Application of pomegranate PgMYB10 gene in increasing anthocyanin content of plants

Abstract

The invention discloses application of a pomegranate PgMYB10 gene in increasing the anthocyanin content of plants, and belongs to the technical field of plant genetic engineering and molecular breeding. According to the application of the pomegranate PgMYB10 gene in improving the anthocyanin content of the plant, protein coded by the pomegranate PgMYB10 gene is over-expressed in the plant, the nucleotide sequence of the pomegranate PgMYB10 gene is shown as SEQ ID NO.1, and the amino acid sequence of the protein coded by the pomegranate PgMYB10 gene is shown as SEQ ID NO.2. Experiments show that the pomegranate PgMYB10 gene is connected to a plant expression vector, a PgMYB10-overexpressed transgenic pomegranate plant is obtained through agrobacterium-mediated genetic transformation, pigment accumulation of the whole plant is shown, and the pomegranate PgMYB10 gene has excellent ornamental value. Therefore, the invention has important theoretical significance and application value in promoting synthesis and accumulation of plant anthocyanin.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of plant genetic engineering and molecular breeding, and particularly relates to application of a Punica granatum PgMYB10 gene in increasing anthocyanin content in plants. BACKGROUND

[0002] Anthocyanins are a class of water-soluble natural pigments widely existing in plants, belong to flavonoids, have various physiological activities such as antioxidant, anti-inflammatory and anticancer, and are also key components for determining the color of plant organs (such as fruits and petals). Punica granatum L. is a fruit rich in anthocyanins, and the color and nutritional value of the fruit are closely related to the anthocyanin content. At present, the methods for increasing the anthocyanin content of Punica granatum mainly include optimization of cultivation management and traditional breeding techniques, but these methods have long cycles, low efficiencies, and are difficult to precisely control.

[0003] MYB transcription factor family plays an important role in the regulation of plant secondary metabolism, especially anthocyanin biosynthesis. Previous studies have shown that some MYB genes such as MdMYB10 of apple and VvMYBA1 of grape can activate the expression of key enzyme genes for anthocyanin synthesis, thereby promoting the accumulation of anthocyanins. However, the key MYB genes for regulating anthocyanin synthesis in Punica granatum and their applications have not been clearly defined. Therefore, it is of important theoretical and application value to explore the MYB genes in Punica granatum that specifically regulate anthocyanin synthesis and increase the anthocyanin content through genetic engineering techniques. SUMMARY

[0004] To solve the above problems in the prior art, the technical problem to be solved by the present application is to provide application of a Punica granatum PgMYB10 gene in increasing anthocyanin content in plants, which can effectively increase the anthocyanin content in plants.

[0005] To solve the above technical problems, the technical solution of the present application is as follows:

[0006] The application of the Punica granatum PgMYB10 gene in increasing anthocyanin content in plants is to overexpress the protein encoded by the Punica granatum PgMYB10 gene in plants, and the amino acid sequence of the protein encoded by the Punica granatum PgMYB10 gene is shown in SEQ ID NO. 2.

[0007] In some embodiments, the method comprises the following steps:

[0008] S1: constructing an expression vector of the Punica granatum PgMYB10 gene;

[0009] S2: transforming the expression vector of the Punica granatum PgMYB10 gene into plants or plant tissues;

[0010] S3: cultivating and screening to obtain the transgenic plant or plant tissue with increased anthocyanin content.

[0011] In some embodiments, the nucleotide sequence of the pomegranate PgMYB10 gene is shown as SEQ ID NO. 1.

[0012] In some embodiments, the method for constructing the expression vector of the pomegranate PgMYB10 gene is specifically: inserting the expression cassette of the pomegranate PgMYB10 gene into a vector skeleton, and the vector skeleton comprises a plant selective marker gene and / or a terminator sequence.

[0013] In some embodiments, the method for constructing the expression cassette of the pomegranate PgMYB10 gene is: connecting the pomegranate PgMYB10 gene with a plant functional promoter to form an expression cassette.

[0014] In some embodiments, the plant functional promoter is a cauliflower mosaic virus 35S promoter.

[0015] In some embodiments, the expression vector of the pomegranate PgMYB10 gene is pBI121-PgMYB10.

[0016] In some embodiments, the transformation is mediated by Agrobacterium.

[0017] The transgenic plant obtained by any of the above methods or a part thereof is used as a model for studying the regulation of anthocyanin synthesis in plants.

[0018] A biological material related to the expression protein of the pomegranate PgMYB10 gene is used in plant molecular breeding, and the amino acid sequence of the expression protein of the pomegranate PgMYB10 gene is shown as SEQ ID NO. 2, and the biological material is any one of the following I) to IV):

[0019] I), a nucleic acid molecule encoding the expression protein of the pomegranate PgMYB10 gene;

[0020] II), an expression cassette containing the nucleic acid molecule of I);

[0021] III), a recombinant vector containing the nucleic acid molecule of I), or a recombinant vector containing the expression cassette of II);

[0022] IV), a recombinant microorganism containing the nucleic acid molecule of I), or a recombinant microorganism containing the expression cassette of II), or a recombinant microorganism containing the recombinant vector of III).

[0023] Compared with the prior art, the beneficial effects of the present application are:

[0024] The PgMYB10 gene (nucleotide sequence as shown in SEQ ID NO. 1, and the encoded protein sequence as shown in SEQ ID NO. 2) is cloned from pomegranate peel. By constructing the PgMYB10 gene into a plant expression vector, the PgMYB10 gene is introduced into pomegranate plants by genetic transformation technology, and the pomegranate tissue culture seedlings overexpressing the PgMYB10 gene prove that the PgMYB10 gene can significantly increase the anthocyanin content of plants and increase the ornamental value. Therefore, the present application has important theoretical significance and application value in promoting the synthesis and accumulation of plant anthocyanins. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 Fig. 4 is a phenotype change diagram of a transgenic plant; A is a wild type plant; B-D are transgenic plants;

[0026] Figure 2 Fig. 5 is a diagram of a transgenic plant observed under a stereomicroscope; A is a wild type plant; B-F are transgenic plants;

[0027] Figure 3 Fig. 6 is a diagram of the total anthocyanin content and the expression level of PgMYB10 of a wild type plant and a transgenic plant; A is a wild type plant and a transgenic plant; B is the total anthocyanin content; C is the relative expression amount of PgMYB10;

[0028] Figure 4 Fig. 7 is a diagram of the determination results of the expression amount of anthocyanin synthesis related genes of a wild type plant and a transgenic plant. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical scheme and advantages of the present application clearer, the present application will be further described below in combination with specific examples. In the following examples, if not specifically described, the technical means used are all conventional means familiar to those skilled in the art, or are performed according to the instructions of the kit and product. In the following examples, the materials, reagents, etc. used, if not specifically described, can be obtained from commercial channels.

[0030] Example 1: Cloning of PgMYB10 gene

[0031] Total RNA is extracted from pomegranate fruits, and cDNA is synthesized by reverse transcription. Specific primers (such as PgMYB10-F: 5'-ATGAGAATCCATGTGGATAGGGGGCC-3'; PgMYB10-R: 5'-TTATATTATCCCCATCTCTTCTTGGTCGGCAC-3') are designed to amplify the full-length coding frame of the PgMYB10 gene by PCR. The PCR product is cloned into a pMD18-T vector, and sequencing verification (SEQ ID NO. 1) is performed.

[0032] 1. Extract RNA and reverse transcribe into cDNA

[0033] Total RNA of Punica granatum was extracted by RNeasy Plant Mini Kit (QIAGEN) and the concentration and purity of total RNA were determined by Nanodrop 1000. The reverse transcription was performed by SMARTer PCR cDNA Synthesis Kit (Clontech). TM

[0034] 2. Obtaining of PgMYB10 gene coding reading frame sequence

[0035] According to the previous transcriptome data of Punica granatum, PgMYB10 gene was screened. The specific primers for amplifying PgMYB10 gene were designed by Oligo6, and the primer sequences were as follows:

[0036] PgMYB10-F: 5'-ATGAGAATCCATGTGGATAGGGGGCC-3',

[0037] PgMYB10-R: 5'-TTATATTATCCCCATCTCTTCTTGGTCGGCAC-3'.

[0038] The PCR reaction system was as follows: 25 μL 2x Rapid Taq Master Mix (Novozyme, Nanjing), 20 μL ddH2O, 2.0 μL cDNA, Forward Primer (10 μM) 1.5 μL, Reverse Primer (10 μM) 1.5 μL.

[0039] The reaction program was as follows: 95℃ 3 min; 95℃ 15 sec, 58℃ 30 sec, 72℃ 30 sec, 30 cycles; 72℃ 6 min; 4℃ Forever.

[0040] The PCR product was cloned into pMD18-T vector, and the product was sequenced. The nucleotide sequence of PgMYB10 gene was as shown in SEQ ID NO. 1, and the amino acid sequence of the expressed protein was as shown in SEQ ID NO. 2.

[0041] Example 2: Construction and transformation of PgMYB10 overexpression vector

[0042] PgMYB10 gene was subcloned into plant expression vector pBI121 downstream of CaMV 35S promoter to construct pBI121-PgMYB10. pBI121-PgMYB10 was transformed into Punica granatum tissue culture seedlings by Agrobacterium-mediated method, and positive transgenic lines were screened by PCR method.

[0043] ​1. Construction of PgMYB10 gene plant expression vector

[0044] The target gene fragment was transferred to the target expression vector by using seamless cloning technology. The plasmid vector carries a Kan resistance gene.

[0045] 1) The PCR reaction system was: 25 μL 2x Rapid Taq Master Mix (Novozyme, Nanjing), 19 μL ddH2O, 2.0 μL cDNA template, 2 μL homologous arm Forward Primer

[0046] (gagaacacgggggactctagaATGAGAATCCATGTGGATAGGGGGCC), 2 μL homologous arm Reverse Primer

[0047] (ggactgaccacccggggatccTTATATTATCCCCATCTCTTCTTGGTCGGCAC).

[0048] The PCR reaction program was 95°C for 3 min; 95°C for 15 sec, 58°C for 30 sec, 72°C for 30 sec, 30 cycles; 72°C for 6 min; 4°C forever.

[0049] 2) The vector was double digested by using Xba I and BamH I endonuclease: the reaction system was: 5 μL 10x QuickCut Buffer, 1 μL Quick Cut Xba I, 1 μL Quick Cut BamH I, 3 μL vector and 40 μL ddH2O; 37°C reaction for 50 min and 82°C reaction for 5 min.

[0050] 3) The above product was recombined by using cloning kit Clon Ⅱ One Step Cloning Kit (Novozyme, Nanjing), the reaction system was 2 μL reaction product, 3 μL linearized vector, 2 μL 5x CEⅡBuffer, 1 μL ExnaseⅡ and 2 μL ddH2O; 37°C reaction for 30 min.

[0051] The positive clone after detection was further sequenced and verified. After recovery and purification of the correct sequencing bacteria liquid, the overexpression vector pBI121-PgMYB10 of the target gene was obtained, which was stored at -20°C for standby and used for pomegranate genetic transformation.

[0052] 2. Transformation of PgMYB10 gene pomegranate

[0053] 1) 1 μL pBI121-PgMYB10 plasmid was added to 50 μL EHA105 Agrobacterium competent cells, mixed thoroughly, then taken to the electroporation cup, 1 mL LB liquid medium was added after electroporation, mixed thoroughly, then taken to 1.5 mL centrifuge tube, 28°C, 180 rpm shaking culture for 30 min, the activated Agrobacterium was transferred to solid LB medium, 28°C culture, after the end of the transformation culture, Agrobacterium EHA105 containing pBI121-PgMYB10 single colony was picked and inoculated into LB liquid medium containing 50 mg / L Kan, 28°C, 250 r / min shaking culture for 12-16 h, when the OD600 of the bacterial solution was 0.8, centrifugation was performed at 6000 rpm for 8 min, the supernatant was discarded, and MS resuspension solution was used. 600

[0054] 2) The pomegranate tissue culture seedlings were taken out of the bottle, the leaves were removed, and the stem segments were cut into 1.0-1.5 cm long, and placed in the pre-culture medium (MS + 1.5 mg / L 6-BA + 0.6 mg / L NAA + 10 mg / L adenine sulfate + 30 g / L sucrose + 7.0 g / L agar + 0.1 g / L inositol) for 4 d.

[0055] 3) The stem segments treated by pre-culture were placed in a sterile conical bottle, the resuspension solution obtained in 1) was added and the stem segments were immersed, then transferred to a shaking bed for 200 rpm shaking to facilitate infection. After the end of infection, the bacterial solution on the surface of the stem segments was absorbed with sterile filter paper, and the stem segments were transferred to the co-culture medium (MS + 1.5 mg / L 6-BA + 0.6 mg / L NAA + 10 mg / L adenine sulfate + 20 mg / L AS + 30 g / L sucrose + 7.0 g / L agar + 0.1 g / L inositol) for dark culture for 3 d.

[0056] 4) After the end of dark culture, the stem segments were placed in the selection medium (MS + 1.5 mg / L 6-BA + 0.6 mg / L NAA + 10 mg / L adenine sulfate + 30 g / L sucrose + 7.0 g / L agar + 0.1 g / L inositol + 30 mg / L Kan + 400 mg / L Tim) for induction of resistant buds, the medium was replaced every two weeks. When the resistant buds grew to 2-3 cm, the medium was replaced with rooting medium (1 / 2MS + 1.0 mg / L IBA + 0.5 mg / L NAA + 30 g / L sucrose + 7.0 g / L agar + 0.1 g / L inositol + 30 mg / L Kan + 400 mg / L Tim).

[0057] Example 3: Functional verification of PgMYB10 in pomegranate

[0058] ​The phenotype of the transgenic plants was observed by naked eyes and stereomicroscope, the content of anthocyanin in the transgenic plants was detected by colorimetry, and the expression of PgMYB10 and anthocyanin synthesis related genes was detected by qRT-PCR.

[0059] 1. The phenotype of the PgMYB10 transgenic pomegranate seedlings was observed and compared with the control pomegranate tissue culture seedlings to confirm the changes in the phenotype. The results, as shown in Figure 1 , the leaves, leaf veins and stems of the PgMYB10 transgenic pomegranate seedlings were red. The red changes in the leaves and stems could be obviously observed under a stereomicroscope. Figure 2

[0060] 2. 0.2 g of the PgMYB10 transgenic pomegranate and control pomegranate tissue culture seedlings after rooting were taken, 5 mL of 0.1% hydrochloric acid methanol was added, and the mixture was extracted in the dark for 12 h. Then the solution was centrifuged at 10,000 rpm for 15 min, the supernatant was taken, and the absorbance values A530 and A657 at 530 nm and 657 nm were determined by a UV spectrophotometer. The total anthocyanin content was represented by the change in absorbance value (A530-0.25 x A657). As shown in Figure 3 A and 3B, the anthocyanin content of the PgMYB10 transgenic pomegranate seedlings was significantly increased, and the best content could reach 5.4 times of the control.

[0061] 3. The expression levels of PgCHS, PgCHI, PgF3H, PgDFR, PgANS and PgUFGT genes in the PgMYB10 transgenic pomegranate and control pomegranate tissue culture seedlings after rooting were detected. The real-time quantitative primers were designed by Oligo 6 software, and the primer and reference gene PgActin primer sequences are shown in the following table:

[0062] Primer name Primer sequence 5'-3(F) Primer sequence 5'-3(R) qPCR-PgActin GATTCTGGTGATGGTGTGAG GACAATTTCCCGTTCAGCAG qPCR-PgCHS CTGGGGCTGAAGGAGGAGAA TCCGAACCCGAAGAGGACAC qPCR-PgCHI TTCTGGAAATCCGTGGGC ATCCGCTGGGCGATTGAGT qPCR-PgF3H GCAACGGGAGGTTCAAGA TGAGCGGGTACACTATGGC qPCR-PgDFR GGCATCGCAAAGCTCCTA TCCCTGCAACACTCCACA qPCR-PgANS GAGGAAGGCAGGCTGGAGAA TTAGGGCGCTGATGTCGGT qPCR-PgUFGT GGCTTTCGTGACGCATTG TCCTTGGTTATGGCTCCC qPCR-PgMYB10 TGGAACACTCACATGGTCCG GTCCGAGGCCGAGGTTTAAT

[0063] qRT-PCR was performed by using an Applied Biosystems 7500 system. According to the instructions of the SYBR Green kit (Rox), the amplification program was as follows: 55°C for 2 min, 95°C for 10 min; 95°C for 15 s, 60°C for 1 min, for 40 cycles. Then the melting curve was generated by setting 60°C to 95°C. Each sample was technically repeated for 3 times, and the reaction system of 20 μL contained: 2 μL of diluted cDNA (the dilution ratio was 1:3, and the concentration of the diluted cDNA was about 350 ng / μL), 10 μL of Fast Start Universal SYBR Green Master (Rox), 6 pmol of upstream primer, 6 pmol of downstream primer and 6.8 μL of ddH2O. The relative expression amount of the gene was calculated according to 2 -ΔΔCt ​The method is calculated. The test data is statistically analyzed by SPSS19.0 software and plotted.

[0064] Results are shown in Figure 3 C and Figure 4 as shown. Figure 3 C shows that the expression amount of PgMYB10 gene in the pomegranate transgenic with PgMYB10 gene is significantly increased, and the highest is 27.2 times of the expression amount of PgMYB10 in the control pomegranate seedlings. Figure 4 It is shown that the expression amount of anthocyanin synthesis related genes PgCHS, PgCHI, PgF3H, PgDFR, PgANS and PgUFGT in the pomegranate transgenic with PgMYB10 gene is significantly increased, and the expression amount of PgUFGT is 36 times of the expression amount in the control pomegranate seedlings.

[0065] The above is only illustrative but not restrictive to the present application, and those skilled in the art understand that many modifications, changes or equivalents can be made without departing from the spirit and scope defined by the appended claims, but all will fall within the protection scope of the present application.

Claims

1. Application of Punica granatum PgMYB10 gene in increasing anthocyanin content in plants, characterized in that, The amino acid sequence of the protein encoded by the pomegranate PgMYB10 gene is shown as SEQ ID NO.

2.

2. Use according to claim 1, characterized in that, The method comprises the following steps: S1: constructing an expression vector of the pomegranate PgMYB10 gene; S2: transforming the expression vector of the pomegranate PgMYB10 gene into a plant or plant tissue; S3: cultivating the transgenic plant or plant tissue screened to obtain a plant or plant tissue with increased anthocyanin content.

3. Use according to claim 2, characterized in that, The nucleotide sequence of the pomegranate PgMYB10 gene is shown as SEQ ID NO.

1.

4. Use according to claim 2, characterized in that, The method for constructing the expression vector of the pomegranate PgMYB10 gene is specifically as follows: inserting an expression cassette of the pomegranate PgMYB10 gene into a vector skeleton, wherein the vector skeleton comprises a plant selective marker gene and / or a terminator sequence.

5. Use according to claim 3, characterized in that, The expression cassette of the pomegranate PgMYB10 gene is constructed by connecting the pomegranate PgMYB10 gene with a plant functional promoter to form an expression cassette.

6. Use according to claim 4, characterized in that, The plant functional promoter is a cauliflower mosaic virus 35S promoter.

7. Use according to claim 6, characterized in that, The expression vector of the pomegranate PgMYB10 gene is pBI121-PgMYB10.

8. Use according to claim 2, characterized in that, The transformation is performed by means of Agrobacterium.

9. Use of a transgenic plant plant or part thereof obtained by the method of any one of claims 1-6 as a model for studying the regulation of anthocyanin synthesis in plants.

10. The use of a biological material related to the expression protein of the Punica granatum L. PgMYB10 gene in plant molecular breeding, characterized by the fact that it is used as a marker for the selection of plants with increased resistance to abiotic stress. The amino acid sequence of the expression protein of the pomegranate PgMYB10 gene is shown as SEQ ID NO. 2, and the biological material is any one of the following I)-IV): I), a nucleic acid molecule encoding the expression protein of the pomegranate PgMYB10 gene; II), an expression cassette containing the nucleic acid molecule of I); III), a recombinant vector containing the nucleic acid molecule of I), or a recombinant vector containing the expression cassette of II); IV), a recombinant microorganism containing the nucleic acid molecule of I), or a recombinant microorganism containing the expression cassette of II), or a recombinant microorganism containing the recombinant vector of III).

Images