Application of CsNOMT gene and prunin in the prevention and treatment of tea tree anthracnose
By synthesizing cherry blossom extract using the CsNOMT gene in tea trees, the problem of poor control of anthracnose in tea trees has been solved, achieving high disease resistance and food safety in tea trees, which meets the requirements of green agriculture development.
Patent Information
- Application Number
- CN202511612585.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-06
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2045-11-06
AI Technical Summary
Existing technologies are not very effective in controlling anthracnose in tea trees, and the use of traditional pesticides poses food safety risks. The stability and duration of action of secondary metabolites in tea trees are short, making it difficult to effectively stimulate the tea tree's own immune response.
By mining the CsNOMT gene in tea trees, cherry blossom extract was synthesized. CsNOMT was used to catalyze the synthesis of cherry blossom extract from naringenin, thereby increasing the content of endogenous phytoprotective agents in tea trees. Cherry blossom extract was then applied exogenously to enhance the tea trees' resistance to anthracnose.
It effectively prevents and controls anthracnose in tea trees, enhances the resistance of tea trees, meets the requirements of green production and high-quality sustainable agriculture, and fills the gap in the biosynthesis mechanism of flavonoid phytoprotectants in tea trees.
Smart Images

Figure CN121065255B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant protection technology, specifically involving CsNOMT Genes and cherry blossom extract in the prevention and control of anthracnose in tea trees Colletotrichum camelliae Applications in ). Background Technology
[0002] tea tree( Camellia sinensis Tea (L.) O. Kuntze is one of the most important economic crops widely cultivated worldwide. As a perennial woody plant, tea trees are susceptible to various fungal diseases during their growth and development. Among the many fungal diseases affecting tea trees, Bacillus anthracis is particularly harmful to the leaves, significantly impacting the quality and yield of tea.
[0003] Anthracnose bacteria exhibit latent infection characteristics, typically overwintering in tea plants as mycelium or conidiophores. In tea gardens severely affected by anthracnose in autumn, the diseased parts of the tea plants release large quantities of conidia the following year, which spread via rain, wind, or human activity, resulting in a 20%-40% reduction in spring tea yield. This causes significant economic losses to the tea industry and related health product sectors. Currently, the primary method for controlling anthracnose in production is direct spraying of pesticides, but the effects are not significant. Furthermore, with increasing public concern about food safety, the issue of pesticide residues in tea urgently needs to be addressed.
[0004] As a crucial defense mechanism for sessile plants against environmental stress, the synthesis of secondary metabolites plays a key role in disease resistance. Tea trees are rich in various secondary metabolites, and in existing research on the application of plant-derived antibacterial agents to control tea tree diseases (such as anthracnose), natural compounds such as tea tree oil, flavonoids, and alkaloids have been extensively explored. These agents have attracted attention due to their good environmental compatibility and low residues, but their control efficacy against anthracnose is often limited by problems such as low stability, short duration of action, or excessive application. For example, commercial tea tree oil is prone to photodegradation in field applications, while alkaloid preparations may adversely affect tea quality. Phytoalexins are a class of small-molecule antibacterial and antiviral secondary metabolites that rapidly accumulate in plants after infection by pathogens. However, the role of phytoalexins in tea tree resistance to anthracnose remains unclear. Colletotrichum camelliae The function of these mechanisms in the infection process is still poorly reported. Therefore, there is an urgent need to develop efficient, safe, and novel plant-based biological control strategies, especially induction strategies that can stimulate the tea plant's own immune response (such as phytoalexin synthesis). Summary of the Invention
[0005] The technical problem to be solved by this invention is at least to discover highly efficient plant-derived antibacterial agents to improve the resistance of tea trees to anthracnose fungi, and to provide the application of the CsNOMT gene and safflower extract in the prevention and control of anthracnose in tea trees. This mainly consists of two aspects: 1) Discovering the key enzymes in the safflower extract synthesis pathway in tea trees. CsNOMT 1) The methyltransferase function of the gene; 2) Cherry blossom extract enhances the resistance of tea trees to anthracnose.
[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:
[0007] In a first aspect, the present invention provides CsNOMT Application of a key enzyme in the cherry blossom synthesis pathway in the prevention and control of anthracnose in tea trees.
[0008] Among them, the CsNOMT The nucleotide sequence is shown in SEQ ID No. 1.
[0009] As a preferred option, encoding CsNOMT The amino acid sequence of the protein is shown in SEQ ID No. 2.
[0010] Preferably, the CsNOMT It was isolated from the tea plant based on the whole genome sequence of the tea plant.
[0011] As a preferred option, according to CsNOMT Primers were designed based on the nucleotide sequence, and the prokaryotic expression vector pET-28a-CsNOMT was constructed and transformed into Escherichia coli (E. coli BL21) for recombinant protein expression.
[0012] Preferably, the IPTG induction concentration is 0.5 mM. CsNOMT The protein expression effect is optimal, and the target protein is purified.
[0013] Preferably, the application is through CsNOMT It catalyzes the synthesis of sakuranetin from naringenin, thereby increasing the content of sakuranetin, an endogenous phytoprotectant in tea trees, and thus enhancing the tea trees' resistance to anthracnose.
[0014] More preferably, the CsNOMT The in vitro enzymatic activity reaction catalyzing the synthesis of safflower extract from naringenin involved incubating the recombinant protein in a reaction system at 30°C for 2 hours, followed by LC-MS / MS verification of the safflower extract product. The reaction system contained 10 mM naringenin, 4 mM S-adenosylmethionine, and a pH 9.5 buffer.
[0015] Secondly, the present invention provides a tea tree anti-anthrax product, including cherry blossom extract.
[0016] Preferably, the concentration of the cherry blossom extract when used alone is 0.05-0.3 mM, more preferably 0.1-0.3 mM.
[0017] Thirdly, the present invention provides a method for improving the resistance of tea trees to anthracnose, specifically by exogenously spraying cherry blossom extract onto the leaves of tea trees, wherein the spraying volume is such that the entire leaf is wetted, i.e., until water begins to drip from the leaf.
[0018] The beneficial effects of this invention are:
[0019] This invention is the first to locate and verify in tea trees. CsNOMT The gene encodes an enzyme with methyltransferase function. Research has successfully elucidated key steps in the biosynthetic pathway of safflower extract and confirmed... CsNOMT It is a key enzyme catalyzing the conversion of naringenin to chrysanthin. Furthermore, research has demonstrated that this gene plays a crucial role in tea tree resistance to anthracnose, filling a gap in the molecular understanding of the biosynthetic mechanism of flavonoid phytoalexins in tea trees and their application in anthracnose resistance. Simultaneously, the tea tree antifungal agent prepared based on chrysanthin can effectively control tea tree anthracnose. Compared to existing antifungal products, the flavonoid compound antifungal agent used in this invention is specifically designed for tea tree disease control, not only supporting the breeding of highly efficient disease-resistant varieties based on green production but also aligning with the development requirements of ecological health and high-quality sustainable agriculture. Attached Figure Description
[0020] Figure 1 yes CsNOMT Catalytic synthesis of naringin from naringenin; A) Naringenin 7-O-methyltransferase (NOMT) catalyzes the conversion of naringenin into naringin; B) Identification of the products of naringin synthases CsNOMT1 and CsNOMT2 in vitro using naringenin as a substrate.
[0021] Figure 2 yes CsNOMT Dynamic parameters Michaelis equation curves; Error bars = ±SD (n = 3).
[0022] Figure 3 The study focuses on the effects of sakurain on the growth of Bacillus anthracis; specifically, A) the inhibitory effects of sakurain and EGCG on Bacillus anthracis plaques; and B) the effects of sakurain and EGCG on the growth of Bacillus anthracis.
[0023] Figure 4 The results show the phenotype and pathogen content of anthracnose in tea trees after treatment with sakura extract, including: A) phenotype of tea leaves after spraying with sakura extract and inoculation with anthracnose; and B) relative expression level of anthracnose mRNA in tea leaves after spraying with sakura extract.
[0024] Figure 5 It is a tea tree CsNOMT Gene function, including A, antisense oligonucleotide treatment ( sCsNOMT and AsCsNOMT ) after tea tree CsNOMT Gene expression and cherry blossom extract content; B. Transient overexpression in tea plants CsNOMT Gene expression and cherry blossom extract content; C, CsNOMT Phenotypic changes in tea leaves after inoculation with anthrax bacteria following a period of silence; D. CsNOMT Phenotypic changes in tea leaves after overexpression of Bacillus anthracis; E, CsNOMT The relative expression level of Bacillus anthracis mRNA in tea leaves after silencing and inoculation with Bacillus anthracis; F, CsNOMT The relative expression level of anthrax mRNA in tea leaves after transient gene overexpression and inoculation with anthrax bacteria. Detailed Implementation
[0025] The present invention will be further described below with reference to specific implementation schemes. These embodiments should be understood as merely the best examples of the present invention, and not as limiting the present invention in any way. Any improvements, modifications and equivalent substitutions made within the scope of the inventive principles should be included within the scope of the present invention.
[0026] Example 1: Tea Tree CsNOMT Gene identification and enzyme activity analysis
[0027] Construction of prokaryotic expression vectors and protein purification:
[0028] Primers for whole-genome amplification were designed using the NCBI primer design tool, with the CDS sequence of Longjing 43 as a reference, and specific primers were designed accordingly. cDNA from tea tree leaves was used as a template and amplified using Biorun Pfu PCR Mix high-fidelity enzyme PCR. CsNOMT Excerpt.
[0029] The specific primer sequences are:
[0030] CsNOMT-F : GTGGTATCGAAGGTAGGCATATGATGGTCTCCAAAGAAAGCCA, as shown in SEQ ID NO: 3.
[0031] CsNOMT-R : ACAAGCTTGAATTCGGATCCTATTTGTAAAGTTCCATGA, as shown in SEQ ID NO: 4.
[0032] CsNOMT The nucleotide sequence of the gene is shown in SEQ ID NO: 1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 2.
[0033] Will CsNOMT The full-length sequence was cloned into the pCold-His tag vector and transformed into E. coli BL21(DE3). E. coliBL21). In LB medium containing ampicillin (50 g / mL), the enzyme was cultured at 37°C until OD600 = 0.6-0.8. Then, 0.5 mM IPTG (i.e., isopropyl-β-D-thiogalactoside) was added, and expression was induced at 16°C to obtain crude enzyme solution.
[0034] Enzyme activity assay:
[0035] The in vitro enzyme activity reaction system contained 50 μL crude enzyme solution, 10 μL 10 mM naringenin (dissolved in dimethyl sulfoxide DMSO), 50 μL 4 mM S-adenosylmethionine (SAM) and 50 μL 400 mM glycine-NaOH buffer (pH 9.5, containing 4 mM EDTA and 200 mM dithiothreitol DTT).
[0036] After reacting at 30℃ for 2 hours, 50 μL of hydrochloric acid (1 M) was added to terminate the reaction, and the amount of cherry blossom extract produced was quantified by LC-MS / MS. The Michaelis constant (Km) was determined using different concentrations of naringenin (0.1-20 mM).
[0037] Standard preparation:
[0038] 10 mg of safflower extract standard was dissolved in 1 ml of safflower extract solution (composed of ethanol:water:acetonitrile:acetic acid = 79:13.99:7:0.01 by mass) to prepare a 10 mg / ml stock solution. Serial dilutions were then prepared to achieve concentrations of 100 ng / mL, 25 ng / mL, 6.25 ng / mL, 1.56 ng / mL, 0.39 ng / mL, and 0.09 ng / mL, which were used to construct a standard curve for calculating the safflower extract concentration in the samples.
[0039] 4. Chromatographic and mass spectrometric acquisition conditions:
[0040] Data acquisition was performed using a SCIEX Triple Quad™ LC-MS / MS 5500+ system, including Ultra Performance Liquid Chromatography (UPLC, ExionLC™ AD) and Triple Quad™ LC-MS / MS 5500+.
[0041] Chromatographic column: ZORBAX Eclipse Plus C18 column (1.8 µm, 3.0 mm * 100 mm; Mobile phase A: ultrapure water (with 0.01% formic acid and 2 mM ammonium formate); Mobile phase B: methanol (with 0.01% formic acid and 2 mM ammonium formate). Flow rate: 0.4 mL / min, column temperature: 40℃, injection volume: 1 µL. A 15-minute gradient elution method was used. The detailed elution gradient settings are shown in the table below.
[0042] Table 1: Liquid phase elution gradient
[0043]
[0044] Mass spectrometry conditions: Data were acquired using Analyst 1.7.1 software. The ion source was an electrospray ionization (ESI) source; the detection mode was multiple reaction monitoring (MRM); the ion spray voltage (IS) was -4500V in negative ion mode; the ion source temperature (TEM) was 500℃; the pressure of the nebulizing gas (Ion Source Gas1, Gas1) was 50psi; the pressure of the auxiliary gas (Ion Source Gas2, Gas2) was 55psi; the pressure of the curtain gas (CUR) was 35psi; and the collision gas (CAD) was 8. Ion pairs were scanned and detected based on the optimized declustering potential (DP) and collision energy (CE).
[0045] like Figure 1 China A- Figure 1 B, Figure 2 , CsNOMT The enzyme catalyzed the conversion of naringenin to safflowerin. Enzyme activity analysis showed that its Michaelis constant Km for naringenin was 4.31 mM, and its binding efficiency Kcat was (61.41±3.05)×10⁻⁶. −3 s −1 This indicates that it has strong substrate affinity and high catalytic efficiency.
[0046] Example 2: Inhibitory effect of sakura extract on anthrax bacteria
[0047] 1. Anthrax bacteria culture: Take an anthrax bacteria block with a diameter of 0.5 cm and add it to potato solid nutrient medium (i.e., PDA medium) for culture. Let the bacteria block grow for 6 days.
[0048] 2. Culture medium preparation: Prepare PDA solid culture medium with different concentrations (0, 0.05, 0.1, 0.3 mM) of epigallocatechin gallate (EGCG) and sakura extract (SAK).
[0049] 3. Indoor antibacterial culture: Take 0.5 cm diameter holes and add the anthrax bacteria blocks cultured in step 1 to PDA solid medium composed of different concentrations of EGCG and SAK in step 2 for culture.
[0050] 4. Diameter statistics: After the anthrax fungal blocks from step 3 have grown for 6 days, the diameter changes of the anthrax fungal strains are statistically analyzed.
[0051] like Figure 3 China A- Figure 3 In an indoor antibacterial experiment, it was found that low concentrations of EGCG (0.05 to 0.3 mM) had no significant effect on the growth of Bacillus anthracis, while a concentration of only 0.05 mM / mL of safflower extract significantly inhibited the growth of Bacillus anthracis.
[0052] Example 3: Cherry blossom extract enhances anthracnose resistance in tea trees
[0053] 1. Tea tree cultivation: Select two-year-old tea trees of uniform growth vigor, Longjing 43, and plant them in a cultivation box at 25℃ with 14 hours of light and 10 hours of darkness.
[0054] 2. Anthrax bacteria culture: Anthrax bacteria blocks were transferred to PDB liquid medium and shaken for 48 h. The spore suspension was collected by centrifugation, and the anthrax spore concentration was calibrated using a hemocytometer (10⁻⁶ spores). 7 spores / mL).
[0055] 3. Preparation of working solution for cherry blossom extract: First, dissolve cherry blossom extract in anhydrous ethanol to prepare a stock solution (100mM), then prepare a working solution using 0.1% Triton X-100 to prepare cherry blossom extract at different concentrations. Simultaneously, a control group (CK) was prepared by adding an equal volume of anhydrous ethanol to 0.1% Triton X-100.
[0056] 4. Spraying tea leaves with cherry blossom extract: Longjing 43 tea trees with uniform growth were sprayed with different concentrations (0.05, 0.1 and 0.3 mM) of cherry blossom extract and 0.1% Triton X-100 (CK) until the leaf surface was evenly moistened. This treatment was performed once.
[0057] 5. Inoculation with anthracnose fungus: The third leaf of a healthy, undamaged tea shoot treated with cherry blossom extract was used for inoculation experiments. The concentration was 10... 7 Tea leaves were inoculated with anthracnose spore suspension (spores / mL), while the control group was inoculated with sterile water. The phenotype of fungal patches on infected leaves was recorded using a super depth-of-field microscope 3-5 days after inoculation.
[0058] 6. Determination of fungal content in tea leaves inoculated with anthracnose: DNA was extracted from tea leaves inoculated with anthracnose in step 5 using the CTAB method, and the fungal content in the tea leaves was calculated using DNA-qPCR (tea genomic DNA GAPDH was used as an internal control). The primers used for the quantitative detection of relative fungal content in the leaves were specified. CcActin Its sequence is as follows:
[0059] CcActin-qF : ATGTGCAAGGCCGGTTTCGC, as shown in SEQ ID NO: 5
[0060] CcActin-qR : TACGAGTCCTTCTGGCCCAT, as shown in SEQ ID NO: 6
[0061] CsGAPDH-qF : TTGGCATCGTTGAGGGTCT, as shown in SEQ ID NO: 7
[0062] CsGAPDH-qR : CAGTGGGAACACGGAAAGC, as shown in SEQ ID NO: 8
[0063] like Figure 4 China A- Figure 4 In study B, the control effect of different concentrations of safflower extract (0, 0.05, 0.1, and 0.3 mM) on anthracnose in tea trees was evaluated by exogenous spraying. For each treatment of 10 leaves, statistical analysis revealed that, compared to the control, the application of different concentrations (0.05, 0.1, and 0.3 mM) of safflower extract significantly reduced the area of anthracnose lesions. Furthermore, the application of 0.1 mM safflower extract did not show a significant difference in anthracnose incidence compared to the application of 0.3 mM. Based on the results of the effect of safflower extract on the growth of anthracnose fungus, the optimal concentration range for the control effect of safflower extract on anthracnose was determined to be 0.1–0.3 mM.
[0064] Example 4: The role of CsNOMT in anthracnose resistance in tea trees
[0065] 1. Transient overexpression CsNOMT Construction of tea leaf samples and detection of cherry blossom extract content
[0066] Agrobacterium, with CsNOMT constructed into the pCAMBIA1302 vector, was injected into the petioles of tea leaves. Each experiment consisted of 6 replicates. Samples were collected 1-3 days after injection, and gene expression was analyzed using RT-qPCR. The content of safflower extract was also detected.
[0067] 2. Construction of transiently silent tea leaf samples using antisense oligonucleotide technology and detection of safflower extract content.
[0068] Antisense oligonucleotide primers were designed using the Software for Statistical Folding of Nucleic Acids and Studies of Regulatory RNAs website (https: / / sfold.wadsworth.org / cgi-bin / index.pl), and primer specificity was tested using the Tea Plant Genome Database (http: / / tpia.teaplant.org). Tea leaves were injected with 20 µM oligonucleotide antisense and sense strands as controls. Each experiment included six replicates, and each sample consisted of one bud and two leaves. Samples were collected 1-3 days post-injection, and subsequent gene analysis was performed using RT-qPCR. CsNOMT The expression of [the substance] was investigated, and the content of cherry blossom extract was detected.
[0069] Its sequence is as follows:
[0070] Oligonucleotide antisense strand AsCsNOMT: AAAGGTGGCTCGGTGGAAGGCAAGAGGGAC, as shown in SEQ ID NO: 9
[0071] Oligonucleotide sense strand SCsNOMT : GTCCCTCTTGCCTTCCACCGAGCCACCTTT, as shown in SEQ ID NO: 10
[0072] CsNOMT-qF TGCTCTGCTCATACACTT, as shown in SEQ ID NO: 11
[0073] CsNOMT-qR : ACTTTCTTAAACTGGTTCCC, as shown in SEQ ID NO: 12
[0074] 3. Anthrax culture, inoculation of tea leaves with anthrax, and determination of anthrax content in tea leaves are described in Example 3.
[0075] like Figure 5 China A- Figure 5 In the F1 generation, gene silencing was performed using antisense oligonucleotide technology. Compared to the control group (tea leaves injected with sense oligonucleotides), the transiently silenced tea leaves showed significant differences. CsNOMT ( AsCsNOMTTranscription levels were significantly reduced, and the content of cherry blossom extract decreased by 30-40%. After inoculation with anthracnose, the lesion area significantly increased. Transient transformation overexpression... CsNOMT ( 35S:CsNOMT Tea leaves, CsNOMT Expression levels were significantly increased, with the content of cherry blossom extract increasing by approximately 30% compared to the control (i.e., treatment with empty vector: Empty Vector, abbreviated as EV). After inoculation with anthrax bacteria, overexpression was observed. CsNOMT The leaf area was smaller than the lesion area. These results indicate that CsNOMT-mediated production of safflowerin enhances the tea plant's resistance to anthracnose.
[0076] The above embodiments are not intended to limit the present invention, and the present invention is not limited to the above embodiments. Any embodiment that meets the requirements of the present invention is within the protection scope of the present invention.
Claims
1. CsNOMT The application of the key enzyme in the synthesis pathway of sakuranetin in the prevention and treatment of tea anthracnose, characterized in that, The CsNOMT The nucleotide sequence is shown in SEQ ID No.
1. The application involves using CsNOMT to catalyze the synthesis of safflower extract from naringenin, thereby increasing the content of the endogenous phytoprotectant safflower extract in tea trees and thus enhancing the tea trees' resistance to anthracnose.
2. Use according to claim 1, characterized in that, The protein amino acid sequence of the coding CsNOMT is shown in SEQ ID No.
2.
3. Use according to claim 1, characterized in that, The CsNOMT was isolated from tea plant according to the whole genome sequence of tea plant.
4. The use according to claim 1, characterized in that, According to CsNOMT the nucleotide sequence design primer, construct prokaryotic expression vector, and then transform E. coli for recombinant protein expression.
5. Use according to claim 4, characterized in that, The in vitro enzymatic activity reaction of the CsNOMT catalyzing naringenin to synthesize prunusin is incubating the recombinant protein in a reaction system at 30 DEG C for 2 hours; wherein the reaction system contains 10 mM substrate naringenin, 4 mM S-adenosyl methionine, and pH 9.5 buffer.
6. A method of increasing resistance to anthracnose in a tea plant, the method comprising, Spraying prunusin on tea leaves.
Citation Information
Patent Citations
Corn naringenin methyltransferase gene ZmNOMT and application thereof in plant broad-spectrum disease resistance
CN114752578A
Modified o-methyltransferases useful for production of o-methylated phenolic natural products
US20250283056A1