A SNP marker for promoting preadipocyte differentiation and identifying broilers with high abdominal fat percentage and its application

Abstract

This invention proposes a SNP marker for promoting preadipocyte differentiation in chickens and identifying broilers with high abdominal fat percentage, and its application, belonging to the field of animal molecular genetics. It includes an SNP marker for promoting preadipocyte differentiation in chickens and identifying broilers with high abdominal fat percentage. The SNP marker uses the sequence shown in SEQ ID NO.1 as its starting sequence, with position 51 being either A or G. If the SNP is of the GG genotype, it indicates a broiler with high abdominal fat percentage. Replacing A with G at position 51 promotes preadipocyte differentiation in chickens. It is mainly used to promote preadipocyte differentiation in chickens and identify broilers with high abdominal fat percentage.

Description

Technical Field

[0001] This invention belongs to the field of animal molecular genetics technology, and in particular relates to an SNP marker that promotes the differentiation of chicken preadipocytes and identifies broilers with high abdominal fat percentage, and its application. Background Technology

[0002] Over the past half-century, fast-growing white-feathered broiler chickens have achieved remarkable success in terms of growth rate and meat yield through traditional breeding methods using phenotypic selection. However, along with rapid growth, physiological maladaptations and related diseases in broilers have increased significantly, such as excessive body fat accumulation, ascites syndrome, sudden death syndrome, leg diseases, increased stress sensitivity, and decreased immune function. Among these, excessive body fat accumulation in broilers has become a prominent problem. Excessive fat deposition in broiler chickens not only reduces feed conversion efficiency and carcass lean meat percentage, affecting cut meat yield, but also increases the burden on processors and even pollutes the environment, causing huge economic losses due to the disposal of excessive fat deposits. On the other hand, overweight broiler breeders not only seriously affect egg production, fertilization rate, and hatchability, but also induce fatty liver syndrome and increase mortality during the laying period. Therefore, controlling excessive fat accumulation in chickens and breeding low-fat broiler strains have become important research topics in modern broiler breeding.

[0003] The genetic basis of abdominal fat deposition in chickens is highly complex, involving the interaction of numerous genes and genetic loci. From a breeding practice perspective, genetic improvement is the fundamental solution to the problem of excessive abdominal fat deposition in chickens. However, traditional breeding methods have yielded limited success in producing low-fat broilers. In contrast, marker-assisted selection (MAS), with its precision and efficiency, has become a key technology in modern breeding systems. Therefore, screening and identifying molecular markers that significantly affect the growth and development of abdominal adipose tissue in broilers, and then eliminating individuals with high abdominal fat percentages by marker genotype elimination while retaining individuals with low abdominal fat percentages for breeding, can effectively improve the excessive accumulation of abdominal fat in offspring. Summary of the Invention

[0004] In view of this, the present invention aims to propose an SNP marker for promoting the differentiation of chicken preadipocytes and identifying broilers with high abdominal fat percentage, and its application, so as to solve the problem of screening broilers with high abdominal fat percentage.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] This invention provides an SNP marker that promotes the differentiation of chicken preadipocytes, wherein the SNP marker is based on the sequence shown in SEQ ID NO.1, and the 51st position is A or G.

[0007] This invention provides a primer combination for amplifying the above-mentioned SNP marker.

[0008] The present invention provides a recombinant vector containing the above-mentioned SNP marker.

[0009] Further specifying, the originating carrier is pCMV-HA.

[0010] The present invention provides a recombinant microbial cell containing the above-mentioned SNP sites.

[0011] This invention provides a method for identifying broiler chickens with high abdominal fat percentage, the steps of which are as follows:

[0012] Step 1: Extract DNA from broiler chickens;

[0013] Step 2: Using the DNA obtained in Step 1 as a template, perform a PCR reaction using the primer combination described above;

[0014] Step 3: Perform genotyping analysis on the PCR products obtained in Step 2; if it is the GG genotype, it is a broiler chicken with a high abdominal fat percentage.

[0015] This invention provides a method for promoting the differentiation of chicken preadipocytes, which involves using the sequence shown in SEQ ID NO.1 as the starting sequence in immortalized chicken preadipocyte line 2, replacing the A at position 51 with G, or transfecting the above-mentioned recombinant vector into immortalized chicken preadipocyte line 2.

[0016] Further, the differentiation was promoted by increasing the lipid content of the immortalized chicken preadipocyte line 2 and promoting lipid droplet deposition in the immortalized chicken preadipocyte line 2.

[0017] This invention provides the application of the above-mentioned SNP marker, primer combination, recombinant vector, or recombinant microbial cell in promoting the differentiation of chicken preadipocytes and identifying genetic breeding related to high abdominal fat percentage in broilers.

[0018] Further specifying, the chicken preadipocytes are immortalized chicken preadipocyte line 2.

[0019] Compared with the prior art, the beneficial effects of the present invention are: the G allele at the A>G site of the FADS2 gene is beneficial to promoting the differentiation of chicken preadipocytes, the A allele has no effect on the differentiation of chicken preadipocytes, and the G allele is only present in high-fat (high abdominal fat percentage) broilers. Attached Figure Description

[0020] The accompanying drawings, which form part of this invention, are used to provide a further understanding of the invention. The illustrative embodiments of the invention and their descriptions are used to explain the invention and do not constitute an undue limitation of the invention. In the drawings:

[0021] Figure 1Figure showing the comparison of relative reporter gene activity at the A>G site of the FADS2 gene at 5:16345061;

[0022] Figure 2 Here is the structure diagram of the pCMV-FADS2 fusion plasmid;

[0023] Figure 3 Figures showing the enzyme digestion identification results of pCMV-FADS2-A and pCMV-FADS2-G plasmids; Note: a): Enzyme digestion identification of the CDS fragment; b): Enzyme digestion identification of the CDS+ mutation site fragment; c): Enzyme digestion identification of the mutation site fragment (1: Enzyme digestion diagram of pCMV-FADS2-A plasmid; 2: pCMV-FADS2-A plasmid; 3: Enzyme digestion diagram of pCMV-FADS2-G plasmid; 4: pCMV-FADS2-G plasmid).

[0024] Figure 4 Figures showing the sequencing results of pCMV-FADS2-A and pCMV-FADS2-G plasmids; Note: a): Sequencing results of pCMV-FADS2-A; b): Sequencing results of pCMV-FADS2-G plasmid (blue boxes represent stop codons in the CDS region of the FADS2 gene; red boxes represent SNP sites).

[0025] Figure 5 Protein expression diagrams for pCMV-FADS2-A and pCMV-FADS2-G plasmids; Note: 1: pCMV-FADS2-A; 2: pCMV-FADS2-G; 3: pCMV-FADS2; 4: pCMV-HA; 5: ICP2 cells;

[0026] Figure 6 The effect of pCMV-FADS2-A and pCMV-FADS2-G plasmids on the differentiation of chicken preadipocytes is shown in the figure. Note: a) Oil Red O staining results (160 μM); b) Oil Red O extraction colorimetric results at different time points; c) Oil Red O extraction colorimetric results at 24 h of differentiation; d) Oil Red O extraction colorimetric results at 48 h of differentiation (the scale bar in the figure is 200 μm, * indicates significant difference (P<0.05), ** indicates extremely significant difference (P<0.01)).

[0027] Figure 7 This is an image showing the detection of PCR products by agarose gel electrophoresis. Detailed Implementation

[0028] ICP2 cells are a successfully constructed immortalized chicken preadipocyte cell line. The source is Wang W, Zhang T, Wu C, Wang S, Wang Y, Li H, Wang N. Immortalization of chicken preadipocytes by retroviral transduction of chicken TERT and TR. PLoS One. 2017 May 9;12(5):e0177348. doi: 10.1371 / journal.pone.0177348. PMID: 28486516; PMCID:PMC5423695.

[0029] The research material used in this application is the high-fat and low-fat broiler breeds selected from abdominal fat at Northeast Agricultural University (hereinafter referred to as the high-fat and low-fat breeds). These breeds were established using Albert Ibrahim (AA) grandparent broilers as the primary source, with abdominal fat percentage and plasma very low-density lipoprotein (VLDL) content as selection indicators. This is the only fast-growing, white-feathered broiler breed in China selected from abdominal fat percentage. Since 1996, this breed has been bred for 29 generations. Statistical analysis shows that from the 4th generation onwards, the abdominal fat percentage of the high-fat and low-fat breeds exhibits a significant difference. At the 27th generation, the abdominal fat percentage of the high-fat breed was 6.44±0.07%, while that of the low-fat breed was 0.45±0.01%.

[0030] Example 1.

[0031] Pick FADS2 The gene SNP 5:16345061 contains a 100bp fragment, consisting of 50bp upstream and downstream of the A>G site.

[0032] Wild type:

[0033] GGTGCTCACATTTCCCAATTAATTGCTAGTCTCTGATTGGCCAACAGCTG A GATAGGAACACTGGTTTTGCTCAGATACCCACAAAGTGAGAAGAAAACCAG (SEQ ID NO. 1);

[0034] Mutant type:

[0035] GGTGCTCACATTTCCCAATTAATTGCTAGTCTCTGATTGGCCAACAGCTG GGATAGGAACACTGGTTTTGCTCAGATACCCACAAAGTGAGAAGAAACCAG (SEQ ID NO.2) was inserted into the multiple cloning site downstream of the *Hymenoplastin* gene in the psi-CHECKⅡ vector. Genewiz then constructed luciferase reporter gene plasmids with different alleles: psi- FADS2 -A and psi- FADS2 -G.

[0036] (1) Vector construction: RNA was extracted from the abdominal adipose tissue of Lindian chickens and reverse transcribed into cDNA (reverse transcription reagent: Hieff UNICON® Universal Blue qPCR SYBR Green Master Mix). The cDNA was then used as a template for amplification. FADS2 Full-length gene (primer sequences: F: tggccatggaggcccGAATTCGGATGGGGAAGGGGGGCGAG, SEQ ID NO.3; R: ccgcggccgcggtacCTCGAGTCACGGAGGTAAGCATCCA, SEQ ID NO.4). (Amplification enzyme: TaKaRaEx Premier™ DNA Polymerase), amplified using homologous recombination. FADS2 The full-length gene fragment was ligated into the pCMV-HA empty vector, and the two restriction enzyme sites were [missing information]. EcoR I and Xho Ⅰ, Obtain pCMV- FADS2 Plasmid. psi- FADS2 -A (containing) FADS2+ (the carrier of SEQ NO.1), psi- FADS2 -G (containing FADS2+ (vector of SEQ NO.2), pCMV- FADS2 -A (containing) FADS2+ (the vector of SEQ NO.1) and pCMV- FADS2 -G (containing SEQ) FADS2+ The carriers of NO.2 were all synthesized by the company.

[0037] psi- FADS2 -A and psi- FADS2 Two plasmids, -G and -G, were transfected into ICP2 cells, and the luciferase activities of *Gnaphalium affine* and *Firefly* were measured after 48 hours. Compared with the control group (transfected with psi-CHECKⅡ vector), psi- FADS2 - There was no significant difference in relative luciferase activity in group A; psi- FADS2 -Group G compared to the control group and psi- FADS2Compared to group A, the relative luciferase activity was significantly increased in all groups ( Figure 1 This indicates that the SNP site is a functional SNP.

[0038] In pCMV- FADS2 Based on the eukaryotic expression plasmid, a DNA fragment containing a total of 100 bp upstream and downstream of the SNP A>G site was inserted into pCMV- FADS2 plasmid FADS2 Downstream of the CDS zone, constructing a system containing FADS2 The fusion plasmid pCMV- contains CDS region and SNP allele fragments. FADS2 -A and pCMV- FADS2 -G ( Figure 2 ).go through Xho I and Not I. Enzyme digestion was performed on a 100 bp DNA fragment containing the A and G alleles of the mutation site. The results showed that the size of the digested fragment was consistent with the expectation. Figure 3 ).

[0039] The correctly digested plasmid was subjected to Sanger sequencing. Sequencing results showed that a 100bp DNA fragment, containing both the A and G alleles at the mutation site, had been inserted into the plasmid. FADS2 The presence of the CDS region stop codon indicates successful plasmid construction. Figure 4 ).

[0040] Two plasmids, pCMV-FADS2-A and pCMV-FADS2-G, with correct sequencing, were transfected into ICP2 cells, and proteins were extracted after 24 hours. Western blot analysis confirmed that both pCMV-FADS2-A and pCMV-FADS2-G plasmids expressed proteins, and their sizes were the same as those of the pCMV-FADS2 plasmid without the insertion of the two 100bp allele fragments. Figure 5 The results indicate that the insertion of 100bp DNA fragments upstream and downstream of the allele did not affect the size of the FADS2 protein. These results demonstrate the successful construction of the two plasmids, pCMV-FADS2-A and pCMV-FADS2-G.

[0041] (2) Transfection and differentiation induction. Immortalized chicken preadipocyte line 2 (ICP2) cells in good growth condition were seeded into 12-well plates. When the cells grew to 50%, they were transfected using KeygenMax 3000 transfection reagent. The induction medium containing 160 μM oleic acid was replaced 6 h after transfection (marked as differentiation 0 h). Fresh induction medium was then regularly replaced every 24 h to maintain the differentiation process.

[0042] (3) Oil Red O staining and extraction colorimetry

[0043] ① Taking a 12-well plate as an example, discard the cell culture medium, wash three times with PBS, add 500 μL of 4% paraformaldehyde to each well for 30 min; at this time, prepare the Oil Red O working solution, that is, mix Oil Red O stock solution and sterile water in a 3:2 ratio thoroughly, filter and use (prepare fresh for each use).

[0044] ② Discard the fixative, wash three times with PBS, and dry in a 65℃ oven;

[0045] ③ Add 500 μL of Oil Red O working solution to each well and stain in the dark for 15 min;

[0046] ④ Discard the Oil Red O working solution, wash 3 times with PBS, add 500 μL of 60% isopropanol to each well, and discard immediately;

[0047] ⑤ After washing twice with PBS, take pictures under an inverted microscope;

[0048] ⑥ Discard the PBS, add 500 μL of 100% isopropanol to each well, and shake on a horizontal shaker at room temperature for 15 min;

[0049] ⑦ Take isopropanol and measure the OD value (OD510) at 510 nm using an ELISA reader.

[0050] (4) Cell number correction Oil Red O extraction colorimetric results

[0051] Prior to Oil Red O extraction and colorimetric assay, the OD value (OD450) of each well was measured at 450 nm using a microplate reader with the Cell Counting Kit-8 (APExBIO) assay. The final result of the Oil Red O extraction and colorimetric assay is expressed as OD510 / OD450.

[0052] (5) Detection of luciferase activity

[0053] The detection procedure using the Beyotime Dual-Lumi™ II dual-luciferase reporter gene assay kit (RG089S) is as follows:

[0054] Sample pretreatment:

[0055] ① Discard the culture medium 48 h after transfection and wash the residual solution with PBS.

[0056] ② Add 100 μL of 1×PLB lysis buffer precisely to each well.

[0057] ③ Use an oscillator at 450 rpm and room temperature for 15 min.

[0058] ④ Transfer the lysate to a centrifuge tube, centrifuge at 4°C and 12,000 rpm for 10 min, and collect the supernatant.

[0059] Dual-luciferase assay:

[0060] ⑤ Firefly detection system: 10 μL LARII working solution + 20 μL supernatant, vortex mix and then detect Fluc activity value.

[0061] ⑥ Rluc assay system: Add 20 μL Stop&Glo to the above system, vortex mix, and then detect the Rluc activity value.

[0062] Data Analysis:

[0063] ⑦ Calculate relative activity: Rluc activity value / Fluc activity value.

[0064] (6) Protein immunoblotting

[0065] Total cell protein extraction:

[0066] ① Taking a 12-well plate as an example. After aspirating the cell culture medium, wash the cells three times with PBS. Add 100 μL of a mixed digestion solution of 0.25% trypsin and 0.04% EDTA to each well. Digest the cells at room temperature for 1 min, and then add a small amount of basal culture medium to stop the digestion.

[0067] ② Collect the digested cells into a 1.5 mL EP tube, centrifuge at 4500 rpm for 10 min, discard the supernatant, add 80 μL of RIPA protein lysis buffer (containing 1% PMSF), mix well, place on ice for lysis for 30 min, and store at -80 ℃ for later use.

[0068] Western Blot:

[0069] ① Gel preparation: Prepare a 10% separating gel using the YARN gel preparation kit.

[0070] ② Electrophoresis: Add an appropriate amount of electrophoresis buffer to the electrophoresis tank. Add 80 μg of protein sample or 5 μL of protein marker to each well. Set the electrophoresis conditions to a constant voltage of 90 V for 30 min. Then adjust the voltage to 120 V and continue electrophoresis for 60 min.

[0071] ③ Transfer: After electrophoresis, accurately measure the region of the target protein on the gel. Cut an NC membrane to match the size of the target protein gel region based on the measurement dimensions. Immerse the filter paper, NC membrane, and sponge in transfer buffer. Stack the layers in the following order: sponge, filter paper, gel, NC membrane, filter paper, sponge, ensuring no air bubbles between each layer. Place the assembled transfer clamp into the transfer tank, add 1 L of 1× transfer buffer, and add ice to maintain a low temperature. Set the transfer conditions to 200 mA, constant current, and transfer for 1 h.

[0072] ④ Blocking: After transfer, wash the NC membrane three times with PBST, 5 min each time. Block the NC membrane in 5% skim milk powder at room temperature for 2 h. After blocking, wash the NC membrane again three times with PBST, 5 min each time.

[0073] ⑤ Primary antibody incubation: Place the NC membrane in a primary antibody solution diluted 1:1000 and incubate overnight at 4°C.

[0074] ⑥ Secondary antibody incubation: After removing the primary antibody, place the NC membrane on a shaker and wash it four times with PBST for 5 min each time. Dilute the HRP-labeled secondary antibody to a ratio of 1:5000 using 5% skim milk powder. Place the NC membrane in the diluted secondary antibody and incubate at room temperature for 1 h.

[0075] ⑦ Exposure and color development: After removing the secondary antibody, place the NC membrane on a shaker and wash it four times with PBST for 5 minutes each time. Prepare the working solution for the ultrasensitive ECL chemiluminescence solution (mix solution A and solution B in a 1:1 ratio). Evenly cover the NC membrane with the working solution and incubate for 1 minute. Place the NC membrane into a gel imaging system for photographic recording.

[0076] (7) Primer design software: Primer Premier 5. Basic primer design parameters:

[0077] ① Primer length 18~30 bp;

[0078] ②Tm value 55~65℃, annealing temperature around 60℃;

[0079] ③GC content 40~70%;

[0080] ④ Pay special attention to avoiding the presence of primer dimers and nonspecific amplification;

[0081] ⑤ Avoid four consecutive bases, especially G and C. Do not have more than three Gs or Cs in the last five bases at the 3' end.

[0082] ⑥The primer sequences are as follows:

[0083] FADS2-F:GCTGGGAGAAACATAGGAAGG (SEQ ID NO.5);

[0084] FADS2-R:ACAATTCCTAGGGAACACTTG (SEQ ID NO.6);

[0085] (8) The PCR reaction system is shown in Table 1:

[0086] Table 1

[0087]

[0088] (9) PCR reaction conditions are shown in Table 2:

[0089] Table 2

[0090]

[0091] PCR product size: 298bp.

[0092] (10) Electrophoresis detection:

[0093] Take 5 μl of the PCR product and prepare a 1% agarose gel for electrophoresis. Electrophoresis parameters: 150 V, 100 mA, 10–20 min; observe the electrophoretic bands using a gel imaging system. Results are as follows. Figure 7 As shown.

[0094] (11) Sequencing:

[0095] ① Purification and recovery of PCR products

[0096] The purpose of this study was to extract and recover PCR bands using gel cutting, following the method described in the SanPrep DNA Gel Extraction Kit (Sangon Biotech B518131).

[0097] ② Data Analysis

[0098] Search for results in the result group and analyze them using sequence analysis software to confirm the genotype.

[0099] To verify FADS2 Effect of gene 5:16345061 A>G site on chicken preadipocyte differentiation, pCMV- FADS2 -A and pCMV- FADS2 -G plasmids were transfected into ICP2 cells, and ICP2 cells transfected with pCMV-HA plasmid were used as the control group. Oleic acid was added to induce cell differentiation 6 h after transfection, and this time was defined as 0 h of differentiation. Then, the changes in lipid deposition in cells 24 h and 48 h of differentiation were detected by Oil Red O staining and Oil Red O extraction colorimetric method.

[0100] Oil Red O staining results showed that during the differentiation of chicken preadipocytes, pCMV- FADS2 Compared with the control group, group A overexpressed pCMV- FADS2 -Lipid droplet deposition was significantly increased in group G. Figure 6 a). Meanwhile, the results of the Oil Red O extraction colorimetric assay showed that, within 0-48 hours, regardless of pCMV- FADS2 -Group A or pCMV- FADS2 -G group lipid content continuously increased, indicating normal cell differentiation ( Figure 6b) Overexpression of pCMV- at 24 h of differentiation FADS2 - The lipid content in group G cells was significantly higher than that in pCMV- FADS2 -Group A (P<0.05, Figure 6 c) Overexpression of pCMV- at 48 h of differentiation FADS2 The lipid content in group G cells was significantly higher than that of cells overexpressing pCMV. FADS2 -Group A cells and control group ( P <0.01, Figure 6 d). Explanation FADS2 The G allele at the A>G locus promotes the differentiation of chicken preadipocytes, while the A allele has no effect on the differentiation of chicken preadipocytes.

[0101] Example 2. Method for identifying broiler chickens with high abdominal fat percentage

[0102] Step 1: Extract genomic DNA from the wing vein blood of broilers;

[0103] Step 2: Using the DNA obtained in Step 1 as a template, perform a PCR reaction using the primer combination shown in SEQ ID NO.3 and SEQ ID NO.4;

[0104] Step 3: Genotyping the PCR product obtained in Step 2; if it is the GG genotype, it indicates a broiler chicken with high abdominal fat percentage (containing the gene described in SEQ ID NO. 2). This is consistent with the abdominal fat percentage of the broiler chicken sample.

[0105] In the 19th, 23rd, and 27th generations of broiler chickens with high and low abdominal fat selected by Northeast Agricultural University, the G allele was only present in the high-fat line (Table 3).

[0106] Table 3

[0107]

[0108] The specific embodiments of the present invention disclosed above are merely illustrative of the invention. These embodiments do not exhaustively describe all details, nor do they limit the invention to the specific embodiments described. Many modifications and variations can be made based on the content of this specification. This specification selects and specifically describes these embodiments to better explain the principles and practical applications of the invention, thereby enabling those skilled in the art to better understand and utilize the invention.

Claims

1. A method for identifying broiler chickens with high abdominal fat percentage, characterized in that, The steps of the method are as follows: Step 1: Extract DNA from broiler chickens; Step 2: Using the DNA obtained in Step 1 as a template, perform a PCR reaction using the primer combination for amplifying SNP markers. The nucleic acid sequence of the SNP marker is shown in SEQ ID NO.1 or SEQ ID NO.2, with the 51st position being the SNP site, which is either A or G. Step 3: Perform SNP genotyping on the PCR products obtained in Step 2; if it is the GG genotype, it is a broiler chicken with a high abdominal fat percentage.

2. A method for promoting the differentiation of chicken preadipocytes, characterized in that, A recombinant vector containing an SNP marker that promotes chicken preadipocyte differentiation was transfected into an immortalized chicken preadipocyte line 2. The nucleic acid sequence of the SNP marker that promotes chicken preadipocyte differentiation is shown in SEQ ID NO.2, with G at position 51.

3. The method according to claim 2, characterized in that, Promoting differentiation resulted in increased lipid content in the immortalized chicken preadipocyte line 2 and enhanced lipid droplet deposition in the immortalized chicken preadipocyte line 2.

4. The application of a SNP marker that promotes the differentiation of chicken preadipocytes, or a recombinant vector containing a SNP marker that promotes the differentiation of chicken preadipocytes, in promoting the differentiation of chicken preadipocytes or identifying genetic breeding related to high abdominal fat percentage in broilers, characterized in that... The nucleic acid sequence of the SNP marker that promotes the differentiation of chicken preadipocytes is shown in SEQ ID NO.2, with G at position 51.

5. The application according to claim 4, characterized in that, The chicken preadipocytes are immortalized chicken preadipocyte line 2.

Images