Application of rice protein kinase OsCIPK9 in improvement of zinc toxicity tolerance and grain zinc content

Abstract

The invention discloses application of a rice protein kinase gene OsCIPK9 in improvement of zinc toxicity tolerance and grain zinc content, belongs to the field of gene engineering, constructs a knockout plant and an overexpression plant of the OsCIPK9 gene, and compares the main root lengths of a wild type, a knockout mutant and the overexpression plant under normal zinc (0.4 mu M ZnSO4) and zinc toxicity (40 mu M ZnSO4) conditions in the seedling stage. And analyzing the tolerance of zinc poisoning. It is indicated that after the rice protein kinase gene OsCIPK9 is knocked out, the tolerance of rice seedlings to zinc poisoning is remarkably enhanced, and after the rice protein kinase gene OsCIPK9 is over-expressed, the tolerance of the rice seedlings to zinc poisoning is remarkably reduced. Besides, the wild type and the knockout mutant are cultured in a normal field, mature-period grains are harvested, and the zinc concentration in brown rice is measured and counted, so that the zinc concentration in the rice grains is obviously improved after the rice protein kinase gene OsCIPK9 is knocked out.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of genetic engineering, and particularly relates to application of rice protein kinase gene OsCIPK9 in improving zinc toxicity tolerance and grain zinc content. BACKGROUND

[0002] Zinc (Zn) is an essential trace element for normal growth and development of animals, plants and human beings. Both insufficient and excessive zinc content in soil will inhibit crop productivity, and thus threaten human health. As a major global food crop, high yield, stable yield and high quality production of rice are of great importance to national food security. Zinc toxicity not only restricts the normal growth and development of rice, but also reduces the accumulation of zinc in grains and the nutritional quality of rice. Therefore, it is of great scientific significance and application value to excavate key zinc-tolerant genes in rice, elucidate their molecular mechanisms, and create new germplasm with both zinc toxicity tolerance and grain zinc enrichment.

[0003] Rice is relatively sensitive to zinc toxicity. Root system is the primary target of zinc toxicity, and high-zinc environment can significantly inhibit root elongation, branching and root hair formation, thus weakening the ability of water and nutrient absorption (Kaur and Garg, 2021). Excessive zinc can damage the mitosis of root tip cells, induce the accumulation of a large amount of reactive oxygen species (ROS), and cause lipid peroxidation of cell membrane, protein denaturation and DNA damage (Cakmak, 2000). Zinc also competitively inhibits the activities of antioxidant enzymes such as superoxide dismutase (SOD) and catalase (CAT), reduces the antioxidant capacity of plants, and interferes with physiological processes such as photosynthesis and transpiration (Wang et al., 2009). In addition, zinc can competitively inhibit the absorption and transport of essential elements such as iron, manganese and copper, leading to ion imbalance in plants (Broadley et al., 2007). These mechanisms collectively exacerbate the effects of zinc toxicity, so it is particularly important to deeply analyze the physiological and molecular basis for developing zinc toxicity relief strategies.

[0004] Overexpression of zinc absorption or transport-related genes. By means of transgenic overexpression of genes encoding zinc / iron transport proteins (such as ZIP family, NAS, YSL, etc.), the absorption of zinc by roots or the transport of zinc to grains is enhanced. However, this may exacerbate zinc toxicity. In zinc-polluted soil, excessive absorption will lead to excessive accumulation of zinc in plants, aggravating the toxicity, and cannot simultaneously achieve zinc toxicity tolerance and grain zinc enrichment. Disruption of element balance, non-specific enhancement of metal absorption may lead to co-absorption of other heavy metals (such as cadmium), or interfere with the homeostasis of other essential elements in the body. There are potential negative effects, and continuous high-intensity expression of certain transport proteins may consume too much energy, affecting the normal growth and development of plants.

[0005] Knockout or inhibition of heavy metal absorption related genes. Knockout or inhibition of heavy metal transport protein genes (such as part of the Nramp or HMA family) by gene editing or RNAi technology to reduce zinc absorption. But this may reduce the zinc content of the grain, while reducing the absorption of toxic zinc, it often also reduces the transport and accumulation of zinc in the grain, resulting in a decrease in rice nutritional quality, which cannot balance tolerance and nutritional quality. Affecting the absorption of essential elements, many metal transport proteins have broad-spectrum functions, and their functional loss may affect the absorption of other essential trace elements.

[0006] Therefore, improving the zinc tolerance of rice seedlings and the zinc content of mature grains is a difficult problem to solve simultaneously.

[0007] In the regulation of plant ion homeostasis, the CBL-CIPK signaling pathway plays a core role in the phosphorylation modification of downstream target proteins. The CIPK family in rice contains 33 members (CIPK1-CIPK33). Currently, there is no literature report on the function and application of OsCIPK9 gene in regulating zinc stress response and grain zinc accumulation. SUMMARY

[0008] The technical problem to be solved by the present application is to provide a method that can improve both the zinc tolerance of rice seedlings and the zinc content of mature grains.

[0009] The technical solution of the present application is: the application of rice protein kinase gene OsCIPK9 in improving the zinc toxicity tolerance of seedlings and the zinc content of mature grains, characterized in that the rice protein kinase gene OsCIPK9 is knocked out in rice to express, thereby improving the zinc toxicity tolerance of seedlings and the zinc content of mature grains. The rice protein kinase gene OsCIPK9 is a gene encoding the amino acid sequence shown in SEQ ID No. 1.

[0010] Further, the method for knocking out the rice protein kinase gene OsCIPK9 is to target knockout the rice protein kinase gene OsCIPK9 by a CRISPR / Cas9 gene editing vector.

[0011] Further, the target sequence of sgRNA in the CRISPR / Cas9 gene editing vector is shown in SEQ ID No. 2.

[0012] A method for breeding rice with high zinc tolerance in seedlings and zinc-rich grains constructs a CRISPR / Cas9 gene editing vector targeting knockout of the rice protein kinase gene OsCIPK9, infects rice callus with Agrobacterium, and obtains OsCIPK9 gene knockout rice mutants through tissue culture, thereby obtaining rice with high zinc tolerance in seedlings and zinc-rich grains. The CDS sequence of the rice protein kinase gene OsCIPK9 is shown in SEQ ID No. 3.

[0013] Further, the target sequence of sgRNA in the CRISPR / Cas9 gene editing vector is shown as SEQ ID No. 2.

[0014] The application constructs knockout and overexpression plants of OsCIPK9 gene, compares the main root length of wild type, knockout mutant and overexpression plants under normal zinc (0.4 μM ZnSO4) and zinc toxicity (40 μM ZnSO4) conditions in seedling stage, and analyzes the zinc toxicity tolerance. It is shown that after knocking out the rice protein kinase gene OsCIPK9, the zinc toxicity tolerance of rice seedlings is significantly enhanced, and after overexpressing the rice protein kinase gene OsCIPK9, the zinc toxicity tolerance of rice seedlings is significantly reduced. In addition, by culturing wild type and knockout mutants in normal fields, harvesting mature grains, and determining and counting the zinc concentration in brown rice, it is shown that after knocking out the rice protein kinase gene OsCIPK9, the zinc concentration in rice grains is significantly improved.

[0015] Alternative one: using other gene editing technologies to knock down gene expression

[0016] In addition to CRISPR / Cas9, other gene editing tools such as TALEN or ZFNs can be used to knock out or disrupt the coding region or promoter region of OsCIPK9 gene, so as to achieve gene function loss. Compared with CRISPR / Cas9, these technologies have more complex design, but they are also effective means to achieve gene knockout.

[0017] Specific implementation: similar to Example 1 of the application, a loss-of-function mutant is created by editing technology, so as to obtain a plant with enhanced zinc tolerance and increased grain zinc content.

[0018] Alternative two: using RNA interference technology to specifically silence gene expression

[0019] An OsCIPK9-specific RNAi (RNA interference) expression vector is constructed. By designing double-stranded RNA (dsRNA) or artificial miRNA (amiRNA) targeting the CDS or UTR region of OsCIPK9 gene, the mRNA is specifically degraded or the translation is inhibited at the post-transcriptional level, so as to effectively reduce the expression level of OsCIPK9 protein.

[0020] Specific implementation: the RNAi expression vector is transformed into rice, and the obtained transgenic plants have inhibited (but not completely knocked out) expression of OsCIPK9 gene. The expected phenotype is similar to that of the knockout mutant: enhanced zinc tolerance in seedling stage, and increased zinc content in mature grains. This is a "knockdown" rather than "knockout" strategy.

[0021] Alternative three: using antisense RNA or nuclease technology to inhibit gene expression

[0022] Construct a vector expressing antisense RNA, whose transcript can bind to the mRNA of OsCIPK9 complementarily, form double-stranded RNA and be degraded by cellular mechanism, thus blocking translation. Alternatively, ribozyme technology can be used to design a ribozyme that can specifically cleave OsCIPK9 mRNA.

[0023] Specific implementation: Similar to RNAi technology, the purpose of the present application is achieved by down-regulating the expression of the target gene at the post-transcriptional level to achieve functional inhibition.

[0024] Alternative four: screening or creating natural or induced loss-of-function allelic variations of OsCIPK9 gene

[0025] Natural variation screening: By re-sequencing large-scale rice germplasm resources (such as local varieties, cultivated species), natural loss-of-function mutants of OsCIPK9 gene coding region or regulatory region (such as premature stop codon, key amino acid mutation, promoter activity reduction variation, etc.) are screened.

[0026] Physical / chemical mutagenesis: Use EMS (ethyl methanesulfonate) or radiation to treat rice to create a mutant library, and then use TILLING (Targeting Induced Local Lesions IN Genomes) technology to high-throughput screen the loss-of-function mutants of OsCIPK9 gene from the mutant library.

[0027] Specific implementation: Directly obtain plants with the same genetic basis as the gene editing mutants in Example 1, without going through the transgenic process, which may have more regulatory advantages in breeding applications.

[0028] Alternative five: application of small molecule inhibitors targeting OsCIPK9

[0029] On the basis of clarifying the three-dimensional structure and active center of OsCIPK9 protein kinase, small molecule compounds that can specifically inhibit the kinase activity of OsCIPK9 are developed through computer-aided drug design or high-throughput screening.

[0030] Specific implementation: When rice seedlings face zinc toxicity stress, or during the key period of zinc accumulation in grains, the small molecule inhibitor can be applied by foliar spraying or root irrigation. Chemical inhibition of protein activity can mimic loss-of-function phenotypes, thereby temporarily enhancing the zinc tolerance of plants or promoting the transport of zinc to grains. This is a non-genetic transformation and controllable chemical regulation scheme.

[0031] Compared with the prior art, the application has the following beneficial effects:

[0032] 1、 The application clarifies the key role of the rice protein kinase gene OsCIPK9 in regulating zinc toxicity tolerance and grain zinc accumulation by knocking out and overexpressing the gene.

[0033] 2、 After knocking out the OsCIPK9 gene, the relative main root length of the mutant plant under zinc toxicity conditions is significantly higher than that of the wild type, indicating that the zinc toxicity tolerance is significantly enhanced.

[0034] 3、 Under field planting conditions, the zinc concentration in the brown rice produced by the knockout mutant plant is significantly higher than that of the wild type, providing a new way for cultivating zinc nutrition enhanced rice varieties.

[0035] 4、 The double regulation of the function of OsCIPK9 is clarified, and the experiment proves that the gene not only negatively regulates zinc stress response (tolerance increases after knockout and decreases after overexpression), but also negatively regulates the transport and accumulation of zinc elements to grains, providing an important theoretical basis for understanding zinc homeostasis mechanism.

[0036] 5、 Provide a new target for genetic improvement: OsCIPK9 gene can be used as a key target to simultaneously improve crop zinc toxicity resistance and grain nutritional quality through gene editing or molecular breeding methods, which has important application potential. BRIEF DESCRIPTION OF DRAWINGS

[0037] Figure 1 For identification of mutant sites of OsCIPK9 gene knockout plants and overexpression lines; wherein:

[0038] A: Base mutation of OsCIPK9 gene sequence at the target site in knockout mutant OsCIPK9;

[0039] B: Comparison of transcription levels of OsCIPK9 gene in wild type and OsCIPK9 overexpression plants;

[0040] C: Comparison of protein levels of OsCIPK9 gene in wild type and OsCIPK9 overexpression plants.

[0041] Figure 2 For the phenotype of wild type and knockout mutant OsCIPK9 under normal and zinc toxicity conditions in seedling stage; wherein:

[0042] A: Growth status of wild type and knockout mutant OsCIPK9 under normal zinc and zinc toxicity;

[0043] B: Comparison of main root length of wild type and knockout mutant OsCIPK9 under normal zinc;

[0044] C: Comparison of the main root length of wild type and knockout mutant OsCIPK9 under zinc toxicity.

[0045] Figure 3 To compare the phenotype of wild type and overexpression OsCIPK9 plants under normal and zinc toxicity conditions at seedling stage; wherein:

[0046] A: Comparison of the growth status of wild type and overexpression OsCIPK9 plants under normal zinc and zinc toxicity.

[0047] B: Comparison of the main root length of wild type and overexpression OsCIPK9 plants under normal zinc.

[0048] C: Comparison of the main root length of wild type and overexpression OsCIPK9 plants under zinc toxicity.

[0049] Figure 4 To compare the zinc concentration in mature period brown rice of wild type and knockout mutant OsCIPK9. DETAILED DESCRIPTION

[0050] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials used in the following examples are all purchased from commercial channels unless otherwise specified.

[0051] Example 1: Construction and obtaining of rice protein kinase gene OsCIPK9 knockout mutant

[0052] The specific implementation process is as follows:

[0053] (1) Construction of knockout vector

[0054] First, the OsbZIP50 specific target site was designed using the website CRISPR-P 2.0, and a 20 bp gRNA sequence (5'-TACGAGCTCGGCAAGACGAT CGG -3', SEQ ID No. 2) was obtained. The obtained forward and reverse sequences were subjected to primer specificity alignment, and the primers were synthesized:

[0055] OsCIPK9-CRISPR-F: CAGTACGAGCTCGGCAAGACGAT,

[0056] OsCIPK9-CRISPR-R: AACATCGTCTTGCCGAGCTCGTA;

[0057] The oligo dimer was formed, and the reaction system was configured: OsCIPK9-CRISPR-F 5 µL, OsCIPK9-CRISPR-R 5 µL, ddH2O 15 µL, the reaction system was mixed, the sample was placed in 100°C water, and naturally cooled to room temperature.

[0058] Linearization of the VK005-101 vector (Uniscience), configuration of the reaction system: BspQI 1 µL, NEBuffer r3.11 µL, VK005-01 3 µL, ddH2O 5 µL, mixing of the reaction system, 50°C, enzyme digestion for 1h; agarose gel electrophoresis, and recovery with a gel recovery kit.

[0059] Connection of the oligo dimer and the linearized vector, configuration of the reaction system: linearized vector 2 µL, oligo dimer 6 µL, T4 DNA Ligase 1 µL, T4 DNA Ligase Buffer 1 µL, mixing of the reaction system, 16°C, ligation for 1h. And transformation into competent E. coli DH5α, sequencing analysis of positive clones, and obtaining of the correct knockout plasmid.

[0060] (2) Obtaining of transgenic plants

[0061] The overexpression plasmid in step (1) was transformed into Agrobacterium EHA105, infected into prepared rice callus, and co-cultured. After washing, selection culture, differentiation, rooting, and seedling strengthening, T0 generation transgenic plants were obtained; whether the coding region of the OsCIPK9 gene was mutated was identified by sequencing, a homozygous mutant single plant was selected, expanded, and T1 and T2 generation seeds were harvested.

[0062] The primers were identified as:

[0063] OsCIPK9-JD-F: GTGGTGGGATTGGGATAGAG

[0064] OsCIPK9-JD-R: TAAGACAGGGTTGGCATCAC

[0065] It was detected that one base T insertion OsCIPK9 gene knockout mutant OsCIPK9 was obtained in the embodiment.

[0066] Example 2: Construction and obtaining of rice protein kinase gene OsCIPK9 overexpression plants

[0067] The specific implementation process is as follows:

[0068] (1) Construction of overexpression vector

[0069] The overexpression vector primers are designed according to the CDS sequence of OsCIPK9 gene (as shown in SEQ ID NO. 3):

[0070] OsCIPK9-OE-F: GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGGCGGAGGCGGAGGCGGA

[0071] OsCIPK9-OE-R: GGGGACCACTTTGTACAAGAAAGCTGGGTCTCACCTCTTCTTTGCTGC

[0072] The gene fragment of OsCIPK9 is amplified from Nipponbare, and is connected with the fragment of the overexpression vector with Ubi promoter to obtain the overexpression vector Ubi-OsCIPK9. The positive clones identified by colony PCR are sequenced to obtain the correct overexpression plasmid.

[0073] (2) Obtaining of transgenic plants

[0074] The overexpression plasmid in step (1) is transformed into Agrobacterium EHA105, and is infected into the prepared rice callus for co-culture. After washing, selection culture, differentiation, rooting, and seedling strengthening, the T0 generation transgenic plants are obtained. The expression level is detected by the quantitative primer of OsCIPK9:

[0075] OsCIPK9-qPCR-F: CTTCGCCAAGGTCAAGGTC

[0076] OsCIPK9-qPCR-R: CATCTTGTGGCGAAGCACAT

[0077] The protein level is detected by western blot on two independent plants with high expression level (such as B and C in Figure 1 ), and the stable genetic T2 generation material is obtained by expansion.

[0078] Example 3: Zinc toxicity tolerance test of the knockout mutant OsCIPK9 plant prepared in Example 1

[0079] The specific implementation process is as follows:

[0080] (1) The T2 generation seeds of wild type and knockout mutant OsCIPK9 are soaked for germination, and the seeds with white germination are placed on a 96-well PCR plate and cultured in a small black box containing 0.5 mM CaCl2 solution for 2 days.

[0081] (2) Transferred to the solution containing only 0.4 and 40 μM ZnSO4 to continue to culture;

[0082] (3) After 24 hours of culture, the main root length of each seedling was measured. The relative root length was calculated according to the 40 μM ZnSO4 root length / 0.4 μM ZnSO4 root length.

[0083] The results show that under normal zinc (0.4 μM ZnSO4) and zinc toxicity (40 μM ZnSO4) conditions, the root length of the knockout mutant OsCIPK9 is significantly lower than that of the wild type; but the relative root length of the knockout mutant OsCIPK9 (93%) is higher than that of the wild type (89.5%); this example shows that after knocking out the rice protein kinase gene OsCIPK9, the tolerance of rice seedlings to zinc toxicity is significantly enhanced Figure 2 .

[0084] Example 4: Zinc toxicity tolerance test of the OsCIPK9 overexpression plant prepared in Example 2

[0085] The specific implementation process is as follows:

[0086] (1) Wild type and T2 generation seeds overexpressing OsCIPK were soaked and germinated, and the seeds with white germination were placed on a 96-well PCR plate and cultured in a small black box containing 0.5 mM CaCl2 solution for 2 days.

[0087] (2) Transferred to the solution containing only 0.4 and 40 μM ZnSO4 to continue to culture;

[0088] (3) After 24 hours of culture, the main root length of each seedling was measured. The relative root length was calculated according to the 40 μM ZnSO4 root length / 0.4 μM ZnSO4 root length.

[0089] The results show that under normal zinc (0.4 μM ZnSO4) conditions, the root length of the OsCIPK9 overexpression plant is significantly higher than that of the wild type; and under zinc toxicity (40 μM ZnSO4) conditions, the root length of the OsCIPK9 overexpression plant is significantly lower than that of the wild type; the relative root length of the OsCIPK9 overexpression plant (77.1% and 71.6%) is lower than that of the wild type (91.1%). This example shows that after overexpressing the rice protein kinase gene OsCIPK9, the tolerance of rice seedlings to zinc toxicity is significantly reduced Figure 3 .

[0090] Example 5: Determination of zinc concentration in mature seeds of the knockout mutant OsCIPK9 plant prepared in Example 1,

[0091] The specific implementation process is as follows:

[0092] (1) Wild type and knockout mutant OsCIPK9 T2 generation seeds were soaked and germinated, and the seeds with white germination were placed on 96-well PCR plates and cultured in a small black box for 7 days.

[0093] (2) Then the plants were transferred to 1 / 2 Murashige and Skoog medium containing rice nutrient solution for further culture to two-leaf-one-heart stage. The nutrient solution was replaced every 2 days.

[0094] (3) The seedlings with consistent growth were transplanted into normal fields, 30 plants per strain (3 rows, 10 plants per row), with a plant spacing of 18 cm and a row spacing of 20 cm, and a total of 3 biological replicates. Water, fertilizer and pest management during the entire rice growth period were the same as in the normal field.

[0095] (4) The seeds of wild type and knockout mutant OsCIPK9 plants were harvested at the mature stage, and after shelling, the zinc concentration in brown rice was detected by ICP-MS.

[0096] The results showed that the zinc concentration in brown rice of knockout mutant OsCIPK9 plants was significantly higher than that of wild type, and this example showed that after knocking out the rice protein kinase gene OsCIPK9, the zinc concentration in rice grains was significantly improved. Figure 4 ).

Claims

1. Application of rice protein kinase gene OsCIPK9 in improving seedling stage zinc toxicity tolerance and mature stage grain zinc content, characterized in that, The knockout of the rice protein kinase gene OsCIPK9 in rice can improve the zinc toxicity tolerance at the seedling stage and the zinc content in the grain at the mature stage, and the rice protein kinase gene OsCIPK9 is a gene encoding the protein of the amino acid sequence shown in SEQ ID No.

1.

2. Use according to claim 1, characterized in that, The method for knocking out the rice protein kinase gene OsCIPK9 is targeted knockout of the rice protein kinase gene OsCIPK9 by a CRISPR / Cas9 gene editing vector.

3. Use according to claim 2, characterized in that, The target sequence of sgRNA in the CRISPR / Cas9 gene editing vector is shown in SEQ ID No.

2.

4. A method for breeding a rice plant having high tolerance to zinc at the seedling stage and having a zinc-rich grain, the method being characterized by, A CRISPR / Cas9 gene editing vector for targeted knockout of the rice protein kinase gene OsCIPK9 is constructed, and an OsCIPK9 gene knockout rice mutant is obtained by agrobacterium infection of rice callus and tissue culture, thereby obtaining a rice with high zinc tolerance at the seedling stage and zinc-rich grain; the CDS sequence of the rice protein kinase gene OsCIPK9 is shown in SEQ ID No.

3.

5. The breeding method according to claim 4, characterized by, The target sequence of sgRNA in the CRISPR / Cas9 gene editing vector is shown in SEQ ID No.

2. The knockout of the rice protein kinase gene OsCIPK9 in rice can improve the zinc toxicity tolerance at the seedling stage and the zinc content in the grain at the mature stage, and the rice protein kinase gene OsCIPK9 is a gene encoding the protein of the amino acid sequence shown in SEQ ID No.

1. The method for knocking out the rice protein kinase gene OsCIPK9 is targeted knockout of the rice protein kinase gene OsCIPK9 by a CRISPR / Cas9 gene editing vector. The target sequence of sgRNA in the CRISPR / Cas9 gene editing vector is shown in SEQ ID No.

2. A CRISPR / Cas9 gene editing vector for targeted knockout of the rice protein kinase gene OsCIPK9 is constructed, and an OsCIPK9 gene knockout rice mutant is obtained by agrobacterium infection of rice callus and tissue culture, thereby obtaining a rice with high zinc tolerance at the seedling stage and zinc-rich grain; the CDS sequence of the rice protein kinase gene OsCIPK9 is shown in SEQ ID No.

3. The target sequence of sgRNA in the CRISPR / Cas9 gene editing vector is shown in SEQ ID No. 2.

Images