InDel molecular marker related to corn kernel sugar content and application of InDel molecular marker

Abstract

The invention discloses an InDel molecular marker related to the corn kernel sugar content and application of the InDel molecular marker, and belongs to the technical field of molecular genetics. A molecular marker InDel-71 located in a corn kernel sugar content increasing gene is screened and identified from a corn chromosome 4, the corn kernel sugar content increasing character can be accurately identified in the early stage by utilizing the molecular marker InDel-71, and the molecular marker InDel-71 has the advantages of being simple, convenient, rapid, efficient, accurate, good in repeatability, high in specificity and the like; the method can be used for corn molecular marker-assisted breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular genetics, and particularly relates to an InDel molecular marker related to the sugar content of corn kernels and application thereof. BACKGROUND

[0002] Corn (Zea mays L.) is the largest crop in the world in terms of planting area, and is widely used in food, feed, chemical industry and other industries. The kernel is the starting point of individual development of corn, and its quality directly affects the yield and quality of corn. Therefore, the synthesis and accumulation of nutrients in corn kernels has always been a hot research topic. Starch is the main storage material in corn kernels, accounting for about 70% of the total mass of kernels. Starch is essentially a monomolecular polymer of glucose, and can be divided into two types of amylopectin and amylose according to the different connection forms of these glucose monomers.

[0003] Sweet corn (Zea mays L. Saccharata Sturt) is a special type of corn formed by the recessive mutation of key genes in the synthesis process of corn starch, which causes the inhibition of starch synthesis and the increase of soluble sugar content in kernels at the milk stage. The kernels of sweet corn are mainly composed of reducing sugars and sucrose, and sweet corn can be divided into common sweet type, super sweet type and enhanced sweet type according to the sugar content. The common sweet type corn contains 10-15% of sugar, the super sweet type corn contains 20-25% of sugar, and the enhanced sweet type corn contains 30-40% of sugar. The kernels of sweet corn at the milk stage are fresh, sweet, crisp and tender, and are rich in nutrients, vitamins, amino acids and minerals, which have important breeding and production application value.

[0004] Molecular markers are DNA fragments that can reflect the differences in certain sequences in the genomes of individuals or populations, and can directly reflect genetic polymorphism at the DNA level. Molecular markers can be detected at different developmental stages and different tissues, making early selection of genotypes possible, which is beneficial to the selection of recessive genes, and the amount of markers is large and not easily affected by the environment. The level of soluble sugar content is one of the key targets of quality breeding of sweet corn, but the research on molecular markers and QTL of soluble sugar content and other traits of sweet corn is still relatively few. Therefore, the development of new molecular markers related to the sugar content of corn kernels is of great significance for improving the quality of sweet corn. SUMMARY

[0005] In view of the above prior art, the present application aims to provide an InDel molecular marker related to the sugar content of corn kernels and application thereof.

[0006] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0007] In a first aspect, the present application provides an InDel molecular marker related to the sugar content of corn kernels, which is named InDel-71, and the nucleotide sequence of which is shown as SEQ ID No. 1. Details are as follows:

[0008] CCAAAGGAGCCCTTAAAATGCATTCACATCATATTGTTGTTTGATTGATGTAGGTTGACACCACCATACTTGGCCTTGATGACGTGAGGGCAAAGGAAATGCCTTATATTGCTAGCATGGGTATCTATGTTTTCAGCAAAGATGTAATGCTTCAGCTCCTCCGTGAACAATTTCCTGAAGCAGTGAAGCCAATGACTTTGGAAGTGAGGTTATTCCAGGTGCAACCAGCATTGGAAAGAGGGTATGCAAA.

[0009] Note: The shaded area in the sequence is the inserted nucleotide fragment compared with the wild type.

[0010] The molecular marker InDel-71 of the present application is located at 61,582,141-61,582,382 bp of chromosome 4 of corn, and there is an insertion of 8 nucleotides (AGTGAAGC) compared with the wild type, and the physical position is referred to the B73 RefGen_v5 genome version.

[0011] In a second aspect, the present application provides the above-mentioned InDel molecular marker for use in (1) or (2) as follows:

[0012] (1) Identifying the high and low of the soluble sugar content of corn kernels;

[0013] (2) Breeding corn germplasm with high soluble sugar content of kernels.

[0014] In the above-mentioned uses, the soluble sugar is sucrose.

[0015] The present application researches and finds that the molecular marker InDel-71 is significantly related to the soluble sugar content of corn kernels, and by detecting the molecular marker InDel-71 in the early growth of corn, corn germplasm resources with high soluble sugar content of kernels can be bred, so as to speed up the breeding process and improve the selection efficiency and effect.

[0016] In a third aspect, the present application provides a primer pair for amplifying the above-mentioned InDel molecular marker, and the nucleotide sequences of the primer pair are shown as SEQ ID No. 3 and SEQ ID No. 4 respectively; details are as follows:

[0017] Upstream primer: 5'-CCAAAGGAGCCCTTAAAATGC-3'; (SEQ ID No. 2)

[0018] Downstream primer: 5'-TTTGCATACCCTCTTTCCAATGC-3'. (SEQ ID No. 3)

[0019] The characteristic band of the molecular marker InDel-71 for the corn kernel sugar content increase is 250bp, and the nucleotide sequence is shown as SEQ ID No. 1.

[0020] If the DNA of the homozygous plant with normal corn kernel sugar content is amplified by the above-mentioned primer, the characteristic band of the molecular marker InDel-71 for the corn kernel sugar content normal is 242bp, and the nucleotide sequence is shown as SEQ ID No. 4.

[0021] CCAAAGGAGCCCTTAAAATGCATTCACATCATATTGTTGTTTGATTGATGTAGGTTGACACCACCATACTTGGCCTTGATGACGTGAGGGCAAAGGAAATGCCTTATATTGCTAGCATGGGTATCTATGTTTTCAGCAAAGATGTAATGCTTCAGCTCCTCCGTGAACAATTTCCTGAAGCCAATGACTTTGGAAGTGAGGTTATTCCAGGTGCAACCAGCATTGGAAAGAGGGTATGCAAA.

[0022] In a fourth aspect of the present application, a kit containing the above-mentioned primer pair is provided.

[0023] Further, the kit further comprises a DNA template, Taq Master Mix and ddH2O.

[0024] In a fifth aspect of the present application, the above-mentioned primer pair or kit is applied in (1) or (2) as follows:

[0025] (1) identifying the high and low of the soluble sugar content of corn kernels;

[0026] (2) breeding corn germplasm with high soluble sugar content of kernels.

[0027] In the above-mentioned application, the soluble sugar is sucrose.

[0028] In a sixth aspect of the present application, a method for identifying the high and low of the soluble sugar content of corn kernels is provided, comprising the following steps:

[0029] The genomic DNA of the corn to be tested is used as a template, and a primer pair shown in SEQ ID No. 3 and SEQ ID No. 4 is used for PCR amplification, and the sequence of the PCR amplification product is homozygous corn of SEQ ID No. 1, and the soluble sugar content of the kernel is higher than that of homozygous corn of the sequence of the PCR amplification product of SEQ ID No. 4.

[0030] Preferably, the reaction system of PCR amplification is: 0.5 μL of the primer shown in SEQ ID No. 3 with a concentration of 10 μM; 0.5 μL of the primer shown in SEQ ID No. 4 with a concentration of 10 μM; 1 μL of genomic DNA with a concentration of 100 ng / μL; 5 μL of 2x TaqMaster Mix; and 3 μL of ddH2O.

[0031] The reaction conditions of PCR amplification are: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; and 10℃ preservation.

[0032] Advantages of the present application:

[0033] The present application screens and identifies a molecular marker InDel-71 located in the internal gene of the corn kernel sugar content increasing gene on chromosome 4 of corn, and the molecular marker InDel-71 of the present application can accurately identify the kernel sugar content increasing trait of corn in early stage, has the advantages of being simple, fast, efficient, accurate, good repeatability and high specificity, and can be used for corn molecular marker assisted breeding. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 The sequence alignment results of the amplification products of the molecular marker InDel-71 of the present application on the corn inbred line B73, the corn kernel sugar content increasing mutant tq16 and the near-isogenic line WT.

[0035] Figure 2 The electrophoretogram of the product obtained by PCR amplification of the corn material in the actual application of the molecular marker InDel-71 of the present application. Among them, S is the amplification band type of the homozygous genotype of the normal corn kernel sugar content, which shows a non-sweet kernel phenotype, N is the amplification band type of the homozygous genotype of the increased corn kernel sugar content, which shows a sweet kernel phenotype, H is the amplification band type of the heterozygous genotype, and M is Marker; the sizes of the bands from bottom to top are 242 bp and 250 bp.

[0036] Figure 3The detection results of the sugar content of the corn kernels in the F2 population. N represents a homozygous plant with normal sugar content of the corn kernels, S represents a homozygous plant with increased sugar content of the corn kernels, and *** represents a significant difference (P < 0.001). DETAILED DESCRIPTION

[0037] It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0038] As described previously, corn is a major food crop in China, and the sugar content of the corn kernels directly affects the taste and quality of sweet corn. Compared with the international advanced level, the existing domestic sweet corn varieties have a lower sweetness, which seriously affects the quality of sweet corn.

[0039] The soluble sugar content is one of the key targets of sweet corn quality breeding. In view of this, the present application has carried out in-depth research on the gene controlling the increase of the sugar content of the corn kernels. The present application determines the genetic mode of the gene controlling the increase of the sugar content of the corn kernels by using genetic methods, and determines the position of the gene controlling the increase of the sugar content of the corn kernels by using the technology of map-based cloning.

[0040] In the process of detecting and identifying the gene controlling the increase of the sugar content of the corn kernels, the design and optimization of the InDel molecular marker is one of the important technical difficulties. Due to the variable characteristics of the target DNA sequence, it may be challenging to design specific primers. The design of primers needs to consider the length, GC content, specificity of the target DNA sequence and the site coverage between primers. In addition, the temperature and amplification program of the primers also need to be optimized to ensure reliable amplification effect. In order to find molecular markers with polymorphism with the gene controlling the increase of the sugar content of the corn kernels, it may be necessary to design multiple groups of primers to cover each polymorphic site.

[0041] The present application takes the maize kernel sugar content increased mutant tq16 found in the field as the father, the inbred lines B73 and B104 as the mother, constructs an F2 separation population, and finely locates the gene for controlling the maize kernel sugar content. The constructed F2 separation population is planted in the field, the mature ears of the separation population are phenotyped, the total DNA of the kernel with the increased sugar content phenotype is extracted, and the polymorphism of the kernel sugar content increased mutant and the parents is screened by using the synthesized and self-developed SSR markers on the IBM map of the maize. According to the published maize genome, the primer is encrypted, and finally the kernel sugar content increased gene is located between the two molecular markers InDel-71 and InDel-49, and the physical distance is 247.1 kb. Sequencing in the locating interval finds that, compared with the wild type, the maize kernel sugar content increased mutant has 8 nucleotide insertions, and the region can be used as the InDel molecular marker for identifying the maize kernel sugar content increased gene, and is named as InDel-71.

[0042] Based on the molecular marker InDel-71, the present application further designs the specific primers for specifically amplifying the above-mentioned molecular marker InDel-71, and the specific primers are as follows:

[0043] The upstream primer is 5'-CCAAAGGAGCCCTTAAAATGC-3' (SEQ ID No. 2);

[0044] The downstream primer is 5'-TTTGCATACCCTCTTTCCAATGC-3' (SEQ ID No. 3).

[0045] The above-mentioned specific primers are subjected to blast analysis, and based on the existing maize genome sequence, it is found that the molecular marker InDel-71 is located at 61,582,141-61,582,382 bp of the maize chromosome 4, and the physical position refers to the B73RefGen_v5 genome version.

[0046] The molecular marker InDel-71 of the present application can accurately identify the maize kernel sugar content increased trait in the early stage, is beneficial to breeding excellent sweet corn varieties, and thus the present application is proposed.

[0047] In order for those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below in combination with specific examples.

[0048] The test materials used in the embodiments of the present application are all conventional test materials in the art, and can be purchased through commercial channels. The experimental methods without detailed conditions are carried out according to the conventional test methods or according to the operation instructions recommended by the suppliers.

[0049] Example 1: Obtaining InDel molecular marker associated with corn kernel sugar content

[0050] 1. Obtaining and genetic analysis of corn mutants with increased kernel sugar content

[0051] The tq16 mutant is a natural mutant discovered in a breeding field, and the soluble sugar content of the kernel of the tq16 mutant is 16%, which has a phenotype of increased corn kernel sugar content compared with the wild type. The phenotype can be stably inherited, and it is preliminarily determined that the phenotype is caused by gene mutation.

[0052] The tq16 mutant is crossed with normal inbred lines B73 and B104, and the F1 kernel develops normally, indicating that the increased corn kernel sugar content is a recessive trait. In the F2 segregation population combined with B73, the ratio of wild type to mutant is 3:1 (Table 1) by chi-square test, indicating that the tq16 mutant trait is controlled by one pair of recessive nuclear genes.

[0053] Table 1: Genetic analysis of the tq16 corn kernel sugar content mutant

[0054]

[0055] 2. Preliminary mapping of genes associated with corn kernel sugar content

[0056] The F2 segregation population constructed from inbred line B73 and the corn kernel sugar content mutant (tq16) is planted in the field, and the mature ears of the segregation population are phenotyped. The total DNA is extracted from the kernels with the phenotype of increased corn kernel sugar content, and the DNA extraction method is as follows:

[0057] (1) Take about 0.1 g of dehulled kernels and grind into powder after quick freezing in liquid nitrogen;

[0058] (2) Add about 700 μl of CTAB buffer and mix well.

[0059] (3) Place in a 60°C water bath for 30-40 min, shake every 10-15 min.

[0060] (4) Take out the centrifuge tube, add Tris-saturated phenol 350 μL and chloroform 350 μL for extraction, mix gently, and centrifuge at 8000 rpm for 8 min.

[0061] (5) Take 600 μL of supernatant in another tube, add isopropyl alcohol 500 μL, mix gently, and stand when the flocculent DNA appears.

[0062] (6) Place the centrifuge tube in the centrifuge, centrifuge at 1200 rpm for 6 min, and remove the supernatant. Wash with 70% ethanol for 2-3 times.

[0063] (7) After air-drying at room temperature, dissolve in 200 μL 1xTE, mix gently, and store at -20°C.

[0064] The polymorphism of the mutant and its parent was screened by using the available and self-developed SSR markers on the IBM map of synthetic maize. The gene of the mutant with increased sugar content in maize kernel was located by bulked segregant analysis (BSA). The polymorphic markers of the mutant with increased sugar content in maize kernel were screened by using 286 pairs of public SSR primers averagely distributed on the whole genome of maize between B73 and the mutant. There were 87 pairs of primers with polymorphic differences between the parent. The normal DNA pool and the mutant DNA pool were constructed by mixing 5 kernels of normal kernel DNA and 5 kernels of mutant kernel DNA, respectively. The linkage of 87 pairs of primers was analyzed, and 4 pairs of markers possibly linked to the target gene were screened. The 96 F2 mutant kernels were amplified by PCR using the 4 pairs of markers possibly linked to the target gene, and the results were verified by gel electrophoresis. It was found that umc2061 and umc1031 were linked to the target trait. The 637 mutant kernels were amplified by PCR using the two pairs of primers umc2061 and umc1031, and the single plants with recombination exchange between the markers were found. According to the number and physical position of the single plants with recombination exchange, the gene of the mutant with increased sugar content in maize kernel was preliminarily located between the markers umc2061 and umc1031 on chromosome 4 of maize, with the genetic distances of 36 cM and 64 cM, respectively, and the physical distance of about 28 Mb.

[0065] Note: umc2061 and umc1031 are self-designed markers, and the primer sequences are as follows:

[0066] umc2061

[0067] Forward primer: 5'-GTCTGGAGAACTCCCTACCCATTC-3'; (SEQ ID No. 5)

[0068] Reverse primer: 5'-TAGCTTGAGAGACCGGAACAGC-3'. (SEQ ID No. 6)

[0069] umc1031

[0070] Forward primer: 5'-TTGGGTTCATACCTCCTAGGAACA-3'; (SEQ ID No. 7)

[0071] Reverse primer: 5'-ACGTGGACAACCAGTCTATCAACA-3'. (SEQ ID No. 8)

[0072] 3. Fine mapping of a gene associated with sugar content in maize kernels

[0073] DNA was extracted from the kernels of the F2 segregation population of B73, B104 and the maize kernel sugar content increased mutant. Between the markers umc2061 and umc1031 in the initial mapping, 80 pairs of InDel molecular markers were developed, and the parent polymorphism difference of B73, B104 and the maize kernel sugar content increased mutant was detected, and the different markers were used for further fine mapping. Finally, the maize kernel sugar content increased gene was located between the two molecular markers InDel-49 and InDel-71 on chromosome 4 of maize, and the physical distance was 247.1Kb.

[0074] Note: InDel-49 and InDel-71 are self-designed markers, and the primer sequences are as follows:

[0075] InDel-49

[0076] Upstream primer: 5'-CTGAGAGGAAGAGTTCTCTC-3'; (SEQ ID No. 9)

[0077] Downstream primer: 5'-CGCCCGGGGAGGTTTTATA-3'. (SEQ ID No. 10)

[0078] InDel-71

[0079] Upstream primer: 5'-CCAAAGGAGCCCTTAAAATGC-3';

[0080] Downstream primer: 5'-TTTGCATACCCTCTTTCCAATGC-3'.

[0081] Finally, an InDel molecular marker located in the maize kernel sugar content increased gene was screened on chromosome 4 of maize, located at the position of 61,582,141-61,582,382bp, named molecular marker InDel-71, and the physical position referred to B73 RefGen_v5 genome version. The nucleotide sequence of the corresponding molecular marker InDel-71 in the maize kernel sugar content increased mutant is shown in SEQ ID No. 1.

[0082] Example 2: Application investigation of molecular marker InDel-71 in the identification of maize kernel sugar content

[0083] Based on the molecular marker InDel-71 screened in Example 1, a primer pair for amplifying the molecular marker was designed, and the sequence of the designed primer pair is as follows:

[0084] Upstream primer: 5'-CCAAAGGAGCCCTTAAAATGC-3' (SEQ ID No. 2);

[0085] Downstream primer: 5'-TTTGCATACCCTCTTTCCAATGC-3' (SEQ ID No. 3).

[0086] The alignment results of the sequences of the amplification products of the molecular marker InDel-71 of the corn inbred line B73, the tq16 mutant and the near-isogenic line WT are shown in the following table. Figure 1

[0087] Taking the corn inbred line B73 and the tq16 mutant as parents, a new F2 separation population was constructed, and the grain sugar content of the corn material in the F2 separation population was detected by using the molecular marker InDel-71 and the primer pair (shown in SEQ ID No. 2 and SEQ ID No. 3). The detection was carried out as follows:

[0088] Taking the genomic DNA of the corn to be detected as a template, the primer pair shown in SEQ ID No. 2 and SEQ ID No. 3 was used for PCR amplification, and the grain sugar content of the corn was determined according to the size of the amplification product.

[0089] If the size of the PCR amplification product of the corn sample to be detected is 250 bp, the corn sample to be detected contains the allele with increased grain sugar content; if the size of the PCR amplification product of the corn sample to be detected is 242 bp, the corn sample to be detected contains the allele with normal grain sugar content. The grain sugar content of the corn sample with a PCR amplification product of 250 bp is higher than that of the corn sample with a PCR amplification product of 242 bp.

[0090] The reaction system of 10 μL PCR amplification is as follows:

[0091] (1) 0.5 μL of the forward amplification primer shown in SEQ ID No. 2 with a concentration of 10 μmol / L;

[0092] (2) 0.5 μL of the reverse amplification primer shown in SEQ ID No. 3 with a concentration of 10 μmol / L;

[0093] (3) 1 μL of the DNA template with a concentration of 100 ng / μL;

[0094] (4) 5 μL of 2×Taq Master Mix;

[0095] (5) 3 μL of ddH2O.

[0096] The program of PCR amplification is as follows:

[0097] ​(1) Pre-denaturation at 94℃ for 10 min;

[0098] (2) 94℃ denaturation for 30s, 60℃ annealing for 30s, 72℃ extension for 30s, 35 cycles;

[0099] (3) Extend at 72℃ for 10 minutes;

[0100] (4) Store at 10℃.

[0101] The amplified fragments were electrophoresed in an 8% polyacrylamide gel (e.g.) Figure 2 As shown in the figure, if a band of 250 bp is amplified, the kernel phenotype is high sugar content (N); if a band of 242 bp is amplified, the kernel phenotype is normal sugar content (S); if two bands of 250 bp and 242 bp are amplified, it indicates that the maize is heterozygous (H).

[0102] The sugar content of maize materials identified with elevated kernel sugar content using the molecular marker InDel-71, as well as maize materials identified with normal kernel sugar content, was determined using the following methods:

[0103] (1) Prepare sucrose standards: Dissolve 200 mg of standard sucrose in 1 L of water to prepare 0.9 mL of sucrose standard samples containing 0 μg, 20 μg, 40 μg, 80 μg, 120 μg and 160 μg.

[0104] (2) Preparation of sucrose extract: Accurately weigh 0.100g of seed sample into a 10mL centrifuge tube, add 8mL of 80% ethanol solution, shake and extract in an 80℃ water bath for 30min, cool and centrifuge at 4000rpm for 15min, collect the supernatant into a 50mL volumetric flask, repeat three times to achieve complete extraction, finally combine the supernatant system and add 1g of activated carbon to stand and adsorb pigments, the supernatant is the sucrose extract.

[0105] (3) Preparation of test solution: Take 0.9 mL of sucrose extract and add 0.1 mL of NaOH, boil in water for 10 min, take it out and cool, then add 1 mL of 1% resorcinol and 3 mL of 10N HCl, boil in water at 80℃ for 60 min, cool, and the resulting liquid is used for the determination of sucrose content.

[0106] (4) Measure absorbance: Pipette 200 μL of the test solution into a 96-well microplate and measure absorbance using a microplate reader. Use sucrose solution at 500 nm for colorimetric analysis.

[0107] (5) Calculation: Sucrose (%) = [(C × V 总 / V 样 ) / (W×10 6 )]×100

[0108] Note: C is the sugar concentration corresponding to the standard curve (μg), V 总 is 50 mL, V 样 is the sampling volume for color reaction (mL), W is 0.1 g, 10 6 is the mass unit conversion coefficient (g→μg)

[0109] The results are shown in Table 1. Figure 3 As shown in Table 1, the sucrose content in the corn material (S) identified by the molecular marker InDel-71 as having increased sugar content in the corn kernel is significantly higher than that in the corn material (N) identified by the molecular marker InDel-71 as having normal sugar content in the corn kernel. The identification result of the molecular marker InDel-71 is consistent with the actual determination result of the sugar content.

[0110] The above results prove that the molecular marker InDel-71 of the present application can be used to detect the trait of increased sugar content in the corn kernel, and the result is accurate and reliable.

[0111] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Various modifications and changes can be made by those skilled in the art based on the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. An InDel molecular marker associated with sugar content of corn kernels, characterized in that, The nucleotide sequence of the InDel molecular marker is shown as SEQ ID No.

1.

2. The InDel molecular marker of claim 1 is applied in (1) or (2) as follows: (1) identifying the high or low soluble sugar content of corn kernels; (2) breeding corn germplasm with high soluble sugar content of kernels.

3. Use according to claim 2, characterized in that, The soluble sugar is sucrose.

4. A primer pair for amplifying the InDel molecular marker of claim 1, characterized in that, The nucleotide sequences of the primer pair are shown as SEQ ID No. 3 and SEQ ID No. 4 respectively.

5. The kit containing the primer pair of claim 4.

6. The kit of claim 5, wherein The kit further comprises a DNA template, Taq Master Mix and ddH2O.

7. The primer pair of claim 4 or the kit of claim 5 is applied in (1) or (2) as follows: (1) identifying the high or low soluble sugar content of corn kernels; (2) breeding corn germplasm with high soluble sugar content of kernels.

8. Use according to claim 7, characterized in that, The soluble sugar is sucrose.

9. A method for identifying high and low soluble sugar content in maize kernels, characterized by, The method comprises the following steps: Using the genomic DNA of the corn to be tested as a template, the primer pair shown as SEQ ID No. 3 and SEQ ID No. 4 is used for PCR amplification, and the sequence of the PCR amplification product is homozygous corn of SEQ ID No. 1, and the soluble sugar content of the kernels thereof is higher than that of homozygous corn of SEQ ID No.

4.

10. The method of claim 9, wherein, The reaction system for PCR amplification is: 0.5 μL of the primer shown as SEQ ID No. 3 with a concentration of 10 μM; 0.5 μL of the primer shown as SEQ ID No. 4 with a concentration of 10 μM; 1 μL of genomic DNA with a concentration of 100 ng / μL; 5 μL of 2×Taq Master Mix; 3 μL of ddH2O; The reaction conditions for PCR amplification are: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; 10℃ preservation. The reaction conditions for PCR amplification are: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 s, 60℃ annealing for 30 s, 72℃ extension for 30 s, 35 cycles; 72℃ extension for 10 min; 10℃ preservation.

Images