Nucleic acid aptamer specifically targeting L-tryptophan
By redesigning the L-tryptophan aptamer sequence and its cDNA, and combining it with markers such as fluorescein to form nucleic acid aptamer derivatives, the cumbersome steps of traditional detection methods have been solved, achieving high-sensitivity and low-cost L-tryptophan detection.
Patent Information
- Application Number
- CN202410721999.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-06-05
- Publication Date
- 2025-12-05
AI Technical Summary
Traditional L-tryptophan detection methods are cumbersome, affecting the timeliness and sensitivity of the results, making it difficult to achieve rapid and convenient detection.
The L-tryptophan aptamer sequence and its partially complementary cDNA sequence were redesigned to obtain nucleic acid aptamers with high affinity and specificity. These aptamers were then modified by linking with substances such as fluorescein labeling, quencher group labeling, biotin, and streptavidin to form nucleic acid aptamer derivatives.
It enables simple and rapid L-tryptophan detection, with high batch-to-batch synthetic stability, low cost, and high detection sensitivity, making it suitable for various application scenarios.
Smart Images

Figure CN121065192A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, and particularly to a nucleic acid aptamer specifically targeting L-tryptophan. BACKGROUND
[0002] Selective fluorescence detection of free amino acids is an important part of biochemistry and molecular biology, and the concentration of which is closely related to the metabolism of polypeptides and proteins in organisms and various physiological processes. L-tryptophan is an essential amino acid for many animals and humans, and is also a precursor of serotonin and melatonin, which is related to schizophrenia, hallucinations and delusions. The detection of free amino acids also plays an important role in the detection of various foods, and can be used as an evaluation index for nutritional substance adulteration.
[0003] In recent years, nucleic acid aptamers have been widely studied for their potential analytical and biomedical applications. Nucleic acid aptamers are DNA or RNA molecules that can specifically bind to target molecules through the systematic evolution of ligands by exponential enrichment (SELEX) screening process, and the binding process is similar to antigen-antibody binding. Compared with antibodies, aptamers have a wide range of target molecules, from small metal ions to large cell target molecules. Since the nucleic acid sequence is obtained by chemical synthesis, it has low cost, good batch-to-batch stability, and is not sensitive to temperature. Combined with various nucleic acid amplification techniques, nucleic acid aptamers can greatly improve the detection sensitivity of biosensors. Currently, nucleic acid aptamers have been widely used in biological analysis, new drug development, environmental monitoring and other fields.
[0004] Traditional L-tryptophan detection schemes include spectrophotometric determination after chemical derivatization and high-performance liquid chromatography detection methods. The multi-step sample pretreatment and determination steps affect the timeliness and sensitivity of the detection results, hindering the practical application of L-tryptophan evaluation and determination. Therefore, developing a sensitive, simple and rapid detection method for L-tryptophan detection is of great significance for many practical applications of L-tryptophan detection. SUMMARY
[0005] To solve the timeliness and accuracy problems in traditional L-tryptophan detection, the present application simulates and predicts the secondary structure of L-tryptophan aptamer, redesigns the sequence of L-tryptophan aptamer and part of its complementary cDNA sequence, and obtains a nucleic acid aptamer with high affinity and specificity for L-tryptophan.
[0006] The first object of the present application is to provide a nucleic acid aptamer specifically targeting L-tryptophan, wherein the sequence of the nucleic acid aptamer is shown as SEQ ID NO. 1.
[0007] Further, the present application provides a cDNA sequence complementary to SEQ ID NO. 1, and the cDNA sequence is shown in SEQ ID NO. 2.
[0008] The second object of the present application provides a nucleic acid aptamer derivative, which is connected, modified and reformed from the nucleic acid aptamer provided by the present application.
[0009] Further, the substance connected by the nucleic acid aptamer and the cDNA in the present application comprises one or more of a fluorescein label, a quenching group label, biotin, and streptavidin.
[0010] The third object of the present application provides the use of the nucleic acid aptamer and the derivative thereof in the preparation of a sample for detecting tryptophan.
[0011] The present application has the following beneficial effects:
[0012] The present application re-designs and optimizes the sequence of the L-tryptophan aptamer, and obtains a nucleic acid aptamer with high affinity and specificity to L-tryptophan. The nucleic acid aptamer has high batch synthesis stability, short synthesis cycle, low cost, simple and rapid detection scheme, and has a wide application prospect in the determination of L-tryptophan concentration in the sample to be tested. BRIEF DESCRIPTION OF DRAWINGS
[0013] Figure 1 The secondary structure bioinformatics simulation diagram of the L-tryptophan aptamer and the cDNA thereof;
[0014] Figure 2 The affinity detection diagram of the aptamer combined with L-tryptophan;
[0015] Figure 3 The specificity detection diagram of the aptamer combined with L-tryptophan;
[0016] Figure 4 The standard curve diagram of the aptamer combined with L-tryptophan. DETAILED DESCRIPTION
[0017] The present application will be further described below in combination with the drawings and specific examples, so that those skilled in the art can better understand the present application and implement it, but the examples are not limiting to the present application.
[0018] Embodiment Example 1: Obtaining of the nucleic acid aptamer
[0019] The nucleic acid sequence used in the embodiment example of the present application is shown in Table 1.
[0020] Table 1
[0021] Sequence name Sequence (5'-3') SEQ ID L-tryptophan aptamer ATGCCGTTGGTTAGGTCAGGTTTGGGTTTCGGCATA SEQ ID NO. 1 cDNA TATGCCGAAA SEQ ID NO. 2
[0022] The online analysis of the analysis slip is used to analyze the aptamer SEQ ID NO. 1, the cDNA sequence SEQ ID NO. 2, and the secondary structure after double-stranded complementation, as shown in Figure 1 .
[0023] Example 2: Analysis of the binding affinity of the aptamer to L-tryptophan
[0024] The concentration of 50mM L-tryptophan was gradient diluted using PBS buffer to prepare 50μL of the sample to be tested. 2μL of 10μM L-tryptophan aptamer, 2μL of 10μM cDNA, and 46μL of PBS buffer were mixed and denatured at 95℃ for 5min and then ice-bathed for 15min. 50μL of the sample to be tested was mixed with 50μL of double-stranded DNA and incubated at 25℃ for 1h. The fluorescence intensity was read by a microplate reader, with the excitation wavelength set at 488nm and the emission wavelength set at 525nm. According to the relationship between the fluorescence signal and the concentration of L-tryptophan, a non-linear curve was fitted and the Kd value was calculated according to the formula y=Bmax×[ssDNA] / (Kd+[ssDNA]). As shown in Figure 2 , the fluorescence intensity increased with the increase of the concentration of L-tryptophan, and the Kd value was calculated as 979nM.
[0025] Example 3: Analysis of the binding specificity of the aptamer to L-tryptophan
[0026] In order to further verify the specificity of the binding of the aptamer to L-tryptophan, the concentrations of L-tryptophan, L-tyrosine, L-serine, indole, and L-phenylalanine were diluted to 2mM using PBS buffer, and the response of the aptamer to different amino acid structural analogs was determined using the method described in Example 2. As shown in Figure 3 , the response ability of the L-tryptophan aptamer to L-tryptophan was significantly higher than that to other structural analogs, indicating that the aptamer had good specificity.
[0027] Example 4: Linear response range of the binding of the aptamer to L-tryptophan
[0028] The concentration of 50mM L-tryptophan was gradient diluted using PBS buffer to prepare 50μL of the sample to be tested. 2μL of 10μM aptamer, 2μL of 10μM cDNA, and 46μL of PBS buffer were mixed and denatured at 95℃ for 5min and then ice-bathed for 15min. 50μL of the sample to be tested was mixed with 50μL of double-stranded DNA and incubated at 25℃ for 1h. The fluorescence intensity was read by a microplate reader, with the excitation wavelength set at 485nm and the emission wavelength set at 525nm. According to the relationship between the fluorescence signal and the concentration of L-tryptophan, a linear relationship curve of the response was drawn. As shown in Figure 4As shown, the fluorescence intensity increased with the increase of L-tryptophan concentration, and the linear regression equation was y = 64.969x + 351.07, R 2 = 0.99622, wherein y represents the fluorescence intensity, x represents LOG[L-tryptophan concentration (nM)], and the linear response range of the method was 100-5000 nM.
[0029] Obviously, the above embodiments are only examples for clearly illustrating, but not limitation to the embodiments. Based on the above description, other different forms of changes or variations can be made by those skilled in the art. Here, all the embodiments are not required to be exhausted, and the obvious changes or variations derived therefrom are still within the protection scope of the present application.
Claims
1. A nucleic acid aptamer specifically targeting L-tryptophan, characterized in that, The nucleic acid aptamer sequence is shown as SEQ ID NO.
1.
2. A cDNA sequence, characterized in that, The cDNA sequence is shown as SEQ ID NO. 2, which is partially complementary to the sequence SEQ ID NO.
1.
3. A derivative of a nucleic acid aptamer and complementary sequence, characterized in that, The nucleic acid aptamer is modified by the nucleic acid aptamer of claim 1, including one or more of fluorescent label, quenching label, biotin label, avidin label.
4. Use of the nucleic acid aptamer and its derivatives of claims 1-3 in the preparation of a reagent or kit for detecting tryptophan in a sample.