Application of quinazoline composition targeting NF-kappa B

The quinazoline compound FBPQD addresses the issues of low bioavailability and poor stability of existing NF-κB-targeting inhibitors by regulating macrophage polarization and inflammatory factor secretion, thereby achieving tissue repair and anti-inflammatory effects.

CN121059611APending Publication Date: 2025-12-05BEIJING ANGOPRO TECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511122616.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-08-12
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

Existing inhibitors targeting NF-κB have limitations in terms of low bioavailability, poor stability, and potential side effects, which restrict their clinical application and promotion.

Method used

The quinazoline compound FBPQD is used to achieve tissue repair, wound healing and anti-inflammatory functions by regulating macrophage polarization, regulating the secretion of inflammatory factors, enhancing angiogenesis and inhibiting fibrosis.

Benefits of technology

FBPQD significantly improves macrophage status under high glucose and inflammatory conditions, regulates key signaling pathways such as NF-κB and PI3K/AKT, and shows good therapeutic potential in in vivo experiments, especially in the medium-dose group, which has the best effect, promoting tissue repair and anti-inflammation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121059611A_ABST
    Figure CN121059611A_ABST
Patent Text Reader

Abstract

The invention discloses application of a quinazoline composition targeting NF-kappa B, and belongs to the field of biological medicine. Through protein docking and molecular simulation, the lowest binding energy and the most stable conformation of the compound FBPQD are determined. In-vitro experiments verify that the FBPQD can significantly improve the state of macrophages in high glucose and inflammatory states, and regulate and control key signal channels such as NF-kappa B, PI3K / AKT and the like. In-vivo experiments prove that the FBPQD shows good treatment potential in a diabetes wound model, and particularly, the effect of a medium-dose (1%) group is optimal; mainly by regulating and controlling macrophage polarization (M1 to M2), secretion of inflammatory factors is regulated, angiogenesis is enhanced, fibrosis is inhibited, and tissue repair is achieved. Therefore, the FBPQD has obvious effects of promoting healing, resisting inflammation, regulating immunity and repairing tissues in an animal model.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological medicine, in particular to the application of a quinazoline composition targeting NF-κB. BACKGROUND

[0002] In the field of anti-inflammatory and anti-tumor drug development, NF-κB signaling pathway has become a target of great concern due to its key regulatory role. This pathway plays an important role in the occurrence and development of various inflammatory diseases and tumors, therefore, regulating NF-κB pathway is of great significance for the development of new anti-inflammatory and anti-tumor drugs.

[0003] Traditional methods mainly regulate NF-κB signaling pathway through non-specific inhibitors, among which the most representative drugs are glucocorticoid drugs, such as dexamethasone, which can interfere with NF-κB activation and reduce the production of pro-inflammatory cytokines. However, these traditional methods have many shortcomings in practical application. First, their selectivity is poor, not only inhibiting the NF-κB pathway, but also affecting other normal physiological processes, leading to widespread side effects. Second, long-term use of these drugs can easily lead to drug resistance, making the treatment effect gradually weaken. In addition, glucocorticoid drugs can also cause a series of adverse reactions, such as osteoporosis, elevated blood sugar, etc., which seriously limit their widespread application in clinical practice.

[0004] In view of the above problems, in recent years, researchers at home and abroad have been exploring new methods in order to achieve specific inhibition of NF-κB pathway. For example, the Guangzhou Institute of Biomedicine and Health and the Guangzhou Medical University jointly developed a small molecule inhibitor named RS47, which targets RelB protein and inhibits its binding to target DNA, thereby specifically inhibiting the non-canonical NF-κB signaling pathway without affecting the canonical NF-κB signaling pathway. In addition, there are studies that achieve cell type-specific targeting of NF-κB inhibition through the "sneaking ligand" method to reduce adverse reactions.

[0005] However, despite the progress made in specific inhibition of NF-κB pathway, there are still some problems to be solved in practical application. For example, the bioavailability of some inhibitors is low, making it difficult to achieve effective concentration in vivo; the stability is poor, and it is easy to degrade during storage or metabolism; in addition, some compounds still have potential side effects, which may adversely affect the health of patients. These deficiencies seriously limit their further clinical application and promotion.

[0006] Although the existing patent solutions have made some progress in specific inhibition of NF-κB pathway, they have not completely solved the problems of low bioavailability, poor stability and potential side effects. SUMMARY

[0007] The application aims to provide an application of a quinazoline composition targeting NF-κB to solve the problems existing in the prior art.

[0008] To achieve the above-mentioned purpose, the application provides the following solutions.

[0009] The application provides an application of a quinazoline composition targeting NF-κB in preparation of a medicine for promoting wound healing, wherein the quinazoline composition comprises FBPQD, the FBPQD is 3-(2-(4-(4-fluorobenzoyl)piperidin-1-yl)-ethyl)quinazoline-2,4(1H,3H)-dione, and the InChI number is 1S / C 22 H 22 FN3O3 / c23-17-7-5-15(6-8-17)20(27)16-9-11-25(12-10-16)13-14-26-21(28)18-3-1-2-4-19(18)24-22(26)29 / h1-8,16H,9-14H2,(H,24,29)。

[0010] The application also provides an application of a quinazoline composition targeting NF-κB in preparation of an anti-inflammatory medicine, wherein the quinazoline composition comprises FBPQD, the FBPQD is 3-(2-(4-(4-fluorobenzoyl)piperidin-1-yl)-ethyl)quinazoline-2,4(1H,3H)-dione, and the InChI number is 1S / C 22 H 22 FN3O3 / c23-17-7-5-15(6-8-17)20(27)16-9-11-25(12-10-16)13-14-26-21(28)18-3-1-2-4-19(18)24-22(26)29 / h1-8,16H,9-14H2,(H,24,29)。

[0011] The application also provides an application of a quinazoline composition targeting NF-κB in preparation of an immunoregulatory medicine, wherein the quinazoline composition comprises FBPQD, the FBPQD is 3-(2-(4-(4-fluorobenzoyl)piperidin-1-yl)-ethyl)quinazoline-2,4(1H,3H)-dione, and the InChI number is 1S / C 22 H 22FN3O3 / c23-17-7-5-15(6-8-17)20(27)16-9-11-25(12-10-16)13-14-26-21(28)18-3-1-2-4-19(18)24-22(26)29 / h1-8,16H,9-14H2,(H,24,29).

[0012] The present application also provides a use of a quinazoline composition targeting NF-κB in the preparation of a medicament for tissue repair, the quinazoline composition comprising FBPQD, the FBPQD being 3-(2-(4-(4-fluorobenzoyl)piperidin-1-yl)-ethyl)quinazoline-2,4(1H,3H)-dione, InChI No. 1S / C 22 H 22 FN3O3 / c23-17-7-5-15(6-8-17)20(27)16-9-11-25(12-10-16)13-14-26-21(28)18-3-1-2-4-19(18)24-22(26)29 / h1-8,16H,9-14H2,(H,24,29).

[0013] Preferably, the quinazoline composition further comprises hyaluronic acid and water.

[0014] Preferably, the quinazoline composition comprises the following amounts of components: hyaluronic acid 1 g, FBPQD 50-200 g, and water 8800-9000 μL.

[0015] Preferably, the quinazoline composition comprises the following amounts of components: hyaluronic acid 1 g, FBPQD 100 g, and water 8900 μL.

[0016] The present application also provides a use of a quinazoline compound targeting NF-κB in any one of the following:

[0017] (1) in the preparation of a medicament for improving the activity of macrophages;

[0018] (2) in the preparation of a medicament for improving the M2 polarization and inhibiting the M1 polarization of macrophages;

[0019] (3) in the preparation of a medicament for promoting the increase of anti-inflammatory factors and growth factors and inhibiting the increase of pro-inflammatory factors in macrophages;

[0020] (4) in the preparation of a medicament for inhibiting the expression of NF-κB, PI3K / AKT and NLRP3 pathways in macrophages;

[0021] The quinazoline compound is FBPQD, the FBPQD is 3-(2-(4-(4-fluorobenzoyl)piperidin-1-yl)-ethyl)quinazoline-2,4(1H,3H)-dione, the InChI number is 1S / C 22 H 22 FN3O3 / c23-17-7-5-15(6-8-17)20(27)16-9-11-25(12-10-16)13-14-26-21(28)18-3-1-2-4-19(18)24-22(26)29 / h1-8,16H,9-14H2,(H,24,29);

[0022] The macrophages are macrophages in a high-sugar-induced state or macrophages in an inflammation state induced by LPS combined with IFN-γ.

[0023] Preferably, the optimal dosage of the FBPQD is 10 μM.

[0024] The present application discloses the following technical effects:

[0025] The present application determines that the FBPQD (FBPQD) compound has the lowest binding energy and the most stable conformation through protein docking and molecular simulation. It is verified through in-vitro experiments that the FBPQD can significantly improve the state of macrophages in a high-sugar and inflammation state, and regulate key signal pathways such as NF-κB and PI3K / AKT. It is verified through in-vivo experiments that the FBPQD shows good treatment potential in a diabetic wound model, especially in a medium-dose (1%) group; the effect is best; the tissue repair is mainly realized by regulating the polarization of macrophages (M1→M2), regulating the secretion of inflammatory factors, enhancing angiogenesis, and inhibiting fibrosis. It is proved that the FBPQD has significant healing promotion, anti-inflammatory, immune regulation, and tissue repair effects in an animal model. BRIEF DESCRIPTION OF DRAWINGS

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0027] Figure 1 Docking results for IKKβ as a candidate target for molecular docking; A: predicted ligand binding site, B: predicted structure;

[0028] Figure 2 Docking results for p65 as a candidate target for molecular docking; A: predicted ligand binding site, B: predicted structure;

[0029] Figure 3 Docking results of TLR4 as a candidate target for molecular docking; A: predicted ligand binding site, B: predicted structure;

[0030] Figure 4 Molecular dynamics simulation results of FBPQD interacting with TLR4 protein; A: RMSD of complex, protein and small molecule ligand; B: Rg of complex; C: RMSF of protein in complex; D: distance between protein and small molecule binding site (Dock site-ligand); E: buried SASA of small molecule and protein; F: simulation conformation superimposition;

[0031] Figure 5 Binding energy VDW and ELE between small molecules and proteins;

[0032] Figure 6 Amino acid binding energy contribution;

[0033] Figure 7 Hydrogen bond number (Hbond number);

[0034] Figure 8 Interaction between protein and small molecule;

[0035] Figure 9 CCK8 detection of FBPQD on LPS combined with IFN-γ induced macrophage injury in vitro model of cell viability observation chart;

[0036] Figure 10 CCK8 detection of FBPQD on LPS combined with IFN-γ induced macrophage injury in vitro model of cell viability;

[0037] Figure 11 Flow cytometry detection of FBPQD on LPS combined with IFN-γ induced macrophage injury in vitro model of macrophage M1 / M2 polarization results;

[0038] Figure 12 Flow cytometry detection of FBPQD on LPS combined with IFN-γ induced macrophage injury in vitro model of macrophage M1 / M2 polarization data statistical results;

[0039] Figure 13 ELISA detection of FBPQD on LPS combined with IFN-γ induced macrophage injury in vitro model of macrophage pro-inflammatory, anti-inflammatory factors and growth factors content;

[0040] Figure 14 Western blot detection of the activation of related signaling pathways;

[0041] Figure 15 For qRT-PCR detection of FBPQD on LPS combined with IFN-γ caused macrophage injury in vitro model of macrophage M1 / M2 polarization related gene expression;

[0042] Figure 16 For fluorescence detection of macrophage M1 / M2 polarization chart;

[0043] Figure 17 For immunofluorescence detection of macrophage M1 / M2 polarization data statistical results;

[0044] Figure 18 For CCK8 detection of FBPQD on HG caused macrophage injury in vitro model of cell viability observation chart;

[0045] Figure 19 For CCK8 detection of FBPQD on HG caused macrophage injury in vitro model of cell viability;

[0046] Figure 20 For flow cytometry detection of FBPQD on HG caused macrophage injury in vitro model of macrophage M1 / M2 polarization results;

[0047] Figure 21 For flow cytometry detection of FBPQD on HG caused macrophage injury in vitro model of macrophage M1 / M2 polarization data statistical results;

[0048] Figure 22 For ELISA detection of FBPQD on HG caused macrophage injury in vitro model of macrophage pro-inflammatory, anti-inflammatory factors and growth factors content;

[0049] Figure 23 For Western blot experiment results show; left chart for Western blot detection chart, right chart for data statistical results chart;

[0050] Figure 24 For different doses of FBPQD treatment on macrophage signaling pathway;

[0051] Figure 25 For qRT-PCR detection of FBPQD on HG caused macrophage injury in vitro model of macrophage M1 / M2 polarization related gene expression;

[0052] Figure 26 For immunofluorescence detection of FBPQD on HG caused macrophage injury in vitro model of macrophage M1 / M2 polarization;

[0053] Figure 27 For immunofluorescence detection of macrophage M1 polarization;

[0054] Figure 28 For immunofluorescence detection of macrophage M2 polarization;

[0055] Figure 29 For Masson staining (collagen deposition) results;

[0056] Figure 30 For CD31 staining (MVD detection) results;

[0057] Figure 31 For HE staining results;

[0058] Figure 32 For qRT-PCR detection of macrophage M1 / M2 polarization related gene expression;

[0059] Figure 33 For Western Blot detection of NF-kB and PI3K / AKT related signaling pathways. DETAILED DESCRIPTION

[0060] Various exemplary embodiments of the present application will now be described in detail, which should be considered to be merely illustrative in nature and are not to be considered as limiting the scope of the present application, and are understood to be a more detailed description of certain aspects, features and embodiments of the present application.

[0061] As used herein, the terms "comprise", "comprising", "include", "including", "have", "having" and the like are open-ended terms, i.e., are intended to mean including but not limited to.

[0062] Example 1: Select representative compounds for protein docking and molecular simulation at the computer level

[0063] 1. Molecular docking

[0064] Based on AI high-throughput virtual screening and its computational chemistry calculation of the binding force and stable conformation of the compound and the target protein receptor, the compound with the lowest binding energy and the most stable conformation is selected as the representative compound.

[0065] Select 3-(2-(4-(4-fluorobenzoyl)piperidin-1-yl)-ethyl)quinazoline-2,4(1H,3H)-dione as a representative compound, InChI = 1S / C 22 H 22 FN3O3 / c23-17-7-5-15(6-8-17)20(27)16-9-11-25(12-10-16)13-14-26-21(28)18-3-1-2-4-19(18)24-22(26)29 / h1-8,16H,9-14H2,(H,24,29), abbreviated as FBPQD.

[0066]

[0067] The key proteins in the NF-kB signaling pathway were selected as IKKβ, TLR4, p65 as the candidate target points for molecular docking. The molecular simulation software used was gromacs, and the AI molecular docking algorithm developed by Beijing AngoPro Technology Co., Ltd. was used for molecular docking. The algorithm can identify protein binding pockets, and autodockvina is used for docking scoring. The results are as follows Figures 1-3 and Tables 1-3.

[0068] Table 1 IKKβ as a predicted conformational binding energy of the candidate target point for molecular docking

[0069] Conformation Binding energy (kcal / mol) 1 -0.01 2 -0.01 3 -0.01 4 0 5 0 6 0 7 0 8 0

[0070] Table 2 p65 as a predicted conformational binding energy of the candidate target point for molecular docking

[0071]

[0072]

[0073] Table 3 TLR4 as a predicted conformational binding energy of the candidate target point for molecular docking

[0074] Conformation Binding energy (kcal / mol) 1 -9.54 2 -9.39 3 -9.21 4 -9.1 5 -9 6 -8.94 7 -8.92 8 -8.81

[0075] From the above results, TLR4 and p65 can be potential targets of FBPQD, and their specific relationship is as follows: there is a close functional relationship between NF-κB and p65 and TLR4:

[0076] (1) Relationship between NF-κB and p65:

[0077] p65 (also known as RelA) is the most important member protein in the NF-κB family;

[0078] p65 and p50 usually form a heterodimer, which is the most common form of NF-κB;

[0079] When referring to NF-κB activation, it usually refers to the activation of p65 / p50 heterodimer.

[0080] (2) Relationship between TLR4 and NF-κB signaling pathway:

[0081] TLR4 is a pattern recognition receptor that can recognize pathogen-associated molecular patterns such as lipopolysaccharide (LPS);

[0082] When TLR4 is activated, it transmits signals through MyD88-dependent and TRIF-dependent pathways;

[0083] These signaling pathways ultimately lead to the activation of the IκB kinase (IKK) complex;

[0084] The IKK complex phosphorylates IκB proteins (inhibitors of NF-κB);

[0085] Phosphorylated IκB is then ubiquitinated and degraded;

[0086] After IκB degradation, NF-κB (mainly p65 / p50) is released from the cytoplasm and translocated to the nucleus;

[0087] In the nucleus, NF-κB binds to the promoter region of target genes, initiating the transcription of genes such as inflammatory factors.

[0088] (3) Synergistic effect in inflammatory response:

[0089] TLR4 acts as an upstream signaling receptor, sensing inflammatory stimuli;

[0090] NF-κB (especially the p65 component) acts as a downstream transcription factor, executing gene expression regulation.

[0091] 2. Verification of TLR4 molecular simulation

[0092] The results of the molecular simulation verification of TLR45 are shown in Figures 4-8

[0093] (1) Analysis of structural stability

[0094] As shown in A of Figure 4 , it shows the change of RMSD (Root Mean Square Deviation) of the complex, protein, and FBPQD (Ligand) over time. The curve tends to be stable, indicating that the complex has reached a conformational stable state during the simulation process. The RMSD values of the protein (purple) and the complex (blue) are higher than those of the small molecule (orange), indicating that the conformation of the small molecule is relatively stable, while the protein has a certain degree of structural adjustment.

[0095] As shown in B of Figure 4 , it shows the fluctuation of the radius of gyration (Rg) of the complex, which tends to be stable as a whole, indicating that the complex maintains a compact structure and does not show obvious structural loosening.

[0096] As shown in C of Figure 4 , it is the RMSF (Root Mean Square Fluctuation) analysis of the protein in the complex, showing the flexibility of each residue of the TLR4 protein. The peak value of some regions is higher, indicating that these regions have greater conformational flexibility, but the residues near the FBPQD binding site have smaller fluctuations, indicating that FBPQD stabilizes these regions.

[0097] (2) Analysis of binding sites ​

[0098] As shown in Fig. 3A, the distance between FBPQD and TLR4 protein binding site (Dock site-ligand) changes. Two lines represent different measurement methods, but remain relatively stable, indicating that FBPQD is continuously bound to a specific site on TLR4 protein, without significant dissociation or relocation. Figure 4

[0099] As shown in Fig. 3B, the buried solvent accessible surface area (Buried SASA) between FBPQD and TLR4 is shown, reflecting the contact area between the two. The fluctuation is small and maintained at a certain level, indicating that FBPQD maintains a stable contact interface with TLR4. Figure 4

[0100] As shown in Fig. 3C, the superposition of multiple conformations during the simulation is shown, and the overall conformation of the protein can be seen from the color gradient, where FBPQD is stably bound to a specific site. Figure 4

[0101] (3) Analysis of interaction energy

[0102] As shown in Fig. 3D, the binding energy components between FBPQD and TLR4 are shown, including van der Waals force (VDW, blue), electrostatic interaction (ELE, purple), and total binding energy (Binding, orange). The data shows that van der Waals force is the main binding energy contribution, followed by electrostatic interaction. Figure 5

[0103] As shown in Fig. 3E, the contribution of each amino acid to the binding energy of FBPQD is shown, and it can be seen that residues such as PHE-734 and LEU-644 have higher negative contribution values (i.e. conducive to binding), which are key residues for the binding of FBPQD to TLR4. Figure 6

[0104] (4) Hydrogen bond analysis and interaction mode

[0105] As shown in Fig. 3F, the number of hydrogen bonds between FBPQD and TLR4 is shown over time. The number of hydrogen bonds fluctuates but remains within a certain range, indicating that there is a persistent hydrogen bond network between FBPQD and TLR4, although it is not as significant as hydrophobic interaction. Figure 7

[0106] Figure 8 ​​​​​​​The interaction mode of FBPQD with TLR4 is shown in the most detail: the left side is the protein surface map; the middle is the binding position of the protein secondary structure and FBPQD; the right side is the interaction details of FBPQD with key amino acids, including hydrogen bonds (dotted lines) and hydrophobic contacts. It can be seen that FBPQD is embedded in a hydrophobic pocket of TLR4, forming a network of interactions with multiple key residues.

[0107] (5) Correlation with the mechanism of action of FBPQD

[0108] TLR4, as a pattern recognition receptor, plays a key role in innate immunity and inflammatory response. It can recognize pathogen-associated molecular patterns such as lipopolysaccharide (LPS), activate MyD88-dependent and TRIF-dependent signaling pathways, and ultimately lead to the activation of NF-κB and the production of inflammatory factors.

[0109] This simulation result provides molecular level evidence for understanding the anti-inflammatory mechanism of FBPQD:

[0110] a. FBPQD may interfere with the ability of TLR4 to recognize LPS or other ligands by stably binding to specific sites of TLR4;

[0111] b. FBPQD may affect its interaction with downstream signaling molecules (such as MyD88 or TRIF) by changing the conformation of TLR4;

[0112] c. By blocking the activation of TLR4, FBPQD cuts off the upstream signal leading to the activation of NF-κB, thereby inhibiting the inflammatory response;

[0113] These findings are consistent with the observation that FBPQD can significantly inhibit the polarization of macrophage M1 and promote the polarization of M2, because the TLR4 signaling pathway is one of the key factors promoting the polarization of macrophage M1.

[0114] Example 2: In vitro experimental verification of FBPQD

[0115] 1. Samples

[0116] Table 4 Information of experimental samples

[0117]

[0118] 2. In vitro experiment

[0119] 2.1 Cells and culture conditions

[0120] RAW264.7 (mouse monocyte macrophage leukemia cells), culture conditions: 95% air + 5% CO2; DMEM (high sugar) medium + 10% FBS + 1% PS.

[0121] 2.2 Packet

[0122] 2.2.1 Study on the therapeutic effect and mechanism of FBPQD in the in vitro model of macrophage injury induced by LPS combined with IFN-γ

[0123] The experiment was divided into 7 groups: Control group, Model group, 5 μM FBPQD group, 10 μM FBPQD group, 20 μM FBPQD group, 40 μM FBPQD group and 80 μM FBPQD group.

[0124] The Control group was normally cultured without any treatment; the Model group was intervened with 20 ng / mL IFN-γ and 100 ng / mL LPS for 24 h; the rest of the FBPQD groups were intervened with 20 ng / mL IFN-γ, 100 ng / mL LPS and the corresponding concentration of FBPQD for 24 h.

[0125] 2.2.2 Study on the therapeutic effect and mechanism of FBPQD in the in vitro model of macrophage injury induced by HG

[0126] The experiment was divided into 5 groups: Control group, Model group, 5 μM FBPQD group, 10 μM FBPQD group, 20 μM FBPQD group.

[0127] The Control group was normally cultured without any treatment; the Model group was intervened with 30 mmol / L HG for 48 h; the rest of the FBPQD groups were intervened with 30 mmol / L HG and the corresponding concentration of FBPQD for 48 h.

[0128] 2.3 Main reagents

[0129] Table 5 Information of main reagents

[0130]

[0131]

[0132]

[0133] 2.4 Experimental methods

[0134] 2.4.1 Pretreatment of test and control products 2.4.1.1 Test sample (1) Preparation of FBPQD

[0135] Stock solution preparation: accurately weigh 12.8 mg of FBPQD, add 647.4 μL of DMSO, vortex on a vortex mixer until uniform, which is 50 mM.

[0136] Primary dilution: Take an appropriate amount of 50 mM FBPQD stock solution and mix with complete medium to prepare a 160 mM working solution.

[0137] Secondary dilution: Use the double dilution method to obtain 80 mM, 40 mM, 20 mM, and 10 mM gradient concentration solutions in turn. After dilution, filter with a 0.22 pm filter for standby.

[0138] (2) LPS preparation

[0139] Stock solution preparation: Add 1 mL of PBS and 10 mg of LPS to the original bottle, vortex to mix thoroughly, to obtain a 10 mg / mL initial solution; transfer the above initial solution to a centrifuge tube, add 9 mL of PBS and mix well to prepare a 1 mg / mL stock solution.

[0140] Primary dilution: Take 100 pL of stock solution (1 mg / mL) and mix with 9.9 mL of complete medium, vortex to obtain a 10 pg / mL intermediate working solution.

[0141] Secondary dilution: Use a pipette to take 800 pL of intermediate working solution (10 pg / mL), add 19.2 mL of complete medium, mix well to obtain a 400 ng / mL working solution. Then use the double dilution method to take an appropriate amount of 400 ng / mL working solution and dilute by equal volume to obtain a 200 ng / mL working solution, filter with a 0.22 pm filter for standby.

[0142] (3) IFN-γ preparation

[0143] Stock solution preparation: Add 1 mL of PBS to the original bottle and vortex to mix well on the vortex mixer to obtain a 5 pg / mL stock solution.

[0144] Primary dilution: Take an appropriate amount of stock solution (5 pg / mL) and mix with complete medium to dilute to 80 ng / mL for standby.

[0145] 3. Secondary dilution: Use the double dilution method to dilute the 80 ng / mL IFN-γ solution by equal volume to obtain a 40 ng / mL solution for standby.

[0146] (4) HG preparation

[0147] The glucose solution stock solution (glucose injection in Table 5) has a concentration of 277.8 mM, which is diluted with PBS to 60 mM for standby.

[0148] 2.4.1.2 Controls

[0149] Negative control, positive control, and blank control.

[0150] 2.4.2 Cell recovery, culture, and cell freezing

[0151] (1) Cell Resuscitation

[0152] Pre-heat the constant temperature water bath and set the temperature to 37°C. Then take the cryo-tube of RAW264.7 cells from the liquid nitrogen tank, transfer it to the flask containing liquid nitrogen, and transfer it to the cell room. When the temperature of the water bath reaches 37°C, immerse the cryo-tube in the constant temperature water bath, and gently shake it to thaw it evenly.

[0153] After thawing and disinfecting the outer wall, transfer the liquid in the cryo-tube to a 15 mL sterile centrifuge tube containing 5 mL of pre-warmed complete medium, and gently blow and mix it, then place the centrifuge tube in the centrifuge and centrifuge at 1000 rpm for 5 min. After centrifugation, discard the supernatant and add 1 mL of complete medium to resuspend it gently.

[0154] Evaluate the cell viability by trypan blue staining combined with cell counting (> 90%) and adjust the cell density to 1 x 10 5 Add 1 mL of cell suspension to each T25 cell culture flask, and add an additional 3 mL of fresh complete medium, write the resuscitation time, personnel and cell information in the corner of the medium, then move it to a constant temperature incubator at 37°C with 5% CO2 and horizontally stand for culture, replace the fresh medium after the cells adhere (about 24 h later), and then routinely change the medium every 48 h, and continuously monitor the growth status of the cells by inverted microscope.

[0155] (2) Cell Culture

[0156] After 24 hours of constant temperature culture of the cells, take out the T25 culture flask and observe the cell state (cell adhesion, cell density, etc.) under the inverted microscope.

[0157] Before operation, start ultraviolet sterilization for 30 min. Then use 75% alcohol to spray and disinfect the table and the outer surface of the culture flask. In the safety cabinet, discard the old medium, and use 2 mL of PBS buffer to gently rinse the cell adhesion surface in the T25 culture flask, repeat 3 times to remove floating / dead cells and residues.

[0158] After discarding the PBS, add 4 mL of fresh complete medium to the culture flask and mark the time of replacing the medium, then place it in the constant temperature incubator for continuous culture and continuously monitor the cell state.

[0159] (3) Cell Passage

[0160] When the cell confluence reaches 80-90%, the cells are passaged. The old culture medium is aspirated in a biological safety cabinet, and the cells are washed 3 times with 2 mL of PBS buffer. 1 mL of 0.25% EDTA-trypsin digestion solution is added to the culture bottle, and the culture bottle is gently shaken to ensure that the trypsin is in full contact with the cells. Then the culture bottle is transferred to a constant temperature incubator and placed horizontally for digestion. When the cells are spherical and partially detached, it indicates that the digestion is complete, and 2 mL of fresh complete culture medium is added to terminate the digestion.

[0161] After the culture medium is aspirated, the bottom cells are gently blown and shaken. When all the cells are detached, the cell suspension is transferred to a centrifuge tube and centrifuged at 1000 rpm for 5 min. After centrifugation, the supernatant is aspirated, 3 mL of fresh complete culture medium is added to the centrifuge tube, and the cells are gently blown and shaken to resuspend them. 1 mL of the cell suspension is transferred to a new culture bottle, 4 mL of fresh complete culture medium is added, and the culture is continued in the incubator.

[0162] (4) Cell cryopreservation

[0163] FBS and DMSO are mixed at a volume ratio of 90:10 to prepare a cryopreservation solution. Cells in the logarithmic growth phase are collected, 1 mL of trypsin is added, and the cells are incubated at 37°C for 2 min. The digestion is terminated by adding complete culture medium, and the cell suspension is collected in a centrifuge tube and centrifuged at 1000 rpm for 5 min.

[0164] After centrifugation, the supernatant is aspirated, and 1 mL of cryopreservation solution is added. The cells are gently blown and shaken to form a uniform single-cell suspension. Then the suspension is immediately transferred to a cryopreservation tube. After sealing, the tube is labeled with the cell strain name, generation number, and time information on the side wall. After filling, the cryopreservation tube is transferred to a programmed cooling box and frozen at -80°C overnight. Finally, the cryopreservation tube is transferred to a liquid nitrogen tank for long-term storage.

[0165] 2.4.3 Cell administration

[0166] (1) FBPQD treatment effect and mechanism in the LPS combined with IFN-γ induced macrophage injury in vitro model

[0167] An equal volume of 200 ng / mL LPS and 40 ng / mL IFN-γ is added to a centrifuge tube, and the solution contains 100 ng / mL LPS and 20 ng / mL IFN-γ after mixing.

[0168] LPS (400 ng / mL) : IFN-γ (80 ng / mL) : FBPQD (160, 80, 40, 20, 10 μM) volume ratio of 1:1:2, so that its final concentration is: ① 100 ng / mL LPS + 20 ng / mL IFN-γ + 80 μM FBPQD; ② 100 ng / mL LPS + 20 ng / mL IFN-γ + 40 μM FBPQD; ③ 100 ng / mL LPS + 20 ng / mL IFN-γ + 20 μM FBPQD; ④ 100 ng / mL LPS + 20 ng / mL IFN-γ + 10 μM FBPQD; ⑤ 100 ng / mL LPS + 20 ng / mL IFN-γ + 5 μM FBPQD.

[0169] (2) FBQD on HG-induced macrophage damage in vitro model of therapeutic effect and mechanism of action of the experiment

[0170] HG (60 mM) : FBPQD (160, 80, 40, 20, 10 μM) volume ratio of 1:1.

[0171] 2.4.4 CCK8 detection of macrophage proliferation

[0172] After the cells were digested and resuspended, they were counted, and the cell suspension was adjusted to 5 × 10 3 cells / 100 μL, and the cell suspension was uniformly blown. 100 μL of cell suspension was added to each well of a 6-well plate, and PBS was added to a circle of wells around the 96-well plate. After the cells adhered, the above grouping was performed for 24 h / 48 h. The old culture medium was removed and washed once with PBS. Prepare CCK-8 working solution (CCK-8 and serum-free medium mixed at a ratio of 1:100), and add 100 μL per well. Incubate at 37°C for 2 h in the dark, and then measure the OD value of each well at 450 nm wavelength in the enzyme marker instrument.

[0173] 2.4.5 Flow cytometry detection of M1 / M2 macrophage polarization ratio

[0174] Take 500,000 cells in a flow tube, volume 50 μL, add 1 μL of CD16 / 32, incubate at room temperature for 15 min, then add CD86 antibody 2 μL, stain at room temperature for 1 h, then add 2 mL PBS, 300g centrifuge at room temperature for 5 min, remove the supernatant, add 500 μL fixing agent, four degrees for 45 min, then add 1 mL of membrane breaking liquid, 300g centrifuge at room temperature for 5 min, remove the supernatant, 50 μL membrane breaking liquid suspended cells, add CD206 antibody 2 μL, 4℃ staining for 3h. Then add 2 mL PBS, 300g centrifuge at room temperature for 5 min, remove the supernatant, 200 μL PBS suspended cells, machine detection;

[0175] 2.4.6 ELISA detection of expression of related inflammatory factors

[0176] (1) Cell collection

[0177] After administration according to the above grouping, the adherent cells were scraped off with a cell scraper, and the cells and supernatant were collected into a centrifuge tube. If not detected immediately, it was transferred to -80℃ for storage.

[0178] (2) ELISA detection

[0179] Take the ELISA kit out of the refrigerator and place it at room temperature for 20 min. Dilute 20x wash solution with ultrapure water at a ratio of 1:20.

[0180] Set the standard well and the sample well. Add 50 μL of different concentrations of standard to the standard well, and dilute the sample according to the set dilution ratio (total volume of sample + diluent is 50 μL). Add 100 μL of horseradish peroxidase (HRP) labeled detection antibody to each well, use a sealing film to seal the reaction well, and incubate in a 37℃ incubator for 60 min. After incubation, discard the liquid and pat dry on a blotting paper. Add 1x wash solution to each well, stand for 1 min, then shake off the wash solution and pat dry on a blotting paper. Repeat the plate washing 5 times, and the last time needs to be thoroughly patted dry on a blotting paper. Add 50 μL of substrate A and B to each well, respectively, and incubate at 37℃ in the dark for 15 min. After incubation, add 50 μL of stop solution to each well, and measure the OD value of each well at 450 nm within 15 min.

[0181] 2.4.7 Western Blot experiment to detect the activation of NF-κB and PI3K / AKT pathway

[0182] Western Blot kit was used for protein extraction and quantification.

[0183] (1) Protein extraction

[0184] The centrifuged cells were washed with 1 mL of normal saline and transferred to a 1.5 mL centrifuge tube. 1 mL of lysis solution was added to 10 μL of PMSF (100 mM), and the mixture was shaken and placed on ice. The PMSF was shaken until no crystals were formed, and then mixed with the lysis solution. Depending on the amount of cells, 100-500 μL of lysis solution containing PMSF was added to each tube of cells, and the mixture was lysed on ice for 30 min. The mixture was centrifuged at 12000 rpm at 4°C for 10 min. The supernatant was transferred to a 1.5 mL centrifuge tube for protein quantification. If the protein concentration cannot be determined in time, the mixture was stored at -80°C.

[0185] (2) Protein quantification and treatment (BCA method)

[0186] When used, Solution A in the BCA kit was shaken to mix well. According to the amount of sample, an appropriate amount of BCA working solution was prepared by mixing 50 volumes of Solution A with 1 volume of Solution B (50:1). After mixing well, a light green working solution was obtained. The BCA working solution was stable at room temperature for 24 hours. The standard (1 mg / mL BSA) was added to the 96-well plate in an amount of 0, 1, 2, 4, 6, 8, and 10 μL, respectively, and deionized water was added to make up to 10 μL. 1 μL of sample was added to the 96-well plate, and deionized water was added to make up to 10 μL. 200 μL of BCA working solution was added to each well, and the mixture was mixed gently with a pipette. The mixture was incubated at 37°C for 30 min. After cooling to room temperature, the absorbance value at A562 was measured with a microplate reader.

[0187] The protein concentration in the sample was calculated according to the standard curve. Protein denaturation treatment: the protein solution was mixed with 5xLoading buffer at a volume ratio of 4:1 (at this time the protein concentration was 0.8 times the actual detection concentration), and boiled in boiling water for 10 min. After cooling, SDS-PAGE electrophoresis was performed, or the mixture was stored at -80°C to avoid repeated freezing and thawing.

[0188] The calculation formula of protein concentration is:

[0189] The standard curve is: Y=aX+b (Y is the OD value, X is the measured concentration);

[0190] The sample protein concentration = [(Y-b) / a] x dilution factor.

[0191] 2.4.8 qRT-PCR experiment to detect the mRNA expression of M1 and M2 type macrophage related markers

[0192] Table 6 Primer information

[0193] Primer designation Primer sequence (5'→3') m-ARG1-181-F CGCCTTTCTCAAAAGGACAG m-ARG1-181-R ACAGACCGTGGGTTCTTCAC m-CD206-153-F ATGCCAAGTGGGAAAATCTG m-CD206-153-R TGTAGCAGTGGCCTGCATAG m-YM-1-197-F CAGGTCTGGCAATTCTTCTGAA m-YM-1-197-R GTCTTGCTCATGTGTGTAAGTGA m-INOS-197-F AAGCCCCGCTACTACTCCAT m-INOS-197-R AGCTGGAAGCCACTGACACT m-MCP-1-120-F TAAAAACCTGGATCGGAACCAAA m-MCP-1-120-R GCATTAGCTTCAGATTTACGGGT m-CD45-195-F GTTTTCGCTACATGACTGCACA m-CD45-195-R AGGTTGTCCAACTGACATCTTTC GAPDH-128F(M) AGCCCAAGATGCCCTTCAGT GAPDH-128R(M) CCGTGTTCCTACCCCCAATG

[0194] 2.4.8.1 Sample pretreatment

[0195] Add 500 μL Trizol to the cell or tissue sample.

[0196] 2.4.8.2 RNA extraction

[0197] (1) Add 100 μL chloroform to the 1.5 mL EP tube with Trizol, shake well, and let stand for 5 min. Centrifuge at 12000 rpm, 4°C for 10 min.

[0198] (2) Take the 1.5 mL EP tube from the centrifuge, and transfer the upper colorless transparent aqueous phase to another clean 1.5 mL EP tube. The sample will be divided into three layers: the lower organic phase, the middle layer, and the upper aqueous phase, and the RNA is in the upper aqueous phase.

[0199] (3) Add an equal volume of isopropanol, mix well by inverting the tube, let stand for 10 min, and centrifuge at 12000 rpm, 4°C for 10 min.

[0200] (4) After centrifugation, a gelatinous precipitate will appear on the wall or bottom of the EP tube. This is the RNA to be extracted. Carefully discard the supernatant, but do not discard the precipitate.

[0201] (5) Wash the RNA precipitate with 1 mL of 75% ethanol. Then centrifuge at 7000 rpm, 4°C for 5 min, and remove the supernatant as completely as possible.

[0202] (6) Let stand at room temperature to dry for about 5-10 min. (Do not vacuum centrifuge to dry, as excessive drying will greatly reduce the solubility of the RNA.) Add 25 μL of DEPC H2O to all EP tubes, and blow several times with a gun to fully dissolve the RNA. Store at -80°C.

[0203] (7) RNA concentration detection: Use a nucleic acid protein detector to detect the RNA concentration.

[0204] 2.4.8.3 Reverse transcription PCR

[0205] Prepare the reverse transcription reaction solution according to the following components and perform the reaction.

[0206] Table 7 Reverse transcription reaction system and reaction conditions

[0207]

[0208]

[0209] The cDNA obtained by reverse transcription can be immediately used for experiments or stored at 4°C.

[0210] 2.4.8.4 RT-qPCR reaction The RT-qPCR reaction system was prepared as follows.

[0211] Table 8 RT-qPCR reaction system

[0212] Ingredient Volume SYBR Green Imix (2x) 5 μL Primer-F (10 μM) 0.2 μL Primer-R (10 μM) 0.2 μL cDNA 0.2 μL Sterile distilled water Supplemented to 10 μL

[0213] The amplification program was set as shown in the following table.

[0214] Table 9 Amplification program

[0215]

[0216] The melting program is shown in the following table.

[0217]

[0218]

[0219] 2.4.8.5 Immunofluorescence detection of M1 / M2 type ratio

[0220] (1) Cell inoculation: RAW264.7 cells were inoculated in a 6-well plate containing a crawling sheet and cultured in a carbon dioxide incubator overnight. According to the grouping, the drug treatment was performed.

[0221] (2) Fixation and permeation: the old culture medium was aspirated and gently rinsed with PBS for 3 times; pre-cooled 4% paraformaldehyde was added and fixed at room temperature for 15 min; after fixation, 0.2% Triton X-100 was used for permeation for 10 min, and then PBS was used for washing for 3 times, each for 5 min.

[0222] (3) Blocking: 5% BSA was added and blocked at room temperature for 1 h; after blocking, the blocking solution was aspirated.

[0223] (4) Primary antibody incubation: anti-CD86 and anti-CD206 primary antibodies were mixed in proportion, diluted to working concentration with 1% BSA, and incubated at 4°C overnight;

[0224] (5) Secondary antibody incubation: PBS was washed for 3 times, each for 5 min; corresponding fluorescent secondary antibodies were added under light shielding condition, and incubated at room temperature for 1 h; PBS was washed for 3 times, each for 5 min.

[0225] (6) Nucleus staining and mounting: DAPI (1 μg / mL) was added for nucleus staining for 5 min; PBS was washed for 3 times, and the liquid was aspirated; anti-fluorescent quenching mounting agent was added dropwise, the crawling sheet was covered, and air bubbles were avoided.

[0226] 2.5 Results and analysis

[0227] 2.5.1 Experimental results of the therapeutic effect and mechanism of FBPQD in the in vitro model of macrophage injury caused by LPS combined with IFN-γ

[0228] 2.5.1.1 CCK8 detection of cell viability results

[0229] As shown in Figure 9 and Figure 10 , the experimental results show that LPS+INF-γ induces RAW264.7 macrophage viability to be significantly down-regulated, and there is cell injury. After giving different doses of FBPQD, the cell viability can be significantly improved, especially at a dose of 10 μM. Although the doses of 40-80 μM can significantly improve the cell viability, they cannot further play a role.

[0230] 2.5.1.2 Flow cytometry detection of macrophage M1 / M2 polarization results

[0231] As shown in Figure 11 and Figure 12 , the flow cytometry experimental results show that LPS+INF-γ induces RAW264.7 macrophage polarization. After giving different doses (5 μM, 10 μM, 20 μM) of FBPQD, the macrophage M2 polarization can be significantly improved, and the M1 polarization can be inhibited.

[0232] 2.5.1.3 ELISA detection of the content of pro-inflammatory, anti-inflammatory factors and growth factors in macrophages

[0233] As shown in Table 10 and Figure 13 , the ELISA experimental results show that LPS+INF-γ induces RAW264.7 macrophage polarization, promotes the secretion of inflammatory factors, and inhibits the expression of anti-inflammatory factors. After giving different doses (5 μM, 10 μM, 20 μM) of FBPQD, the content of anti-inflammatory factors and growth factors can be significantly improved, and the expression of pro-inflammatory factors can be inhibited. The dose of 10 μM is the best.

[0234] Table 10 ELISA experimental results

[0235]

[0236]

[0237] 2.5.1.4 Western blot detection of the activation of related signaling pathways

[0238] As shown in Figure 14As shown in the Western blot results, LPS+INF-γ induced polarization of RAW264.7 macrophages, promoting the activation of NF-κB, PI3K / AKT, and NLRP3 inflammasome pathways. These signaling pathways all lead to macrophage polarization towards M1, exacerbating the inflammatory response. Administration of different doses (5 μM, 10 μM, 20 μM) of FBPQD significantly inhibited the expression of these signaling pathways in macrophages. The 10 μM dose showed the best effect.

[0239] 2.5.1.5 qRT-PCR detection of M1 / M2 polarization-related gene expression in macrophages

[0240] like Figure 15 As shown in the qRT-PCR results, LPS+INF-γ induced polarization of RAW264.7 macrophages. Administration of different doses (5 μM, 10 μM, 20 μM) of FBPQD significantly increased the mRNA levels of macrophage M2 polarization biomarkers (Arg-1, Ym-1, CD206) and inhibited the mRNA levels of M1 polarization biomarkers (iNOS, MCP-1, CD45). The 10 μM dose showed the best effect.

[0241] 2.5.1.6 Immunofluorescence detection of macrophage M1 / M2 polarization

[0242] like Figures 16-17 As shown, immunofluorescence results indicated that LPS+INF-γ induced polarization of RAW264.7 macrophages. After administration of different doses (5μM, 10μM, 20μM) of FBPQD, macrophage M2 polarization was significantly enhanced and M1 polarization was inhibited.

[0243] 2.5.2 Experimental Results of the Study on the Therapeutic Effect and Mechanism of FBPQD on HG-Induced Macrophage Injury In Vitro Model

[0244] 2.5.2.1 CCK8 assay results of cell viability

[0245] like Figures 18-19 As shown in the CCK-8 assay, high glucose (HG) induces a significant decrease in the viability of RAW264.7 macrophages, resulting in cell damage. Administration of different doses of FBPQD can significantly improve cell viability, with 10 μM being the most effective. While 40 μM significantly improves cell viability, it does not have a further effect, and 80 μM has no significant effect, possibly indicating some toxic side effects.

[0246] 2.5.2.2 Flow cytometry results of macrophage M1 / M2 polarization

[0247] likeFigure 20 and Figure 21 As shown in the flow cytometry results, HG induces polarization of RAW264.7 macrophages. After administration of different doses (5μM, 10μM, 20μM) of FBPQD, macrophage M2 polarization was significantly enhanced and M1 polarization was inhibited.

[0248] 2.5.2.3 ELISA detection of the levels of pro-inflammatory, anti-inflammatory, and growth-promoting factors in macrophages

[0249] like Figure 22 As shown in Table 11, the ELISA results indicated that HG-induced polarization of RAW264.7 macrophages promoted the secretion of inflammatory factors and inhibited the expression of anti-inflammatory factors. Administration of different doses (5 μM, 10 μM, 20 μM) of FBPQD significantly increased the levels of anti-inflammatory and growth-promoting factors and inhibited the expression of pro-inflammatory factors. The 10 μM dose showed the best effect.

[0250] Table 11 ELISA Experimental Results

[0251]

[0252] 2.5.2.4 Western blot detection of activation status of relevant signaling pathways

[0253] like Figures 23-24 As shown in the Western blot results, LPS+INF-γ induced polarization of RAW264.7 macrophages, promoting the activation of NF-κB, PI3K / AKT, and NLRP3 inflammasome pathways. These signaling pathways all lead to macrophage polarization towards M1, exacerbating the inflammatory response. Administration of different doses (5 μM, 10 μM, 20 μM) of FBPQD significantly inhibited the expression of these signaling pathways in macrophages. The 10 μM dose showed the best effect.

[0254] 2.5.2.5 qRT-PCR detection of M1 / M2 polarization-related gene expression in macrophages

[0255] like Figure 25 As shown in the qRT-PCR results, HG-induced polarization of RAW264.7 macrophages, administration of different doses (5 μM, 10 μM, 20 μM) of FBPQD significantly increased the mRNA levels of macrophage M2 polarization biomarkers (Arg-1, Ym-1, CD206) and inhibited the mRNA levels of M1 polarization biomarkers (iNOS, MCP-1, CD45). The 10 μM dose showed the best effect.

[0256] 2.5.2.6 Immunofluorescence detection of macrophage M1 / M2 polarization

[0257] As Figure 26 shown, the immunofluorescence results show that HG induces polarization of RAW264.7 macrophages, and after administration of FBPQD at different doses (5 μM, 10 μM, 20 μM), the M2 polarization of macrophages can be significantly improved, and the M1 polarization is inhibited.

[0258] Example 3: In vivo experimental verification of FBPQD

[0259] 1. Experimental animals

[0260] C57BL / 6J mice, SPF level, male, 60, body weight 18-22 g, age 6-7 weeks. Purchased from Zhuhai Baisitong Biotechnology Co., Ltd., Experimental Animal Production License No.: SCXK (Guangdong): 2020-0051, Experimental Animal Quality Certificate No.: NO.44822700049880.

[0261] Animals were raised in the 11th floor SPF animal room of Guangzhou Huateng Biomedicine Technology Co., Ltd. The experimental animal use license number is SYXK (Guangdong) 2024-0307 (valid until January 15, 2028, issued by the Guangdong Provincial Department of Science and Technology). Animals were raised in cages of 5 animals each. The animal room environment temperature was 20-26℃, the daily temperature difference was not more than 4℃, the relative humidity was 40-70%, and the light / dark alternation was 12 hours light / 12 hours dark.

[0262] Feed situation: irradiation sterilization size mouse maintenance feed, purchased from Jiangsu Province Cooperation Pharmaceutical Biotechnology Engineering Co., Ltd., each batch of animal feed will be provided by the production unit with a quality inspection report

[0263] Drinking water: drinking water is sterile water, which meets the sterile requirements. Water supply method: continuous supply, animals freely take water.

[0264] 2. Experimental method

[0265] 2.1 Modeling

[0266] 60 quarantine mice were fed with high-fat feed for 6 weeks, and then injected with STZ 40 mg / kg each time, every other day, for 5 times. Five days after the injection was completed, the fasting blood glucose was measured, and mice with a value greater than 11.1 mmol / L were randomly divided into groups, including the model control group, the human epidermal growth factor group, the Xiangle sugar plaster group, the FBPQD No. 2 low-dose group, the FBPQD No. 2 medium-dose group, and the FBPQD No. 2 high-dose group. After grouping, a 10 mm full-thickness wound was created on the back using a biopsy punch.

[0267] 2.2 Dose and group design of test product and control product

[0268] The model control group was smeared with physiological saline, and the other groups were smeared with the corresponding drugs to the wound 0.1-0.2 g.

[0269] 2.3 Preparation of test and control samples and administration method

[0270] FBPQD No. 2 low dose (0.5%): hyaluronic acid 1 g, FBPQD 50 mg, pure water 8950 μL.

[0271] FBPQD No. 2 medium dose (1%): hyaluronic acid 1 g, FBPQD 100 mg, pure water 8900 μL.

[0272] FBPQD No. 2 high dose (2%): hyaluronic acid 1 g, FBPQD 200 mg, pure water 8800 μL.

[0273] Smeared on the wound, once a day, about 0.1-0.2 g, for 15 days.

[0274] 2.4 Clinical observation and evaluation criteria

[0275] Observation index: After the wound was punched, the mouse wound healing and the mouse body condition were observed every day, and the wound was photographed at 0, 5, 10, 15 days. Image analysis software was used to measure the wound area.

[0276] Experimental endpoint dissection: 5 animals were randomly selected for euthanasia in each group on the 5th day and the 15th day, the mouse wounds were collected, fixed and stored, the wound was longitudinally cut, and the pathological changes of the wound surface were observed.

[0277] 2.5 Histopathological observation of mouse skin tissue

[0278] (1) HE staining: to evaluate the wound tissue structure, healing, epithelialization, fibrosis, granulation tissue generation and neovascularization.

[0279] (2) Masson staining: to observe the collagen deposition and evaluate the scar formation.

[0280] (3) Double immunofluorescence (IF): to analyze the distribution of macrophages (F4 / 80 positive cells), M1 type macrophages (F4 / 80 and CD45 double positive cells), and M2 type macrophages (F4 / 80 and CD206 double positive cells) in the wound.

[0281] (4) Immunofluorescence: to detect CD31 (main marker for skin wound healing and neovascularization)

[0282] 2.6 Detection of skin tissue gene-related indicators

[0283] (1) qPCR detection of RNA expression of M2 macrophage markers (Arg-1, Ym-1, CD206); RNA expression of M1 macrophage markers (INOS, MCP-1, CD45).

[0284] (2) Western blot detection of expression of genes related to two signaling pathways of NF-kB (TLR4, P-P65, P65, MyD88) and PI3K / AKT (PI3K, Akt, P-PI3K, P-Akt).

[0285] 2.6 Animal carcass disposal

[0286] After the end of the experiment, the animal carcasses were temporarily stored in the animal carcass temporary storage freezer, and finally the personnel arranged by the safety officer disposed of the animal carcasses.

[0287] 3. Test results and data

[0288] 3.1 Fasting blood glucose

[0289] The fasting blood glucose of each group of animals was > 11.3 mmol / L, indicating that the construction of the diabetic model was successful.

[0290] 3.2 Skin healing

[0291] Table 12 Skin healing data results (N = 10)

[0292]

[0293] Note: D5, N = 10; D10-D15, N = 5.

[0294] 3.2 Histopathological observation

[0295] 3.2.1 F4 / 80 + CD45 + The proportion of double positive cells suggests that M1 type macrophages may be related to inflammatory response or immune activity, and the FBPQD material medium dose group has a tendency to inhibit M1 polarization, see Figure 27 .

[0296] 3.2.2 F4 / 80 + CD206 + The proportion of double positive cells suggests that M2 type macrophages have a repair effect in the late immune response, and the FBPQD material medium dose group has a significant effect on promoting M2 polarization. It shows that the effect of FBPQD material on the immune environment of mice may be more inclined to repair and anti-inflammatory effect, see Figure 28 .

[0297] 3.2.3 Masson staining (collagen deposition) results suggest that the amount of collagen deposition in the medium dose of FBPQD No. 2 is significantly reduced, indicating that FBPQD No. 2 has a lighter degree of fibrosis and is not prone to form scars in the process of acting on skin repair. See Figure 29 .

[0298] 3.2.4 CD31 staining (MVD detection) results suggest that changes in microvessel density reflect the situation of angiogenesis. The medium dose of FBPQD No. 2 significantly increases the microvessel density, indicating that the process of angiogenesis may be more active, which helps to repair the wound. See Figure 30 .

[0299] 3.2.5 HE staining score: reflects the overall situation of tissue repair, inflammatory response and structural integrity. The lower dose in the FBPQD group indicates better healing, see Figure 31 and Table 13.

[0300] Table 13 Summary of skin pathology data (N = 3)

[0301]

[0302] 3.3 qPCR detection of M2 macrophage markers (Arg-1, Ym-1, CD206); M1 macrophage marker (iNOS, MCP-1, CD45) expression results

[0303] 3.3.1 M2 macrophage markers Arg-1, CD206 and YM-1, relative to the model control group, the human epidermal growth factor group, the Xiangle sugar foot paste group, the FBPQD No. 2 low, medium and high dose groups were all up-regulated, among which the Xiangle sugar foot paste group and the FBPQD No. 2 medium dose group were the most significantly up-regulated, indicating that they significantly promote tissue repair and M2 polarization, see Figure 32 .

[0304] 3.3.2 M1 macrophage markers iNOS, MCP-1 and CD45, relative to the model control group, the human epidermal growth factor group, the Xiangle sugar foot paste group, the FBPQD No. 2 low, medium and high dose groups were all down-regulated, among which the Xiangle sugar foot paste group and the FBPQD No. 2 medium dose group were the most significantly down-regulated, indicating that they significantly reduce inflammation and improve the healing environment, see Figure 32 .

[0305] 3.4 Western Blot detection of NF-kB and PI3K / AKT signaling pathways

[0306] TLR4, P-P65, MyD88 / NF-κB pathway, relative to the model control group, the human epidermal growth factor group, the Xiangle foot paste group, the FBPQD No. 2 low, medium and high dose groups were all down-regulated, among which the Xiangle foot paste group and the FBPQD No. 2 medium dose group were most significantly down-regulated, indicating that the anti-inflammatory effect was significant, see Figure 33 .

[0307] p-PI3K, P-Akt, PI3K / AKT pathway, relative to the model group, the human epidermal growth factor group, the Xiangle foot paste group, and different doses of FBPQD molecules can significantly inhibit the activation of the signal pathway, especially the low and high doses, indicating that the skin healing effect is significantly improved, see Figure 33 .

[0308] The above-described embodiments are only descriptions of the preferred modes of the present application and do not limit the scope of the present application. Without departing from the design spirit of the present application, various modifications and improvements to the technical solutions of the present application made by those skilled in the art shall fall within the protection scope determined by the claims of the present application.

Claims

1. Use of a quinazoline composition targeting NF-κB for the manufacture of a medicament for promoting wound healing, characterized in that, The quinazoline composition includes FBPQD, which is 3-(2-(4-(4-fluorobenzoyl)piperidin-1-yl)-ethyl)quinazoline-2,4(1H,3H)-dione, InChI No. 1S / C 22 H 22 FN3O3 / c23-17-7-5-15(6-8-17)20(27)16-9-11-25(12-10-16)13-14-26-21(28)18-3-1-2-4-19(18)24-22(26)29 / h1-8,16H,9-14H2,(H,24,29).

2. Use of a quinazoline composition targeting NF-κB for the manufacture of an anti-inflammatory medicament, characterized in that, The quinazoline composition includes FBPQD, which is 3-(2-(4-(4-fluorobenzoyl)piperidin-1-yl)-ethyl)quinazoline-2,4(1H,3H)-dione, InChI No. 1S / C 22 H 22 FN3O3 / c23-17-7-5-15(6-8-17)20(27)16-9-11-25(12-10-16)13-14-26-21(28)18-3-1-2-4-19(18)24-22(26)29 / h1-8,16H,9-14H2,(H,24,29).

3. Use of a quinazoline composition targeted against NF-κB for the manufacture of an immunomodulatory medicament, characterized in that, The quinazoline composition includes FBPQD, which is 3-(2-(4-(4-fluorobenzoyl)piperidin-1-yl)-ethyl)quinazoline-2,4(1H,3H)-dione, InChI No. 1S / C 22 H 22 FN3O3 / c23-17-7-5-15(6-8-17)20(27)16-9-11-25(12-10-16)13-14-26-21(28)18-3-1-2-4-19(18)24-22(26)29 / h1-8,16H,9-14H2,(H,24,29).

4. Use of a quinazoline composition targeted to NF-κB for the preparation of a medicament for tissue repair, characterized in that, The quinazoline composition includes FBPQD, which is 3-(2-(4-(4-fluorobenzoyl)piperidin-1-yl)-ethyl)quinazoline-2,4(1H,3H)-dione, InChI No. 1S / C 22 H 22 FN3O3 / c23-17-7-5-15(6-8-17)20(27)16-9-11-25(12-10-16)13-14-26-21(28)18-3-1-2-4-19(18)24-22(26)29 / h1-8,16H,9-14H2,(H,24,29).

5. Use according to any one of claims 1 to 4, wherein the compound is of formula (I) ###0001### (I) or a pharmaceutically acceptable salt thereof. The quinazoline composition also includes hyaluronic acid and water.

6. Use according to claim 5, wherein The quinazoline composition includes the following components in the following amounts: 1 g of hyaluronic acid, 50-200 g of FBPQD, and 8800-9000 μL of water.

7. Use according to claim 6, wherein The quinazoline composition includes the following components in the following amounts: 1 g of hyaluronic acid, 100 g of FBPQD, and 8900 μL of water.

8. The use of a quinazoline compound targeting NF-κB in any one of the following: (1) the preparation of a drug for improving the activity of macrophages; (2) the preparation of a drug for improving the M2 polarization and inhibiting the M1 polarization of macrophages; (3) the preparation of a drug for promoting the increase of anti-inflammatory factors and growth factors and inhibiting the increase of pro-inflammatory factors in macrophages; (4) the preparation of a drug for inhibiting the expression of NF-κB, PI3K / AKT, and NLRP3 pathways in macrophages; wherein The quinazoline compound is FBPQD, the FBPQD is 3-(2-(4-(4-fluorobenzoyl)piperidin-1-yl)-ethyl)quinazoline-2,4(1H,3H)-dione, the InChI number is 1S / C 22 H 22 FN3O3 / c23-17-7-5-15(6-8-17)20(27)16-9-11-25(12-10-16)13-14-26-21(28)18-3-1-2-4-19(18)24-22(26)29 / h1-8,16H,9-14H2,(H,24,29); The macrophages are macrophages in a high-glucose-induced state or macrophages in an inflammatory state induced by LPS combined with IFN-γ.

9. Use according to claim 8, wherein the compound is ###0002### The optimal dosage of the FBPQD is 10 μM.