Application of TRMT61A as target in preparation of AML (acute myeloid leukemia) treatment medicine

Abstract

The invention relates to application of TRMT61A as a target spot in preparation of AML (acute myeloid leukemia) treatment medicines, and belongs to the technical field of biological medicines. In order to solve the problem that clinical applicability limitation exists in chemotherapy and targeted inhibitor treatment in current AML treatment, the invention provides application of TRMT61A as a target spot in preparation of a medicine for treating AML, and the medicine comprises a TRMT61A inhibitor Thiram or targeted sgRNA. By knocking out the TRMT61A, AML cell proliferation can be remarkably inhibited, apoptosis and differentiation are promoted, and the cell cycle is retarded. The Thiram has an inhibiting effect on the growth of AML cells and the activity of patient-derived leukemia cells, shows a synergistic anti-leukemia effect when being combined with Rapamycin, ORY-1001 or a clinical chemotherapeutic drug Ara-C, and can obviously inhibit the infiltration of leukemia cells in a mouse model and prolong the lifetime. The invention provides a new strategy for AML treatment.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to application of TRMT61A as a target in preparation of an AML treatment drug. BACKGROUND

[0002] Acute myeloid leukemia (AML) is an aggressive hematological malignancy characterized by the abnormal proliferation of undifferentiated myeloid cells in the bone marrow, blood, and other tissues. In the current clinical diagnosis and treatment scheme, the "7+3" chemotherapy regimen (i.e., continuous injection of cytarabine for 7 days, followed by combination with anthracycline drugs for 3 days) is the main treatment strategy for AML patients. However, only about 60%~80% of patients are sensitive to standard chemotherapy, and patients over 60 years old often have poor tolerance and are difficult to accept high-intensity chemotherapy.

[0003] Targeted inhibitors targeting the FLT3 signaling pathway, IDH1 / 2 metabolic enzymes, and BCL-2 apoptosis proteins can significantly improve the efficacy of AML treatment. However, due to the high incidence of low-risk cytogenetics or genetic mutations, such targeted therapy is only suitable for a part of the population, and drug resistance problems are prone to occur. Therefore, current research is focusing on the development of epigenetic targeted drugs to overcome the limitations of existing therapies and expand treatment options.

[0004] tRNA methyltransferase 61A (TRMT61A) is a key enzyme that catalyzes the modification of tRNA at position 58 N1-methyladenosine (m1A), and maintains the stability and translation function of tRNA by forming a complex with TRMT6. The TRMT61A gene is located in the region of 103529196-103537073 of the human chromosome 14 GRCh38 genome version, and its abnormal expression shows a significant carcinogenic effect in various malignant tumors. In the tumor tissues of patients with liver cancer and head and neck squamous cell carcinoma, the expression level of TRMT61A is significantly higher than that in normal tissues. The increase in expression level is closely related to the diffusion, migration ability, and strengthening of invasiveness of tumor cells. In bladder cancer, the increase in m1A modification level is consistent with the dysregulation of unfolded protein response (UPR) related genes. Molecular mechanism studies have shown that the TRMT6 / TRMT61A complex promotes PPARδ protein translation by increasing m1A methylation in tRNA, thereby triggering cholesterol synthesis to activate Hedgehog signaling, ultimately driving the self-renewal of liver cancer stem cells and tumorigenesis. However, the mechanism of action of TRMT61A in AML has not been reported. SUMMARY

[0005] In order to solve the problem of the limited clinical applicability of chemotherapy and targeted inhibitor treatment in current AML treatment, the application provides an application of TRMT61A as a target in preparation of an AML treatment drug.

[0006] The technical scheme of the application: The application of the TRMT61A inhibitor in preparation of an acute myeloid leukemia treatment drug.

[0007] Further, the TRMT61A inhibitor is a small molecule compound or an artificially designed small nucleic acid gene silencing preparation.

[0008] Further, the TRMT61A inhibitor is a small molecule compound Thiram, and the Thiram is a dithiocarbamate compound with a molecular formula of C6H 12 N2S4.

[0009] Further, the content of Thiram in the acute myeloid leukemia treatment drug is 10-150 nM.

[0010] Further, the acute myeloid leukemia treatment drug is a combined application of the small molecule compound Thiram and an mTOR inhibitor Rapamycin.

[0011] Further, the acute myeloid leukemia treatment drug is a combined application of the small molecule compound Thiram and a KDM1A inhibitor ORY1001.

[0012] Further, the acute myeloid leukemia treatment drug is a combined application of the small molecule compound Thiram and Ara-C.

[0013] Further, the artificially designed small nucleic acid gene silencing preparation is sgRNA, and the sequence of the sgRNA is shown in SEQ ID No: 1 or SEQ ID No: 2.

[0014] Further, the acute myeloid leukemia treatment drug is a combined application of the small nucleic acid gene silencing preparation sgRNA and Ara-C.

[0015] The beneficial effects of the application: The application knocks out TRMT61A in acute myeloid leukemia cells, significantly inhibits tumor cell proliferation, promotes cell apoptosis and differentiation, and blocks cell cycle progression. TRMT61A deletion leads to down-regulation of key protein expression in the PI3K / AKT / mTOR signaling pathway, thereby relieving the inhibition of the pathway on apoptosis, restoring the function of myeloid differentiation-related transcription factors, and inhibiting cell cycle progression by blocking mTORC1-dependent protein synthesis.

[0016] The present application first discloses a new use of TRMT61A inhibitor Thiram in treating acute myeloid leukemia. Through in vitro AML cell experiments and patient primary leukemia cell verification, Thiram can effectively reduce the growth and proliferation ability of AML cells, and significantly weaken the viability of leukemia cells in patients. Through animal model experiments, it is proved that Thiram can inhibit the migration and colonization of leukemia cells to liver and spleen, effectively delay the progression of leukemia, reduce the mortality of mice, and has a synergistic effect on inhibiting the progression of leukemia with the clinical first-line chemotherapy drug Ara-C, and has high clinical transformation value.

[0017] tRNA methyltransferase TRMT61A promotes the expression of core pathway proteins such as PI3K / AKT / mTOR, and inhibiting the expression of TRMT61A protein shows a broad-spectrum inhibitory effect on AML. PI3K / AKT / mTOR pathway is generally abnormally activated in AML, and TRMT61A inhibitor regulates this pathway through upstream, which can avoid the drug resistance problem of direct inhibitors. Epigenetic drugs are often synergistic with chemotherapy or other targeted drugs, and the combined effect of Thiram with mTOR inhibitor Rapamycin or KDM1A inhibitor ORY1001 on AML cells is significantly synergistic, which improves the efficacy of existing AML treatment programs and has broad clinical application prospects. BRIEF DESCRIPTION OF DRAWINGS

[0018] Figure 1 The survival rate comparison chart of the high expression group and the low expression group of patients detected by two probes in Example 1, A is 221907_at probe, and B is 52741_at probe; Figure 2 The cell proliferation count result comparison chart of the control group and the TRMT61A knockout group in Example 2; Figure 3 The colony formation comparison chart of the control group and the TRMT61A knockout group in Example 2, A is the colony formation photo, and B is the colony formation colony number comparison chart; Figure 4 The CD11b positive cell proportion comparison chart of the control group and the TRMT61A knockout group in Example 2; Figure 5 The cell apoptosis proportion comparison chart of the control group and the TRMT61A knockout group in Example 2; Figure 6 The PI3K / AKT / mTOR pathway protein expression comparison chart of the control group and the TRMT61A knockout group in Example 2; Figure 7 The cell viability comparison chart of leukemia cells in each group after treatment with different concentrations of Thiram in Example 3; Figure 8Cell viability of leukemia cells in bone marrow of AML patients treated with different concentrations of Thiram in Example 3; Figure 9 Cell viability of leukemia cells in bone marrow of AML patients treated with different concentrations of Thiram in Example 3; Figure 10 Cell viability of leukemia cells in bone marrow of AML patients treated with different concentrations of Thiram in Example 3; Figure 11 Cell viability of leukemia cells in bone marrow of AML patients treated with different concentrations of Thiram in Example 3; Figure 12 Cell viability of leukemia cells in bone marrow of AML patients treated with different concentrations of Thiram in Example 3; Figure 13 Cell viability of leukemia cells in bone marrow of AML patients treated with different concentrations of Thiram in Example 3; Figure 14 Cell viability of leukemia cells in bone marrow of AML patients treated with different concentrations of Thiram in Example 3. DETAILED DESCRIPTION

[0019] The technical solutions of the present application are further described below in conjunction with the examples, but are not limited thereto. Any modification or equivalent replacement to the technical solutions of the present application without departing from the spirit and scope of the present application shall be encompassed in the protection scope of the present application. The process equipment or device not specifically mentioned in the following examples is the conventional equipment or device in the art. If not specifically mentioned, the raw materials used in the examples of the present application are commercially available. If not specifically mentioned, the technical means used in the examples of the present application is the conventional means known to those skilled in the art.

[0020] Example 1 In this example, the Kaplan-Meier public database was used to analyze the correlation between the expression level of TRMT61A in human acute myeloid leukemia patients and the survival period.

[0021] The survival rate of patients in different groups was compared. P value less than 0.05 proves that there is a correlation between the expression of the gene and the survival rate of patients.

[0022] As Figure 1 As shown in the survival rate data comparison of the 221907_at probe group in A, the survival rate of the TRMT61A low expression group was significantly improved compared with the TRMT61A high expression group, and the corresponding hazard ratio (HR) was 1.54 (95% confidence interval: 1.15-2.08), and P=0.0037, indicating that the survival period of the TRMT61A high expression group was significantly shortened.

[0023] As Figure 1 As shown in the survival rate data comparison of the 52741_at probe group in B, the survival probability of the TRMT61A low expression group was also significantly higher than that of the high expression group, and the hazard ratio (HR) was 1.62 (95% confidence interval: 1-2.62), P=0.046.

[0024] In summary, compared with the TRMT61A low expression group (blue curve), the 50, 100, 150 and 200 month cumulative survival rates of the high expression group (orange curve) were significantly reduced (P<0.05), further confirming that the high expression of TRMT61A is closely related to the poor prognosis of AML patients, which is manifested as a significantly shortened survival period, suggesting that it may become a prognostic evaluation and potential therapeutic target.

[0025] Example 2 In this embodiment, a TRMT61A knockout AML stable cell model was constructed by CRISPR / Cas9 KO technology, and the cell proliferation, cell apoptosis, cell cycle and cell differentiation of the cell model were investigated.

[0026] In this embodiment, sgRNA sequences were designed according to the DNA sequence of TRMT61A gene in NCBI database, which were as follows: sg61A#1: ATACGAGGAGCTGATCAAGG, as shown in SEQ ID No: 1; sg61A#2: ACTGGGCCATGGTGCAATGG, as shown in SEQ ID No: 2.

[0027] This example will be two sgRNA sequences cloned into the lentiviral vector pLenti-U6-sgRNA-SFFV-Cas9-2A-pPuro plasmid, get for knocking out the target gene TRMT61A plasmid. The specific molecular construction work is completed by Shanghai Aibimeng Biotechnology Co., Ltd.

[0028] Using lentiviral packaging technology in 293T cells to package lentivirus containing TRMT61A sgRNA, human acute myeloid leukemia cell line-Kasumi-1 cells were cultured to the logarithmic growth phase with 1640 medium containing 10% fetal bovine serum, and Kasumi-1 cells were infected with lentivirus medium containing 2 μg of Polybrene (polybrene) per milliliter of culture medium after mixing with virus, and the surviving cells were selected using 1 μg / ml puromycin antibiotic 10% FBS 1640 medium, and TRMT61A knockout stable cell lines sg61A#1 and sg61A#2 were obtained. In the same way, Kasumi-1 cells were infected with empty control lentivirus without sgRNA sequence, and empty control sgCtrl was obtained.

[0029] I. Cell proliferation experiment: Collect TRMT61A knockout Kasumi-1 cells sg61A#1, sg61A#2 and empty control group sgCtrl, respectively adjusted to 1×10 5 cells / well seeded into 6-well plates, 3 parallel holes were set for each group, and the cells were cultured in a cell incubator. Every 2 days, the cells were counted after staining with trypan blue, and a total of 10 days.

[0030] The results are shown in Figure 2 Compared with the control group sgCtrl, the cell proliferation ability of the knockout group sg61A#1 and sg61A#2 was significantly decreased.

[0031] II. Cell cloning experiment: Collect TRMT61A knockout Kasumi-1 cells sg61A#1, sg61A#2 and empty control group sgCtrl, and inoculate single cell suspension at a density of 1000 cells / well in a 6-well culture plate, set 3 parallel holes for each group; placed in a 37℃, 5% CO2 incubator for continuous culture for 8-14 days, and the fresh medium was replaced every 3 days during the culture period; after the culture was terminated, the culture medium was discarded, 70% ethanol was fixed at room temperature for 15 minutes, and 0.5% crystal violet solution was stained for 15 minutes; count the clone colonies containing ≥50 cells, and calculate the cloning efficiency. All experiments were repeated three times.

[0032] The results are shown in Figure 3As shown, compared with the control group sgCtrl, the clonogenic ability of the knockout groups sg61A#1 and sg61A#2 was significantly reduced, and the self-renewal ability of the cells was inhibited.

[0033] III. Cell differentiation experiment Kasumi-1 cells sg61A#1, sg61A#2 and empty control group sgCtrl after TRMT61A knockout were collected: the supernatant was discarded, 1 ml PBS was added for washing once, the supernatant was discarded, the cell suspension was transferred into a centrifuge tube, and the cells were collected by centrifugation at 1500 rpm for 5 min. Add 3 ml of 4°C pre-cooled PBS to resuspend the cells, centrifuge at 1500 rpm for 5 min, and discard the supernatant. Shake the precipitate to mix. After counting, 500,000 cells were dispensed per well and centrifuged at 400g for 5 minutes, and the supernatant was discarded. 100 microliters containing 2.5 microliters of CD11b + Resuspend the cells with antibody dilution buffer for the antibody, and incubate on ice for 30 minutes, avoiding light. Centrifuge at 400g for 5 minutes, discard the supernatant, and resuspend the cells with 500 microliters of pre-cooled PBS per sample before use. Measure on the machine.

[0034] As shown in the results Figure 4 As shown, compared with the control group sgCtrl, the proportion of CD11b positive cells (myeloid-derived immune cells) in the knockout groups sg61A#1 and sg61A#2 was significantly increased, suggesting that the differentiation ability of AML cells was enhanced after TRMT61A knockout.

[0035] IV. Apoptosis experiment TRMT61A knockout Kasumi-1 cells sg61A#1, sg61A#2 and empty control group sgCtrl were washed with pre-cooled PBS to discard the supernatant, and 500,000 resuspended cells were taken, centrifuged at 1000 rpm for 5 min, and the supernatant was discarded. Apoptosis detection kit was used for detection. The fluorescence signals of Annexin V-FITC and PI-FE were measured by flow cytometry, and the data were analyzed using FlowJo software.

[0036] As shown in the results Figure 5 As shown, compared with the control group sgCtrl, the apoptosis cells of the knockout groups sg61A#1 and sg61A#2 were significantly increased, and the proportion of early and late apoptosis cells was higher than that of the control group.

[0037] V. PI3K / AKT / mTOR pathway protein expression PI3K / AKT / mTOR pathway plays a key role in regulating cell growth, proliferation, survival, metabolism and protein synthesis, and abnormal activation of the pathway is closely related to the occurrence and development of cancer. In this embodiment, the expression of key proteins P13K (phosphatidylinositol 3-kinase), AKT (protein kinase B) and mTOR (mammalian target of rapamycin) in the PI3K / AKT / mTOR pathway of Kasumi-1 cells after TRMT61A knockout and control cells were detected by conventional Western Blotting (Western Blotting) experiment, and the effect of targeting inhibition of TRMT61A expression on the expression of PI3K / AKT / mTOR pathway proteins was investigated.

[0038] The results of the WB experiment are shown in Figure 6 Compared with the control group sgCtrl, the expression of PI3K / AKT / mTOR pathway proteins in the knockout group cells was down-regulated.

[0039] According to the analysis of the above experimental data, inhibiting the expression of TRMT61A in acute myeloid leukemia cells can down-regulate the expression of PI3K / AKT / mTOR pathway proteins, inhibit the differentiation of AML tumor cells, increase the apoptosis of AML tumor cells, and reduce the proliferation rate and self-renewal ability of AML tumor cells.

[0040] Example 3 This embodiment provides an acute myeloid leukemia treatment drug, which contains a TRMT61A inhibitor, a small molecule compound Thiram.

[0041] Thiram (Thiram) is a dithiocarbamate compound with a molecular formula of C6H 12 N2S4, CAS No. 137-26-8; widely used as an agricultural fungicide and a vulcanization accelerator in the rubber industry. As a fungicide, it can be used for wheat, corn, cotton seed treatment to prevent and control soil and seed-borne fungal diseases (such as damping-off, anthracnose). The Thiram used in this embodiment is purchased from Aladdin brand with the item number T111114-250mg.

[0042] First, this embodiment provides the cell viability detection results of human acute myeloid leukemia cell lines SHI cells, SKNO-1 cells, Kasumi-1 cells and OCI-AML2 cells after treatment with different concentrations of Thiram, and the specific detection method is as follows: Thiram powder was dissolved by organic solvent DMSO and diluted by phosphate buffer solution. Thiram with concentrations of 10 nM, 20 nM, 50 nM, 100 nM and 150 nM was set up to treat SHI cells, SKNO-1 cells, Kasumi-1 cells and OCI-AML2 cells respectively, and the number of cells in each well was 1×10 5 The cell culture solution with corresponding concentration of drug was prepared fresh every day.

[0043] The results are shown in Table 1. Figure 7 As shown in Table 1, the cell viability of Kasumi-1 cells, SKNO-1 cells, OCI-AML2 cells and SHI cells decreased with the increase of Thiram concentration.

[0044] In the second embodiment, the cell viability of AML patient bone marrow cells after treatment with different concentrations of Thiram was provided, and the specific detection method was as follows: Thiram powder was dissolved by organic solvent DMSO and diluted by phosphate buffer solution. Thiram with concentrations of 10 nM, 20 nM, 50 nM, 100 nM and 200 nM was set up to treat AML patient bone marrow cells AML#01 and AML#04 with a cell concentration of 5000 cells / well, and the cell culture solution was replaced every day.

[0045] The results are shown in Table 2. Figure 8 As shown in Table 2, AML patient bone marrow cells AML#01 and AML#04 had a dose-dependent response to Thiram, and showed a significant decrease in viability under high concentration of inhibitor, thereby proving that Thiram could inhibit the cell viability of leukemia cells in AML patients.

[0046] Example 4 The present embodiment provides the combined effect of TRMT61A knockout combined with clinical chemotherapy drug Ara-C (Ara-C).

[0047] Kasumi-1 cell stable cell lines sg61A#1 and sg61A#2 of TRMT61A knockout and empty control sgCtrl of Kasumi-1 cell were obtained by the method of Example 2. The sg61A-1 cells, sg61A-2 cells and sgCtrl cells were treated with AML chemotherapy drug Ara-C at concentrations of 15.625 nM, 31.25 nM, 62.5 nM, 125 nM, 250 nM, 500 nM, 1000 nM, 5000 cells per well (96-well plate), and the cell culture medium was replaced with the corresponding drug concentration every 24 hours, and the cell counting was performed every two days.

[0048] The results are shown in Figure 9 TRMT61A knockout combined with Ara-C group has the lowest leukemia cell viability.

[0049] Example 5 This example provides the evaluation results of the synergistic effect of TRMT61A inhibitor Thiram and currently known pathway inhibitors in leukemia.

[0050] I. TRMT61A inhibitor Thiram combined with mTOR inhibitor Rapamycin To evaluate the synergistic effect of Thiram (5 nM, 10 nM, 25 nM, 50 nM) and currently known pathway inhibitor Rapamycin (1 nM, 2 nM, 5 nM concentration) in leukemia, Kasumi-1 cells of acute myeloid leukemia (5000 cells per well, 96-well plate) were treated with the combination of drugs at different drug concentrations, and CTG cell viability detection was performed after 72 hours of treatment.

[0051] The results are shown in Figure 10 After calculating the ZIP synergistic effect score chart, the reference index of combined drug efficacy was obtained, and the calculation result was 13.2 (synergistic score greater than 10 indicates that the combination of two drugs has synergistic effect), which indicates that the combination of Thiram and Rapamycin has a significant synergistic inhibitory effect on leukemia cells.

[0052] II. TRMT61A inhibitor Thiram combined with KDM1A inhibitor ORY1001 To evaluate the synergistic effect of Thiram (10 nM, 20 nM, 30 nM, 40 nM, 50 nM) and the epigenetic drug ORY1001 (0.5 μmol, 1 μmol, 2 μmol, 4 μmol, 8 μmol) in the clinical phase II experiment, Kasumi-1 cells of acute myeloid leukemia (5000 cells / well, 96-well plate) were treated with different concentrations of leukemia cells and different concentrations of drugs, and CTG cell viability detection was performed after 96 hours of treatment.

[0053] The results are shown in Figure 11 The ZIP synergistic effect score chart was calculated, and the reference index of combined drug efficacy was obtained. The calculation result was 39.86 (a synergistic score greater than 10 indicates that the combination of the two drugs has a synergistic effect), indicating that the combination of Thiram and ORY1001 has a significant synergistic inhibitory effect on leukemia cells.

[0054] Example 6 This example provides the situation of mouse spleen and survival period after administration of Thiram, an inhibitor of TRMT61A, in a MLL-AF9 mouse AML leukemia model. This example provides the results of spleen morphology and animal survival statistics, which can verify the morphological and overall survival benefits from two dimensions to provide key evidence for the in vivo anti-leukemia activity and safety of Thiram.

[0055] I. Preparation and adaptive feeding of mice 6-8 week old female C57BL / 6 mice were raised in a barrier environment, maintained at a temperature of 22-25°C and a humidity of 40-60%, with a 12h light-dark cycle. The mice could freely eat sterilized feed and drink water, and were adaptively fed for more than three days. The mental state, activity, and body weight of the mice were observed daily to exclude abnormal individuals.

[0056] II. Construction of MLL-AF9 leukemia model (1) Retrovirus packaging (three-plasmid system + 293T cells) and hematopoietic stem cell transfection 293T cells were passaged into 10 cm culture dishes 24 hours before the experiment, and the confluence reached 70-80% at the time of transfection. The culture medium and PBS were pre-warmed for 30 min, and the liposome reagent was room temperature for 15 min. During the virus packaging operation, the transfection complex was first prepared: pMIG-FLAG-MLL-AF9 plasmid (Addgene plasmid #71443; RRID: Addgene_71443) + PUMVC plasmid + VSV-G plasmid mixed with transfection reagent, and left to stand.

[0057] 293T cells were replaced with fresh culture medium, and the transfection complex was added to the culture dish, which was incubated at 37℃ in a 5% CO2 environment for 8 hours. The culture medium was discarded and replaced with fresh complete culture medium.

[0058] The culture medium was replaced and collected at 24 and 48 hours after transfection (containing virus particles). The virus solution was concentrated using an ultrafiltration tube, and the virus titer was measured and used to infect mouse hematopoietic stem cells (HSCs).

[0059] In vitro culture conditions for mouse hematopoietic stem cells (HSCs): Opti-MEM containing 20% fetal bovine serum TM Serum-reduced medium; add stem cell culture cytokines. Incubate at 37℃ in a 5% CO2 humidified incubator, and replace the fresh culture medium daily.

[0060] Before infection, prepare mouse hematopoietic stem cells in logarithmic growth phase with a viability of ≥90%, add Polybrene and an appropriate amount of virus solution, centrifuge the culture plate, and replace the fresh culture medium after incubation at 37℃ in a 5% CO2 environment for 24 hours. After 72 hours, detect the proportion of GFP-positive cells by flow cytometry and sort them. Keep the GFP-positive cell population and expand it for quality control. Collect MLL-AF9 cells.

[0061] (2) Mouse transplantation Observe the state of MLL-AF9 cells 24 hours before the experiment to ensure uniform suspension without obvious aggregation, good refraction, and a viability of ≥90%. When preparing the cells for injection, collect the cell suspension in a sterile centrifuge tube, place it in a centrifuge, and centrifuge at 1000 rpm at room temperature for 5 minutes. Discard the supernatant. Add 10 mL of pre-warmed PBS, gently resuspend the cells by blowing, and centrifuge again at 1000 rpm for 5 minutes. Repeat the washing twice to completely remove the residual components of the culture medium and cell debris. Discard the supernatant from the last centrifugation, add 1 mL of serum-free culture medium or PBS, and gently blow to prepare a single-cell suspension. Take 20 μL of the suspension for cell counting and viability detection. According to the counting results, adjust the cell concentration to 5×10 5 cells / 100 μL with normal saline or PBS.

[0062] Take the mouse for cell injection, with an injection amount of 1×10 6 Hold the mouse's tail root with the left hand and hold the syringe with the right hand, with the needle at a 15-30° angle to the tail vein. Slowly push the syringe plunger, and observe the tail for no swelling or fluid leakage. After injection, press the puncture site with a dry cotton ball for 30 seconds to prevent blood leakage. Place the mouse back in the original cage, mark the cage number and mouse number. Monitor the mouse daily after cell injection, record the mouse's mental state, hair, food intake, water intake, and defecation. Pay special attention to whether the mouse shows typical leukemia symptoms such as kyphosis, rapid breathing, and splenomegaly.

[0063] After injection, 20 μL of whole blood was taken from the tail vein of mice every week to make blood smears, which were stained with Wright-Giemsa and observed under a microscope to determine whether abnormal leukemia cells were present. When the mice in the same group showed typical leukemia characteristics, bone marrow or spleen single-cell suspensions were taken and the proportion of GFP-positive cells in MLL-AF9 leukemia cells was detected by flow cytometry. The experimental protocol was approved by the relevant experimental animal management and welfare ethics committee, and the euthanasia of mice was in accordance with the "3R principle".

[0064] III. Drug intervention and phenotype analysis After 7 days of feeding, drug experiments were performed. MLL-AF9 mice were divided into a control group, a Thiram single-drug group, an Ara-C single-drug group, and a Thiram and Ara-C combined drug group, with eight mice in each group. The drug administration scheme was as follows: the Thiram single-drug group was administered at a dose of 1.6 mg Thiram / kg body weight, the Ara-C single-drug group was administered at a dose of 50 mg Ara-C / kg body weight, the Thiram and Ara-C combined drug group was administered at a dose of 1.6 mg Thiram / kg body weight and 50 mg Ara-C / kg body weight, and the control group was administered the same amount of drug solvent DMSO (not more than 1% of the total volume of the drug solution). Each group was administered drugs a total of three times, with two days between each administration.

[0065] Seven days after the first administration, three mice from each group were taken for spleen and body weight measurement. The percentage of spleen weight to total body weight in the control group, the Thiram single-drug group, the Ara-C single-drug group, and the Thiram and Ara-C combined drug group was calculated and statistically analyzed, and the proportion of AML cells in bone marrow cells was also statistically analyzed using flow cytometry. The remaining mice were continuously observed for survival status, and the survival of mice in each group was recorded and survival time was statistically analyzed.

[0066] The results are shown in Figure 12 The control group showed significant pathological enlargement of the spleen tissue; in contrast, the pathological changes in the Thiram single-drug group, the Ara-C single-drug group, and the Thiram and Ara-C combined treatment group were significantly reduced, with the combined drug group showing the lowest degree of splenomegaly, directly demonstrating that Thiram can effectively inhibit the migration and colonization of leukemia cells to the liver and spleen tissue, inhibit organ infiltration of leukemia cells, and can be used in combination with the clinical chemotherapy drug Ara-C to synergistically inhibit leukemia progression.

[0067] Figure 13The results showed that the proportion of leukemia cells in bone marrow of control group was as high as 90.9%, Thiram single drug group was 83.4%, Ara-C single drug group was 69.5%, and the proportion of combined administration group was significantly reduced to 33.4%. This shows that Thiram can inhibit the bone marrow infiltration of leukemia cells, and show a synergistic effect with Ara-C, which provides a potential combination drug strategy for clinical use.

[0068] Figure 14 The results showed that the median survival time of the control group was shorter, while the survival time of the Thiram treatment group was significantly prolonged, which indicated that Thiram could significantly prolong the survival time of MLL-AF9 leukemia model mice, and effectively delay the progression of leukemia in vivo, reduce the mortality of animals, which is one of the most promising therapeutic evidence of the compound for transformation application.

Claims

1. Use of a TRMT61A inhibitor in the preparation of a drug for treating acute myeloid leukemia.

2. The use of the TRMT61A inhibitor according to claim 1 for the preparation of a medicament for the treatment of acute myeloid leukemia, characterized in that, The TRMT61A inhibitor is a small molecule compound or an artificially designed small nucleic acid gene silencing agent.

3. The use of the TRMT61A inhibitor according to claim 2 for the preparation of a medicament for the treatment of acute myeloid leukemia, characterized in that, The TRMT61A inhibitor is a small molecule compound Thiram, which is a dithiocarbamate compound with a molecular formula of C6H 12 N2S4.

4. The use of the TRMT61A inhibitor according to claim 3 for the preparation of a medicament for the treatment of acute myeloid leukemia, characterized in that, The content of Thiram in the drug for treating acute myeloid leukemia is 10-150 nM.

5. The use of the TRMT61A inhibitor according to claim 4 for the preparation of a medicament for the treatment of acute myeloid leukemia, characterized in that, The drug for treating acute myeloid leukemia is a combination of a small molecule compound Thiram and an mTOR inhibitor Rapamycin.

6. The use of the TRMT61A inhibitor according to claim 4 for the preparation of a medicament for the treatment of acute myeloid leukemia, characterized in that, The drug for treating acute myeloid leukemia is a combination of a small molecule compound Thiram and a KDM1A inhibitor ORY1001.

7. The use of the TRMT61A inhibitor according to claim 4 for the preparation of a medicament for the treatment of acute myeloid leukemia, characterized in that, The drug for treating acute myeloid leukemia is a combination of a small molecule compound Thiram and Ara-C.

8. The use of the TRMT61A inhibitor according to claim 2 for the preparation of a medicament for the treatment of acute myeloid leukemia, characterized in that, The artificially designed small nucleic acid gene silencing agent is an sgRNA, and the sequence of the sgRNA is shown in SEQ ID No: 1 or SEQ ID No:

2.

9. The use of the TRMT61A inhibitor according to claim 8 for the preparation of a medicament for the treatment of acute myeloid leukemia, characterized in that, The drug for treating acute myeloid leukemia is a combination of the small nucleic acid gene silencing agent sgRNA and Ara-C.

Images