Application of CsNOMT gene and sakuranetin in prevention and treatment of tea tree anthracnose
By synthesizing cherry blossom extract using the CsNOMT gene in tea trees, the problem of insignificant control effects against anthracnose in tea trees has been solved, achieving efficient and safe control of anthracnose in tea trees, which meets the needs of green production and high-quality sustainable agriculture.
Patent Information
- Application Number
- CN202511612585.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-06
- Publication Date
- 2025-12-05
- Estimated Expiration
- 2045-11-06
AI Technical Summary
Existing technologies for controlling anthracnose in tea trees have problems such as insignificant control effects and environmental unfriendliness. In particular, tea tree essential oils are easily deactivated, alkaloids affect the quality of tea, and there is a lack of highly effective and safe plant-derived antibacterial agents.
By mining the CsNOMT gene in tea trees, cherry blossom extract was synthesized. CsNOMT was used to catalyze the synthesis of cherry blossom extract from naringenin, thereby increasing the content of endogenous phytoprotective agents in tea trees. Cherry blossom extract was then applied exogenously to enhance the tea trees' resistance to anthracnose.
It effectively prevents and controls anthracnose in tea trees, meets the requirements of green production and high-quality sustainable agriculture, and enhances the disease resistance of tea trees.
Smart Images

Figure CN121065255A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant protection technology, specifically involving CsNOMT Genes and cherry blossom extract in the prevention and control of anthracnose in tea trees Colletotrichum camelliae Applications in ). Background Technology
[0002] tea tree( Camellia sinensis Tea (L.) O. Kuntze is one of the most important economic crops widely cultivated worldwide. As a perennial woody plant, tea trees are susceptible to various fungal diseases during their growth and development. Among the many fungal diseases affecting tea trees, Bacillus anthracis is particularly harmful to the leaves, significantly impacting the quality and yield of tea.
[0003] Anthracnose bacteria exhibit latent infection characteristics, typically overwintering in tea plants as mycelium or conidiophores. In tea gardens severely affected by anthracnose in autumn, the diseased parts of the tea plants release large quantities of conidia the following year, which spread via rain, wind, or human activity, resulting in a 20%-40% reduction in spring tea yield. This causes significant economic losses to the tea industry and related health product sectors. Currently, the primary method for controlling anthracnose in production is direct spraying of pesticides, but the effects are not significant. Furthermore, with increasing public concern about food safety, the issue of pesticide residues in tea urgently needs to be addressed.
[0004] As a crucial defense mechanism for sessile plants against environmental stress, the synthesis of secondary metabolites plays a key role in disease resistance. Tea trees are rich in various secondary metabolites, and in existing research on the application of plant-derived antibacterial agents to control tea tree diseases (such as anthracnose), natural compounds such as tea tree oil, flavonoids, and alkaloids have been extensively explored. These agents have attracted attention due to their good environmental compatibility and low residues, but their control efficacy against anthracnose is often limited by problems such as low stability, short duration of action, or excessive application. For example, commercial tea tree oil is prone to photodegradation in field applications, while alkaloid preparations may adversely affect tea quality. Phytoalexins are a class of small-molecule antibacterial and antiviral secondary metabolites that rapidly accumulate in plants after infection by pathogens. However, the role of phytoalexins in tea tree resistance to anthracnose remains unclear. Colletotrichum camelliae The function of these mechanisms in the infection process is still poorly reported. Therefore, there is an urgent need to develop efficient, safe, and novel plant-based biological control strategies, especially induction strategies that can stimulate the tea plant's own immune response (such as phytoalexin synthesis). Summary of the Invention
[0005] The technical problem to be solved by this invention is at least to discover highly efficient plant-derived antibacterial agents to improve the resistance of tea trees to anthracnose fungi, and to provide the application of the CsNOMT gene and safflower extract in the prevention and control of anthracnose in tea trees. This mainly consists of two aspects: 1) Discovering the key enzymes in the safflower extract synthesis pathway in tea trees.CsNOMT Methyltransferase function of the gene; 2) the sakuranetin improves the resistance of tea tree to anthracnose.
[0006] In order to achieve the above-mentioned purposes, the present application provides the following technical solutions. In a first aspect, the present application provides CsNOMT The application of the key enzyme in the synthesis pathway of sakuranetin in preventing and treating anthracnose of tea tree.
[0007] Preferably, the nucleotide sequence of the protein is shown as SEQ ID No. 1. CsNOMT Preferably, the amino acid sequence of the protein is shown as SEQ ID No. 2.
[0008] CsNOMT Preferably, the protein is isolated from tea tree according to the whole genome sequence of tea tree.
[0009] Preferably, the protein is isolated from tea tree according to the whole genome sequence of tea tree. CsNOMT Preferably, the nucleotide sequence of the protein is shown as SEQ ID No. 1.
[0010] Preferably, the amino acid sequence of the protein is shown as SEQ ID No. 2. CsNOMT Preferably, the nucleotide sequence of the protein is shown as SEQ ID No. 1.
[0011] Preferably, the protein expression effect is best when the concentration of the inducer IPTG is 0.5 mM, and the target protein is purified. CsNOMT
[0012] Preferably, the application is to catalyze naringenin to synthesize sakuranetin, thereby increasing the content of endogenous plant sakuranetin in tea tree, and thereby improving the resistance of tea tree to anthracnose. CsNOMT Preferably, the application is to catalyze naringenin to synthesize sakuranetin, thereby increasing the content of endogenous plant sakuranetin in tea tree, and thereby improving the resistance of tea tree to anthracnose.
[0013] Preferably, the in vitro enzyme activity reaction for catalyzing naringenin to synthesize sakuranetin is to incubate the recombinant protein in a reaction system, react for 2 hours at 30 DEG C, and verify the product sakuranetin by LC-MS / MS. CsNOMT Preferably, the in vitro enzyme activity reaction for catalyzing naringenin to synthesize sakuranetin is to incubate the recombinant protein in a reaction system, react for 2 hours at 30 DEG C, and verify the product sakuranetin by LC-MS / MS.
[0014] In a second aspect, the present application provides a tea tree anthracnose-resistant product comprising sakuranetin.
[0015] Preferably, the concentration of the sakuranetin used alone is 0.05-0.3 mM, preferably 0.1-0.3 mM.
[0016] In a third aspect, the present application provides a method for improving the resistance of tea plant to anthracnose, specifically by spraying exogenous prunin on the leaves of tea plant, and the spraying capacity is to wet the whole leaf, that is, the leaf starts to drip water.
[0017] Advantages of the present application: The present application first locates and verifies the gene in tea plant, CsNOMT which encodes an enzyme with methyltransferase function, successfully analyzes the key step of prunin biosynthesis pathway, and confirms that CsNOMT is the key enzyme for catalyzing the conversion of naringenin to prunin. In addition, the study also proves that the gene plays an important role in the resistance of tea plant to anthracnose, fills the blank of the biosynthesis mechanism of flavonoid phytoalexin and its application in the molecular level of anthracnose resistance in tea plant; at the same time, the tea plant bacteriostatic agent prepared on the basis of prunin can effectively prevent and control the anthracnose of tea plant. Compared with the existing antibacterial agent products, the flavonoid compound bacteriostatic agent used in the present application is specially used for the disease prevention and control of tea plant, not only supports the efficient disease-resistant variety breeding based on green production, but also meets the development requirements of ecological health and high-quality sustainable agriculture. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 is CsNOMT catalyzing the synthesis of prunin from naringenin; wherein A, naringenin 7-O-methyltransferase (NOMT) catalyzes the conversion of naringenin to prunin; B, product identification of in vitro prunin synthase CsNOMT1 and CsNOMT2 using naringenin as substrate.
[0019] Figure 2 is CsNOMT kinetic parameters of Michaelis equation curve; Error bars = ± SD (n = 3).
[0020] Figure 3 is the effect of prunin on the growth of anthracnose; wherein A, the inhibitory effect of prunin and EGCG on anthracnose plaque; B, the effect of prunin and EGCG on the growth of anthracnose.
[0021] Figure 4 is the phenotype and pathogen content of tea plant inoculated with anthracnose after prunin treatment, wherein A, the phenotype of tea plant leaf sprayed with prunin and inoculated with anthracnose; B, the relative expression level of anthracnose mRNA after prunin is sprayed on the leaves of tea plant.
[0022] Figure 5 is the function of tea plant CsNOMT gene, wherein A, the expression of sCsNOMT gene and the content of prunin after antisense oligonucleotide treatment AsCsNOMT ; B, the expression of CsNOMT gene and the content of prunin after transient overexpression of tea plant CsNOMTGene expression and anthocyanin content; C, CsNOMT Phenotypic changes in tea leaves after silencing followed by inoculation with C. acutatum; D, CsNOMT Phenotypic changes in tea leaves after overexpression followed by inoculation with C. acutatum; E, CsNOMT Relative expression levels of C. acutatum mRNA in tea leaves after silencing followed by inoculation with C. acutatum; F, CsNOMT Relative expression levels of C. acutatum mRNA in tea leaves after transient overexpression of the gene followed by inoculation with C. acutatum. DETAILED DESCRIPTION
[0023] The present application is further described in the detailed description that follows, by reference to the examples, which should be understood as merely exemplary and not limiting of the present application, as described and claimed. Any improvement, modification, and / or equivalent substitution for any of the components of the present application are intended to be included in the scope of the present application.
[0024] Example 1: Tea plant CsNOMT Gene identification and enzyme activity analysis Construction of prokaryotic expression vector and protein purification: The full gene amplification primers were designed using the NCBI primer design tool, with the CDS sequence of Longjing43 as reference, and specific primers were designed. The tea plant leaf cDNA was used as a template, and the Biorun Pfu PCR Mix high-fidelity enzyme PCR amplification CsNOMT fragment.
[0025] The specific primer sequence is: CsNOMT-F : GTGGTATCGAAGGTAGGCATATGATGGTCTCCAAAGAAAGCCA, as shown in SEQ ID NO: 3.
[0026] CsNOMT-R : ACAAGCTTGAATTCGGATCCTATTTGTAAAGTTCCATGA, as shown in SEQ ID NO: 4.
[0027] CsNOMT The nucleotide sequence of the gene is shown in SEQ ID NO: 1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2.
[0028] The CsNOMT The full-length sequence was cloned into the pCold-His tag vector, and E. coli BL21 (DE3) was transformed E. coliBL21). When the OD600=0.6-0.8, 0.5mM inducer IPTG (i.e. isopropyl-β-D-thiogalactopyranoside) was added to induce expression at 16℃, and the crude enzyme solution was obtained.
[0029] Enzyme activity assay: The in vitro enzyme activity reaction system contained 50 μL crude enzyme solution, 10 μL 10 mM naringenin (dissolved in dimethyl sulfoxide DMSO), 50 μL 4 mM S-adenosyl methionine (SAM), and 50 μL 400 mM glycine-NaOH buffer (pH 9.5, containing 4 mM ethylenediaminetetraacetic acid EDTA and 200 mM dithiothreitol DTT).
[0030] After 2 hours of reaction at 30℃, 50 μL hydrochloric acid (1 M) was added to terminate the reaction, and the amount of prunusin produced was quantified by LC-MS / MS. The Michaelis constant (Km) was determined with different concentrations of naringenin (0.1-20 mM).
[0031] Standard preparation: 10 mg prunusin standard was dissolved in 1 ml prunusin extraction solution (consisting of ethanol: water: acetonitrile: acetic acid = 79:13.99:7:0.01 by mass ratio) to prepare a 10 mg / ml stock solution. Gradient dilution was performed to prepare 100 ng / mL, 25 ng / mL, 6.25 ng / mL, 1.56 ng / mL, 0.39 ng / mL, 0.09 ng / mL gradients for making a calibration curve to calculate the prunusin concentration of the sample.
[0032] 4. Chromatography-mass spectrometry acquisition conditions: The SCIEX ultra-high performance liquid triple quadrupole tandem mass spectrometer Triple Quad™ LC-MS / MS 5500+ system was used for acquisition, including ultra-high performance liquid chromatography (Ultra Performance Liquid Chromatography UPLC, ExionLC™ AD) and triple quadrupole tandem mass spectrometry (Triple Quad™ LC-MS / MS 5500+).
[0033] Chromatographic column: ZORBAX Eclipse Plus C18 column (1.8 μm, 3.0 mm*100 mm; mobile phase A: ultrapure water (add 0.01% formic acid, 2mM ammonium formate); mobile phase B: methanol (add 0.01% formic acid, 2mM ammonium formate). Flow rate 0.4 mL / min, column temperature 40℃, injection volume 1 μL. A 15 min gradient elution method was used, and the elution gradient settings are shown in the table below: Table 1: Liquid elution gradient Mass spectrometry conditions: Data were collected using software Analyst 1.7.1, ion source was electrospray ionization (ESI); detection mode was multiple reaction monitoring (MRM); ion spray voltage (IS) was -4500 V in negative ion mode; temperature (TEM) was 500℃; ion source gas 1 (Gas1) pressure was 50 psi; ion source gas 2 (Gas2) pressure was 55 psi; curtain gas (CUR) pressure was 35 psi. Collision gas (CAD) was 8. According to the optimized declustering potential (DP) and collision energy (CE), the ion pairs were scanned and detected.
[0034] As Figure 1 A- Figure 1 B、 Figure 2 , CsNOMT Catalyzing the conversion of naringenin to sakuranetin, the enzyme activity analysis showed that its Michaelis constant Km for naringenin was 4.31 mM, and the binding efficiency Kcat was (61.41 ± 3.05) x 10 −3 s −1 , indicating that it has strong substrate affinity and high catalytic efficiency.
[0035] Example 2: Inhibition of Colletotrichum gloeosporioides by sakuranetin 1. Colletotrichum gloeosporioides culture: Take the diameter of 0.5 cm of Colletotrichum gloeosporioides block added to the potato solid nutrient medium (i.e., PDA medium) for culture, and the mycelial growth is 6 days.
[0036] 2. Preparation of culture medium: Prepare PDA solid culture medium with different concentrations (0, 0.05, 0.1, 0.3 mM) of epigallocatechin gallate (EGCG) and sakuranetin (SAK).
[0037] 3. Indoor antibacterial culture: Take the diameter of 0.5 cm of Colletotrichum gloeosporioides block after culture in step 1 and add it to the PDA solid culture medium with different concentrations of EGCG and SAK prepared in step 2 for culture.
[0038] 4. Diameter statistics: After the growth of Colletotrichum gloeosporioides block for 6 days in step 3, the diameter change of Colletotrichum gloeosporioides strain growth was counted respectively.
[0039] AsFigure 3 Medium A Figure 3 Medium B, it was found by indoor antibacterial experiment that low concentration of EGCG (0.05 to 0.3 mM) had no significant effect on the growth of anthracnose, while the concentration of 0.05 mM / mL of sakuranetin significantly inhibited the growth of anthracnose.
[0040] Example 3: Sakuranetin improves the resistance of tea tree to anthracnose 1. Tea tree cultivation: 2-year-old tea trees with consistent growth were selected, and tea trees Longjing 43 were planted in a culture box at 25°C with light for 14 h / dark for 10 h.
[0041] 2. Anthracnose fungus culture: Take the anthracnose fungus block and transfer it to the PDB liquid medium to shake the fungus for 48 h, centrifuge to collect the spore suspension, and use a hemocytometer to calibrate the anthracnose spore concentration (10 7 spores / mL).
[0042] 3. Preparation of sakuranetin working solution: Sakuranetin was first dissolved in anhydrous ethanol to prepare a stock solution (100 mM), and then 0.1% Triton X-100 was used to prepare the working solution, and different concentrations of sakuranetin were prepared. At the same time, 0.1% Triton X-100 was added to an equal volume of anhydrous ethanol as a control group (CK).
[0043] 4. Spraying sakuranetin on tea tree leaves: Tea trees Longjing 43 with consistent growth were sprayed with different concentrations (0.05, 0.1 and 0.3 mM) of sakuranetin and 0.1% Triton X-100 (CK) using a spray bottle to evenly wet the leaves, and the treatment was done once.
[0044] 5. Inoculation of anthracnose fungus: The third leaf of the new shoot of the tea tree treated with sakuranetin without disease and injury was used for inoculation experiment, and the concentration of 10 7 spores / mL of anthracnose fungus spore suspension was used to inoculate the tea tree leaves, and the control group was inoculated with sterile water. After 3-5 days, the infection leaf spot phenotype was recorded using an ultra-depth microscope.
[0045] 6. Determination of the content of anthracnose fungus in tea tree leaves: CTAB method was used to extract the DNA of tea tree leaves inoculated with anthracnose fungus in step 5, and DNA-qPCR method was used to calculate the content of anthracnose fungus in tea tree leaves (tea tree genomic DNA GAPDH as internal reference). The primers used for the above quantitative detection of the relative fungal content of the leaves are as follows: CcActin CcActin-q-F : ATGTGCAAGGCCGGTTTCGC, as shown in SEQ ID NO: 5 CcActin-q-R : TACGAGTCCTTCTGGCCCAT, as set forth in SEQ ID NO: 6 CsGAPDH-q-F : TTGGCATCGTTGAGGGTCT, as set forth in SEQ ID NO: 7 CsGAPDH-q-R : CAGTGGGAACACGGAAAGC, as set forth in SEQ ID NO: 8 As Figure 4 A- Figure 4 B, the prevention and treatment effect of prunusin on tea anthracnose was identified by spraying different concentrations of prunusin (0, 0.05, 0.1, 0.3 mM) on the tea leaves. Each treatment included 10 leaves. It was found through statistics that, compared with the control, the use of different concentrations (0.05, 0.1 and 0.3 mM) of prunusin significantly reduced the lesion area of anthracnose, and there was no significant difference in the incidence of anthracnose between the use of 0.1 mM prunusin and the use of 0.3 mM prunusin. Combined with the results of the effect of prunusin on the growth of anthracnose, the optimal concentration range of prunusin for the prevention and treatment of anthracnose was determined to be 0.1-0.3 mM.
[0046] Example 4: Role of CsNOMT in the resistance of tea anthracnose 1. Transient transformation overexpression CsNOMT Construction of tea leaves and detection of prunusin content CsNOMT was constructed into the pCAMBIA1302 vector and injected into the petiole of tea leaves by Agrobacterium. Each experiment included 6 replicates. Samples were collected 1-3 days after injection. The expression of the gene was analyzed by RT-qPCR, and the prunusin content was detected.
[0047] 2. Transient silencing of tea leaves constructed by antisense oligonucleotide technology and detection of prunusin content Antisense oligonucleotide primers were designed by the website of Software for Statistical Folding of Nucleic Acids and Studies of Regulatory RNAs (https: / / sfold.wadsworth.org / cgi-bin / index.pl) and the specificity of the primers was detected by the tea genome database (http: / / tpia.teaplant.org). The antisense oligonucleotide and the sense oligonucleotide control were injected into the tea leaves at a concentration of 20 µM. Each experiment included 6 replicates, and each sample included one bud and two leaves. Samples were collected 1-3 days after injection. The expression of the gene was analyzed by RT-qPCR, and the prunusin content was detected. CsNOMT
[0048] The sequence is as follows: Antisense oligonucleotide strand AsCsNOMT: AAAGGTGGCTCGGTGGAAGGCAAGAGGGAC, as shown in SEQ ID NO: 9 Antisense oligonucleotide strand SCsNOMT : GTCCCTCTTGCCTTCCACCGAGCCACCTTT, as shown in SEQ ID NO: 10 CsNOMT-q-F : TGCTCTGCTCATACACTT, as shown in SEQ ID NO: 11 CsNOMT-q-R : ACTTTCTTAAACTGGTTCCC, as shown in SEQ ID NO: 12 3. Refer to Example 3 for anthracnose culture, inoculation of tea leaves with anthracnose and determination of anthracnose content in tea leaves.
[0049] As Figure 5 A- Figure 5 F, gene silencing was performed by antisense oligonucleotide technology. Compared with the control (injection of sense oligonucleotide into tea leaves), the transiently silenced tea leaves CsNOMT ( AsCsNOMT ) had a significantly reduced transcription level, and the prunasin content was reduced by 30-40%. After inoculation with anthracnose, the lesion area was significantly increased. The transiently transformed tea leaves CsNOMT ( 35S:CsNOMT ) had a significantly increased expression level, and the prunasin content was increased by about 30% compared with the control (i.e. injection of empty vector: Empty Vector, EV for short). After inoculation with anthracnose, the lesion area of the overexpressed leaves was smaller. The above results show that CsNOMT-mediated prunasin production improves the resistance of tea to anthracnose. CsNOMT CsNOMT
[0050] The above examples are not a limitation of the present application, and the present application is not limited to the above examples. As long as it meets the requirements of the present application, it belongs to the protection scope of the present application.
Claims
1. CsNOMT Application of key enzyme in synthesis of sakuranetin in prevention and cure of tea tree anthracnose.
2. Use according to claim 1, characterized in that, The CsNOMT The nucleotide sequence is shown in SEQ ID No.
1.
3. Use according to claim 1, characterized in that, The protein amino acid sequence of the coding CsNOMT is shown in SEQ ID No.
2.
4. The use according to claim 1, characterized in that, The CsNOMT was isolated from tea plant according to the whole genome sequence of tea plant.
5. The use according to claim 1, characterized in that, According to CsNOMT the nucleotide sequence design primer, construct prokaryotic expression vector, and then transform E. coli for recombinant protein expression.
6. The use according to claim 1, characterized in that, The application is to catalyze naringenin to synthesize prunol by CsNOMT, to improve the content of endogenous plant prunol in tea tree, and to further improve the ability of tea tree to resist anthracnose.
7. Use according to claim 6, characterized in that, The in vitro enzyme activity reaction of the CsNOMT catalyzing naringenin to synthesize prunol is to incubate the recombinant protein in a reaction system for 2 hours at 30 DEG C; wherein the reaction system contains 10 mM substrate naringenin, 4 mM S-adenosyl methionine, and pH 9.5 buffer.
8. A tea tree product resistant to anthracnose, characterised in that, Prunol.
9. The product of claim 8, wherein, The concentration of the prunol used alone is 0.05-0.3 mM.
10. A method of increasing resistance to anthracnose in a tea plant, the method comprising, The prunol is sprayed on the tea tree leaves.
Citation Information
Patent Citations
Corn naringenin methyltransferase gene ZmNOMT and application thereof in plant broad-spectrum disease resistance
CN114752578A
Application of OsWRKY14 gene in regulation and control of synthesis of sakuranetin in rice
CN116590306A
Application of sakuranetin in prevention and treatment of plant gray mold
CN117981755A
NtCOMT gene and application of NtCOMT gene in improving secretion amount of ferulic acid methyl ester and disease resistance of root system
CN118956916A
Polygonatum cyrtonema PcF3H gene and application thereof in promoting synthesis of flavanone compounds and catalyzing naringenin hydroxylation
CN119331888A
Cited By
Application of sakuranetin in prevention and treatment of stem rot of anoectochilus formosanus and improvement of quality of anoectochilus formosanus
CN121621339A