LTbetaR humanized genome, vector and application
By developing a humanized LTβR genome and vector, the limitations of traditional mouse models in simulating human LTβR function have been overcome, enabling better simulation of the human immune system and supporting disease research and the development of treatment strategies.
Patent Information
- Application Number
- CN202511276494.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-08
- Publication Date
- 2025-12-05
AI Technical Summary
Traditional mouse models cannot fully reflect the research results of human-related diseases due to significant differences in gene sequence and function between human and mouse LTβR, and are difficult to effectively simulate the function of human LTβR in the immune system.
A humanized LTβR genome was developed, containing a non-human animal endogenous LTβR promoter and a humanized LTβR gene. It was introduced into non-human mammals for expression via a vector, ensuring that the human transmembrane and intracellular domains support the physiological signal transduction of mouse cells and retaining regulatory elements for effective expression.
It provides a model that more closely resembles the human immune system, supporting research on LTβR-related diseases, drug screening, and the development of novel treatments. It also provides a deeper understanding of the function of LTβR under different physiological and pathological states, offering strategies for the clinical treatment of related diseases.
Smart Images

Figure CN121065197A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of genomics, and in particular to a LTβR humanized genome and vectors and uses thereof. BACKGROUND
[0002] Lymphotoxin β Receptor (LTβR) is a member of the tumor necrosis factor (TNF) superfamily, which is mainly involved in the development of the immune system, lymphoid organ formation and maintenance, immune cell migration and orientation, and the regulation of various biological processes in the inflammatory response and tumor immune microenvironment. The function of LTβR in the immune system has been extensively studied. It not only participates in the development of secondary lymphoid organs such as lymph nodes and spleen, but also plays an important role in regulating T cell proliferation, inducing inflammatory response and regulating autoimmune diseases. LTβR mainly activates downstream signaling pathways through binding with its ligand, lymphotoxin α1β2 (LTα1β2), and then affects cell migration, differentiation and proliferation. In the tumor microenvironment, the activation of LTβR can promote the formation of high endothelial venules (HEV), thereby increasing the infiltration of immune cells at the tumor site and enhancing the anti-tumor immune response.
[0003] In recent years, with the in-depth study of the biological function of LTβR and its role in diseases, scientists have developed various animal models to explore its role in different physiological and pathological states. Currently, researchers mainly use LTβR-deficient (knockout) mice to study its role in the immune system. These models show severe defects in lymphoid organ development, especially in the formation of lymph nodes and spleen. At the same time, models lacking LTβR also exhibit abnormalities in immune cell localization and migration. These studies reveal the importance of LTβR in the development of the immune system.
[0004] Although these traditional mouse models have played an important role in revealing the basic biological function of LTβR, due to the significant differences in gene sequence and function between human and mouse LTβR, many disease-related research results related to human sources cannot be fully reflected in these models. SUMMARY
[0005] In order to better simulate the function of human LTβR in different disease states, the applicant has developed a LTβR humanized genome to better simulate the performance of LTβR in gene sequence in vivo. The present application also relates to vectors and uses of the above-mentioned LTβR humanized genome.
[0006] Firstly, the present application provides a LTβR humanized genome, comprising: (i) a non-human animal genome endogenous LTβR promoter, and (ii) a humanized LTβR gene, wherein the humanized LTβR gene is operably linked to an endogenous LTβR promoter.
[0007] Preferably, the humanized LTβR gene comprises a nucleic acid sequence encoding the following amino acid sequence: Seq NO. 1: MRLPRASSPCGLAWGPLLLGLSGLLVASQPQAVPPYASENQTCRDQEKEYYEPQHRICCSRCPPGTYVSAKCSRIRDTVCATCAENSYNEHWNYLTICQLCRPCDPVMGLEEIAPCTSKRKTQCRCQPGMFCAAWALECTHCELLSDCPPGTEAELKDEVGKGNNHCVPCKAGHFQNTSSPSARCQPHTRCENQGLVEAAPGTAQSDTTCKNPLEPLPPEMSGTMLLLAILLSLVLFLLFTTVLACAWMRHPSLCRKLGTLLKRHPEGEESPPCPAPRADPHFPDLAEPLLPMSGDLSPSPAGPPTAPSLEEVVLQQQSPLVQARELEAEPGEHGQVAHGANGIHVTGGSVTVTGNIYIYNGPVLGGTRGPGDPPAPPEPPYPTPEEGAPGPSELSTPYQEDGKAWHLAETETLGCQDL.
[0008] Further preferably, the humanized LTβR gene is as follows: Seq NO. 2:
[0009] Further preferably, the non-human animal is a mouse.
[0010] It is important to ensure that the human transmembrane and intracellular domains support physiological signaling in mouse cells, because LTβR is critical for the development and organization of secondary lymphoid organs and the release of chemokines. The extracellular region, transmembrane region, and intracellular region of human and murine LTβR are 75%, 67%, and 69% similar, respectively. Thus, retaining the murine signal peptide, transmembrane region, and intracellular region sequence can effectively ensure the expression of humanized LTβR in murine cells, and improve the recognition of mouse adaptors and signal activation in mouse cells after humanization modification.
[0011] To retain regulatory elements as much as possible, the cDNA is inserted into the 5' end of exon 2, and the L32 residue in exon 1 is humanized. The influence on regulatory elements is minimal, only MIX1 and MAZ are affected.
[0012] In the above scheme, the murine sequence, murine endogenous promoter, and murine 5'UTR sequence are retained. Although the MAZ and MIX1 transcription factor binding regions are interfered, other core binding sites are retained, which can retain the expression regulation function as much as possible.
[0013] In a second aspect, the present application further provides a vector comprising the LTβR humanized genome according to the above genome on the basis of the above genome.
[0014] Preferably, the vector is a plasmid.
[0015] Preferably, the vector comprises a resistance screening element for screening, a homologous arm, a LoxP site, a FRT site, a DTA toxin gene, a gene editing fragment, and a promoter and terminator, wherein the gene editing fragment contains the LTβR humanized genome according to any one of the above.
[0016] In addition, the present application also comprises the use of the LTβR humanized genome according to any one of the above in simulating human immune responses.
[0017] Preferably, the use method is to introduce the vector into a non-human mammal and express it.
[0018] Preferably, the non-human mammal is a mouse.
[0019] Through the above scheme, the LTβR humanization construction technology provides a powerful tool for solving the many limitations of traditional mouse models. These models not only better simulate the human immune system, but also provide important support for the research of LTβR related diseases, drug screening, toxicity testing, and the development of new treatment methods. Through the humanized mouse model, researchers can gain a deeper understanding of the function of LTβR in different physiological and pathological states and its potential therapeutic applications, thereby providing new strategies and directions for the clinical treatment of related diseases. BRIEF DESCRIPTION OF DRAWINGS
[0020] Figure 1 is the vector diagram shown in Example 3.
[0021] Figure 2 is the expression result of LTβR protein in spleen samples.
[0022] Figure 3 is the expression result of LTβR protein in bone marrow samples. DETAILED DESCRIPTION
[0023] The scheme in the present application is further described through the following detailed description.
[0024] Example 1: Sequence construction The sequence shown as Seq NO 1 is designed: Seq NO 1: MRLPRASSPCGLAWGPLLLGLSGLLVASQPQAVPPYASENQTCRDQEKEYYEPQHRICCSRCPPGTYVSAKCSRIRDTVCATCAENSYNEHWNYLTICQLCRPCDPVMGLEEIAPCTSKRKTQCRCQPGMFCAAWALECTHCELLSDCPPGTEAELKDEVGKGNNHCVPCKAGHFQNTSSPSARCQPHTRCENQGLVEAAPGTAQSDTTCKNPLEPLPPEMSGTMLLLAILLSLVLFLLFTTVLACAWMRHPSLCRKLGTLLKRHPEGEESPPCPAPRADPHFPDLAEPLLPMSGDLSPSPAGPPTAPSLEEVVLQQQSPLVQARELEAEPGEHGQVAHGANGIHVTGGSVTVTGNIYIYNGPVLGGTRGPGDPPAPPEPPYPTPEEGAPGPSELSTPYQEDGKAWHLAETETLGCQDL.
[0025] Example 2: Design of LTβR humanized genome comprising (i) a non-human animal genomic endogenous LTβR promoter, and (ii) a humanized LTβR gene, in particular having the following sequence: Seq NO. 2: atgacaccacctgaacgtctcttcctcccaagggtgtgtggcaccaccctacacctcctccttctggggctgctgctggttctgctgcctggggcccaggggctccctggtgttggcctcacaccttcagctgcccagactgcccgtcagcaccccaagatgcatcttgcccacagcaccctcaaacctgctgctcacctcattggagaccccagcaagcagaactcactgctctggagagcaaacacggaccgtgccttcctccaggatggtttctccttgagcaacaattctctcctggtccccaccagtggcatctacttcgtctactcccaggtggtcttctctgggaaagcctactctcccaaggccacctcctccccactctacctggcccatgaggtccagctcttctcctcccagtaccccttccatgtgcctctcctcagctcccagaagatggtgtatccagggctgcaggaaccctggctgcactcgatgtaccacggggctgcgttccagctcacccagggagaccagctatccacccacacagatggcatcccccacctagtcctcagccctagtactgtcttctttggagccttcgctctgtag.
[0026] Example 3: Construction of vectors The vector map of the plasmid used in this application is shown in Figure 1 Figure 1, and the selected plasmid is pPNT, which is mainly used for studying the function of LTβR (Lymphotoxin β Receptor) gene and related biological processes. It should be noted that further expansion and optimization can be made on the pPNT plasmid, and the introduction of the above nucleic acid sequence can be achieved by specific nucleic acid cleavage enzymes. The vector contains the following important functional elements: Resistance selection element: This plasmid contains a neomycin resistance gene (Neo resistance cassette) for positive selection in transfected cells. The resistance gene is located downstream of the plasmid and works in conjunction with the antibiotic G418 to select for cells that have successfully been transfected with this plasmid. This resistance element is commonly used for selection and expansion of embryonic stem cells, ensuring that the selected cells contain the plasmid vector.
[0027] Homology arms (LA and SA): The ends of the plasmid are labeled LA and SA. These two sequences are homologous to the target gene site and can integrate the vector sequence into the target cell genome through homologous recombination, achieving site-specific insertion or modification of the LTβR gene in the cell.
[0028] LoxP sites and FRT sites: The plasmid contains two LoxP sites and two FRT sites. These elements allow specific genes in the plasmid to be cut or deleted under specific conditions through the Cre-loxP system and the FLP-FRT system, further increasing the flexibility of the vector in the process of gene editing. LoxP and FRT systems are often used in the construction of conditional gene knockout mouse models.
[0029] DTA toxin gene: The plasmid contains a DTA (diphtheria toxin A chain) gene, which is usually used for negative selection. The presence of this gene allows cells that have not correctly integrated the plasmid to be killed by DTA toxin, thereby improving the efficiency of selection and ensuring that only cells that have correctly inserted the target gene are retained.
[0030] Gene editing fragment (LTβR gene modification): The central part of the plasmid is marked as "chimeric LTβR CDS", representing the coding sequence shown in Seq1. The adjacent multiple exon and intron structures (such as exon 1, exon 2) indicate that this plasmid can be used to modify or replace a specific fragment of the LTβR gene. In addition, it also contains functional elements such as SP (signal peptide sequence) and TM (transmembrane segment) for normal physiological expression of the target protein.
[0031] Note that the above content provides only an example, which can be linked to any DNA sequence corresponding to the protein sequence shown in Seq1.
[0032] Promoter and terminator: The promoter region in the plasmid regulates gene expression, including Pol 2 Prom (RNA polymerase II promoter) and multiple transcription termination signals (such as SV40 polyA and hGH polyA), ensuring correct mRNA transcription and termination. These elements help to efficiently express the target gene in mammalian cells.
[0033] Example 4: Cell electroporation 100 μg of linearized plasmid, 260 volts, 500 μF, linearized vector was transfected into 108 C57B1 / 6 embryonic stem cells.
[0034] After 48 hours of electroporation, positive selection was initiated by the addition of 200 μg / ml G418 (active ingredient 150 μg / ml, from Life Technologies, Inc.). Drug resistant colonies were isolated and expanded in 96 well plates. Replicate plates of 96 well plates were made. Plates containing ES cell colonies expanded on gelatin were genotyped by PCR and sequencing analysis using primers and PCR expected sizes as shown in Table 1.
[0035] Example 5, Microinjection Embryo Transfer The above electroporated cells were injected into blastocysts of albino C57BL / 6 mice, which were then transferred into the oviducts of recipient dams to generate male chimeras with significant ES cell contribution.
[0036] Example 6, Expression Analysis after Gene Humanization Reference Figure 2 and Figure 3 , Figure 2 The expression results in spleen, Figure 3 The expression results in spinal cord samples. The WT group is the normal wild type mouse, and the antibody used has a clone site of 5G11. The hLTβR homozygous group is the mouse in Example 4. It can be seen that there is good expression in myeloid cells, dendritic cells and granulocytes.
[0037] This embodiment is only an explanation of the present application, and is not a limitation of the present application. Those skilled in the art can make modifications to this embodiment without creative contribution after reading this specification, and as long as the modifications are within the scope of the claims of the present application, they are protected by the patent law.