 minutes to mix thoroughly);
[0068] ④ Centrifuge at 5000g for 40s and discard the supernatant. Resuspend in 400μL H2O and centrifuge for 30s and discard the supernatant.
[0069] ⑤ Resuspend in 50 μL H2O, spread on SD / -Ura plates, and incubate at 28℃ for 72 h.
[0070] ⑥ Select 5-10 clones and use PCR to confirm that pBait-AbAi is integrated into the Y1HGold genome. PCR-positive strains are streaked on SD / -Ura plates, cultured at 28℃ for 72 h, and stored at 4℃. This strain is the Y1HGold[Bait / AbAi] strain.
[0071] 3) Screening for yeast bait strains with the lowest AbA inhibition concentration
[0072] ① Pick positive single clones and incubate them overnight at 30℃ and 250r / min in liquid medium containing SD / -Ura / -Leu, until the bacterial culture OD 600 = Approximately 0.2;
[0073] ② Take 10 μL of the shaken bacterial solution and drop it onto SD / -Ura / -Leu solid medium containing different AbA concentrations, and air dry it on a clean bench;
[0074] ③ After sealing the plate with sealing film, place it in a 30℃ constant temperature incubator and invert it for 3-5 days. Observe the growth of spots and select the lowest ABA inhibition concentration.
[0075] 4) Preparation of yeast competent cells
[0076] The bait strain obtained in step 2) was prepared into competent yeast cells. The preparation method for 10 mL of 1.1X TE / LiAc solution (freshly prepared) is as follows: 1.1 mL TE (10×) buffer, 1.1 mL 1 mol / L LiAc (10×), and 7.8 mL H₂O. The method for preparing competent cells is as follows:
[0077] ① Streaking the yeast-positive strain onto SD / -Ura solid medium with an inoculation loop, incubate upside down in a 28°C incubator, and colonies will grow in about 3 days;
[0078] ② Pick a single clone into a 15mL centrifuge tube containing 3mL of SD / -Ura liquid medium, and incubate at 30℃ with shaking at 250r / min for 8-12h;
[0079] ③ Transfer 50 μL of the above culture into a 250 mL Erlenmeyer flask containing 50 mL of SD / -Ura liquid medium, and incubate at 30 °C with shaking at 250 rpm for 16-20 h, until OD is reached. 600 The value reaches 0.15-0.3;
[0080] ④ Centrifuge at 700g for 10 min at room temperature, discard the supernatant, resuspend the bacterial cells in 100mL of fresh YPDA liquid, transfer the bacterial solution to a 250mL Erlenmeyer flask, and incubate at 30℃ with shaking at 250r / min for about 3-5 hours to allow OD to develop. 600 A value of 0.4-0.5 is acceptable;
[0081] ⑤ OD 600 Centrifuge the bacterial culture at 700g for 10 min at room temperature when the pH reaches 0.4-0.5, discard the supernatant, and then add 15mL of sterile deionized water to the centrifuge tube to suspend the bacterial cells.
[0082] ⑥ Centrifuge at 700g for 10 min at room temperature, discard the supernatant, dissolve the bacterial cells with 1.5 mL of 1.1×TE / LiAc, then transfer the bacterial cells to a 1.5 mL centrifuge tube, centrifuge at high speed for 15 s, and discard the supernatant;
[0083] ⑦ Add 600 μL of 1.1×TE / LiAc to a 1.5 mL centrifuge tube for suspension and place on ice.
[0084] 5) Heat shock method for transforming yeast competent cells
[0085] ①At 95℃ for 5 min, denature the carrier DNA, then quickly insert it into ice to cool;
[0086] ② Repeat step ① once;
[0087] ③ Take 0.1 μg of recombinant plasmid (PGADT7-DkHOS15 and PGADT7 empty vector) and add it to 5 μL of denatured carrier DNA. Mix well with a pipette, add 50 μL of prepared yeast competent cells, and finally add 500 μL of PEG / LiAc and mix gently.
[0088] ④ Incubate at 30℃ for 30 minutes, gently mixing once every 10 minutes;
[0089] ⑤ Add 20 μL of dimethyl sulfoxide to each sample and mix gently;
[0090] ⑥ Heat shock at 42℃ for 15 minutes, and gently mix every 5 minutes;
[0091] ⑦ Centrifuge at high speed for 15 seconds and discard the supernatant. Resuspend in 1 mL of YPD Plus medium;
[0092] ⑧ Incubate at 30℃ with shaking for 30 min;
[0093] ⑨ Centrifuge at high speed for 15 seconds, discard the supernatant, and resuspend in 1 mL of 0.9% (w / v) NaCl solution;
[0094] ⑩ Spread an appropriate amount of the resuspension evenly on an SD / -Ura-deficient medium plate, incubate at 30°C for 3 days, pick single colonies and perform positive identification. Spot-test the interaction of positive co-transformed yeast cells on SD / -Ura / -Leu / AbA-deficient medium.
[0095] like Figure 3 As shown, the Y1H system was used to detect whether DkHOS15 interacts with the DkMYB4 promoter. Bait (pAbAi-DkMYB4pro) and Prey (PGADT7-DkHOS15) were co-transferred pairwise into the yeast strain Y1Hgold and cultured on a deficient medium. The growth of the yeast strain was observed. On SD-Ura / Leu medium supplemented with 25 ng / mL AbA, only pAbAi-DkMYB4pro (first fragment) + PGADT7-DkHOS15 and the positive control grew normally. This indicates that DkHOS15 interacts with the DkMYB4 promoter.
[0096] IV. Design DkHOS15 gene-specific primers with vector homologous arms (SEQ ID NO.20: CGCTCTAGA ACTAGTGGATCCATGGTGTCGTTAACTTCGGCC and SEQ ID NO.21: GATAAGCTTGATATCGAATTCCTACATGCGGAAATCCAAGAC), and insert their amplification products between the restriction sites (BamHI and EcoRI) of the pGreenII 62-SK vector. Design DkMYB4 promoter-specific primers with vector homologous arms (SEQ ID NO.22: GGTACCGGGCCCCCCCTCGAGGGTGGCTTGAAAGGGAGTAAC and SEQ ID NO.23: TGTTTTTGGCGTCTTCCATGGTCTTCCCATCTCTTCTTCTGA), add corresponding restriction sites (Sal I and Hind III) at both ends, and insert the amplification products between the restriction sites of the pGreenII 0800-LUC reporter vector. After the constructed vector was confirmed to have a correct sequence by sequencing, plasmid DNA was extracted and transformed into Agrobacterium competent cells GV3101 containing pSoup+p19 plasmid, along with the empty vector.
[0097] (1) Transient expression in tobacco, the specific experimental steps are as follows:
[0098] ① Remove the transformed GV3101 Agrobacterium from -80℃, streak culture, and pick single colonies. Inoculate into 5 mL LB liquid medium (containing 50 mg / L Rif and 50 mg / L Kan), and incubate at 28℃ and 250 r / min with shaking for 48 h;
[0099] ② Add 500 μL of the activated bacterial culture to 50 mL of LB liquid medium (containing 50 mg / L Rif and 50 mg / L Kan) for expansion culture until OD. 600 Values range from 0.6 to 0.8, approximately 6-8 hours.
[0100] ③ Transfer the bacterial culture to a 50mL centrifuge tube, centrifuge at 4000r / min for 5min, discard the supernatant, and collect the bacterial cells;
[0101] ④ Add 10 mL of permeation buffer (containing 10 mM MES, 10 mM MgCl2, 150 μM AS, pH 5.6) to resuspend the bacterial cells;
[0102] ⑤ Centrifuge at 4000 r / min for 5 min, discard the supernatant, collect the bacterial cells, and resuspend them in 5 mL of permeate;
[0103] ⑥ Measure the OD of each effector and reporter separately.600 The infusion solution was prepared by mixing Effector and Reproter at a ratio of 5:1, and then bringing the total volume to 10 mL with osmotic buffer. The prepared infusion solution was allowed to stand at room temperature for 3 hours to activate. Using a 1 mL disposable syringe, the infusion solution was injected into the underside of tobacco leaves (watering was stopped 2-3 days prior to injection). Each combination was repeated three times. An empty vector (pGreenII 62-SK) + Effector mixed infusion solution served as a control. After infusion, the leaves were labeled and returned to the light incubator for further cultivation. The dual-luciferase activity in the infused leaves was measured after 3 days.
[0104] (2) Dual-luciferase activity assay, using The Reporter Assay System (Promega, USA) kit was used to detect the activities of firefly luciferase (LUC) and sea cucumber luciferase (REN). The detection method is described in the instruction manual, and the specific operating steps are as follows:
[0105] 1) Preparation of relevant reagents in the dual-fluorescein detection kit
[0106] ①Passive Lysis Buffer (PLB): Each time, dilute 5 times the volume of PLB to 1 volume of PLB according to the amount used;
[0107] ② Luciferase Assay Reagent II (Luc II): Mix the substrate with the buffer and dispense into 10 tubes, then store at -80°C;
[0108] ③Stop and Reagent (Stop and Glo): Each time, draw the substrate into a buffer 50 times its volume, depending on the amount used.
[0109] 2) Dual-luciferase activity assay
[0110] ① Add 50 μL of 1×PLB reagent to the wells of the white microplate;
[0111] ② Take tobacco leaves that have been soaked for 3 days, and use a 0.5cm diameter punch to remove a certain number of discs (1 disc per well). Place them into the wells of a white ELISA plate, repeating 6 times.
[0112] ③ Briefly heat the tip of the 200μL pipette over an alcohol lamp, then immediately press it onto the table to flatten the tip. Use the prepared pipette tip to manually grind the blade. It is best to do the grinding process on ice and in a dark environment.
[0113] ④ After grinding, let stand for 10 minutes (dark conditions are better), and then turn on the microplate reader (Tecan Infinite M200, Switzerland);
[0114] ⑤ Add 50 μL of Luc II to each well, gently shake the microplate for 10 seconds, let it stand for 10 minutes, and measure the Luc activity using the Luminescence method.
[0115] ⑥ Add 50 μL of Stop and Glo reagent, shake for 10 seconds, let stand for 10 minutes, and measure Ren activity. By comparing the Luc / Ren ratio, analyze the effect of transcription factors on promoter transcription activity.
[0116] The results are as follows Figure 4 As shown, Reporter (DkMYB4pro-0800-LUC) and Effector (DkHOS15-62-SK) were co-transformed into tobacco, and the changes in LUC / REN were detected. The results showed that the DkMYB4 promoter activity was significantly increased after co-transformation with DkHOS15. These results indicate that DkHOS15 can enhance the activity of the DkMYB4 promoter.
[0117] Therefore, this invention confirms that DkHOS15 is a positively regulating transcription factor gene for persimmon proanthocyanidin synthesis, and has the function of promoting the accumulation of persimmon proanthocyanidins. It provides a key gene resource for the targeted regulation of persimmon proanthocyanidins, which is of great significance for optimizing the tannin content of persimmon fruits, improving persimmon fruit quality, and promoting persimmon germplasm improvement.
[0118] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.
Claims
1. DkHOS15 The application of genes in regulating the biosynthesis of persimmon anthocyanins is characterized by, The DkHOS15 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
2. The application according to claim 1, characterized in that, Overexpression in persimmon DkHOS15 Genes that promote the synthesis of soluble tannins in persimmons.
3. The application of DkHOS15 protein in regulating the biosynthesis of persimmon anthocyanins, characterized in that, The amino acid sequence of the DkHOS15 protein is shown in SEQ ID NO.2, and its encoding gene is as described in claim 1. DkHOS15 Gene, DkHOS15 The nucleotide sequence of the gene is shown in SEQ ID NO.
1.
4. The application of a recombinant vector in regulating the biosynthesis of persimmon anthocyanins, characterized in that, The recombinant vector comprises the one described in claim 1. DkHOS15 Gene; the recombinant vector is a plant overexpression vector.
5. The application of a recombinant bacterium in regulating the biosynthesis of persimmon proanthocyanidins, characterized in that, The recombinant bacteria comprises the recombinant vector as described in claim 4.
6. A method for regulating the synthesis of persimmon proanthocyanidins, characterized in that, Includes the following steps: S1. Constructing a structure containing the contents described in claim 1 DkHOS15 Gene recombination vectors; S2. Introduce the recombinant vector into Agrobacterium to obtain recombinant bacteria; S3. Using Agrobacterium-mediated transformation, the recombinant bacteria were used to infect persimmon tissue culture seedlings, and transgenic plants were obtained through screening and cultivation.
7. The application of the method of claim 6 in persimmon germplasm improvement.