InDel marker for rice brown glume character, regulatory gene and application of InDel marker and regulatory gene

Abstract

The invention belongs to the field of crop heredity, and relates to application of a polyphenol oxidase gene. The invention discloses an InDel marker for rice brown glume traits, a regulatory gene and application of the InDel marker and the regulatory gene. Based on a brown glume mutant material in the background of Hunan early indica 42, genetic analysis shows that the mutation is dominant mutation, single-gene control and gene positioning find that the mutant gene is a polyphenol oxidase encoding gene (MSULocus is LOCOs04g53300), and the exon region of the mutant gene is deleted by 6bp (GCGACT), so that the material shows brown glume; the gene is knocked out from a brown glume mutant, and the glume color becomes normal; the method has the advantages that the GCGACTs are used as the raw materials, the GCGACTs are accurately edited in the wild type materials, the corresponding 6bp deletion (GCGACT) materials are obtained, the glumes of the GCGACTs are brown, and new gene resources and methods are provided for quickly and directionally cultivating novel rice materials and rice materials suitable for mechanized seed production of hybrid rice.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of crop genetics and relates to the use of polyphenol oxidase genes. BACKGROUND

[0002] The seed production of hybrid rice still mainly adopts technical measures such as artificial seeding, transplanting, powder chasing, harvesting, etc., with high production cost, high labor intensity and low efficiency (Wang Jie et al., Anhui Agricultural Sciences, 2013, 41:5682-5683+5686; Xia Yu-mei et al., Hybrid Rice, 2020, 35:1-5). Among them, the use of mechanical mixed seeding of parent lines is an effective way to realize the full mechanization of hybrid rice seed production and thus improve the seed production efficiency (Xia Yu-mei et al., Hybrid Rice, 2020, 35:1-5). Based on the hybrid rice parent line mixed seeding, the parent lines are required to have consistent or similar growth periods and to be mixed seeded in appropriate proportions. On this basis, different technical means are still needed to separate the hybrid seeds and the selfed seeds of the restorer line at the time of harvesting, or to remove the male parent to only produce hybrid seeds, so as to realize the full mechanization (Tang Wen-bang et al., China Rice Science, 2020, 34:95-103). By using the differences between the seeds of the male parent and the female parent, physical means are used to separate the hybrid seeds and the selfed seeds after mixed harvesting (Tang Wen-bang et al., China Rice Science, 2020, 34:95-103), such as selecting parent lines with different chaff colors and separating them by a microcomputer color sorter (Xu Ke et al., Hybrid Rice, 2018, 33(04):17-21).

[0003] The color of rice cultivars is often shown on the outer glume, inner glume, protective glume, palea, stigma, seed coat, awn, leaf sheath, leaf blade and internode traits. Studies have shown that the main substance causing color change in rice is flavonoids (Xu Xia et al., China Rice Science, 2015, 29:335-342). The glume color is a marker that can be recognized after the rice panicles emerge, and the trait is relatively stable and less affected by the environment (He Libin et al., Journal of Zhejiang Agricultural Sciences, 2001, 13:357-360). The inheritance of rice color genes is complex, with some being controlled by a single gene and others being controlled by 2-3 pairs of interacting genes. Compared with the conventional yellow glume color of cultivated rice, the abnormal glume colors mainly include golden yellow, black and brown (Li Hui et al., Biological Resources, 2021, 43:427-434). gh-1, gh-2, gh-3, gh-4, gh-5 gh-6 ibfl bh6 bh1 fb1 M47286 ​​​​​​et al., Bioresource, 2021, 43: 427-434), while black glume is one of the traits of common wild rice (Zhu et al., Plant physiol., 2011, 155: 1301-1311). Among them, gh-1 and gh-2 respectively because of flavonoid pigment regulatory gene OsCHI and cinnamyl alcohol dehydrogenase gene mutation in lignin synthesis pathway, which leads to golden yellow glume and internode of rice (Hong et al., Planta, 2012, 236: 141-151; Zhang et al., Plant physiol., 2006, 140: 972-983), brown chaff inhibitor IBF1 can regulate the synthesis and deposition of chaff pigment, and can inhibit BF , the latter may be regulated by OsKF1 (Xu Xia et al., Chinese rice science, 2015, 29: 335-342), OsBh4 encodes an amino acid transporter protein involved in regulating the formation of black glume phenotype of rice (Zhu et al., Plant physiol., 2011, 155: 1301-1311).

[0004] Therefore, the genetic regulation mechanism of rice glume color is relatively complex, and it is still unclear at present, and more related genes need to be cloned to further explore, so as to provide favorable resources for breeding suitable scale seed production hybrid rice parents. SUMMARY

[0005] The present application provides an InDel marker, regulatory gene and application of brown glume trait of rice, and provides a new idea for changing the color of rice glume.

[0006] The technical scheme of the present application is as follows: The present application is based on the brown glume mutant material of Xiangzaoxian 42 background, and genetic analysis shows that the phenotype is caused by single gene dominant mutation, and gene mapping shows that the mutation site is located in the exon region of a polyphenol oxidase encoding gene (MSU_Locus is LOC_Os04g53300), and the region lacks 6 bp (GCGACT), so that the material shows brown glume; knock out the gene in the brown glume mutant material, the glume color changes to normal; in the wild type material of Xiangzaoxian 42, the corresponding 6 bp (GCGACT) deletion material is obtained, and its glume shows brown.

[0007] In one aspect, an InDel marker of a brown glume trait of rice is provided, wherein the InDel marker is an acquired molecular marker, and the nucleotide sequence of the InDel marker is GCGACT, and the InDel marker is located between 31751341-31751346 bases (base position refers to the published Oryza sativa ssp japonica cv. Nipponbare genome).

[0008] In another aspect, a gene with the InDel marker deleted is provided, and the sequence obtained after the InDel marker is deleted from the gene with the gene number of LOC_Os04g53300, and the nucleotide sequence of the InDel marker deleted from Xiangzaoxian No. 42 is shown in SEQ ID No. 1.

[0009] In a second aspect, the InDel marker or the gene is used for changing the color of the glume of rice.

[0010] The steps of the above application are selected from any one of the following: ① using gene editing technology to construct a rice material with the InDel marker deleted from the LOC_Os04g53300 gene of rice; ② constructing a rice material containing the gene with the InDel marker deleted sequence; ③ using gene editing technology to knock out the rice material containing the LOC_Os04g53300 gene with the InDel marker deleted sequence.

[0011] In a third aspect, a method for preparing a brown glume rice material is provided, and the steps are as follows: (1) designing a template sequence and a primer pair according to the InDel marker and the gene, and constructing a gene precise editing vector; (2) using the precise editing vector of step (1), taking a normal color glume rice to be improved as a background, and preparing a brown glume rice material with the InDel marker deleted.

[0012] Further, the template sequence in step (1) is shown in SEQ ID No. 2, and the primer pair sequence in step (1) is shown in SEQ ID No. 3 and SEQ ID No. 4.

[0013] The application of the brown glume mutant prepared by the above method is selected from any one of the following: ① germplasm innovation; ② breeding of hybrid rice parents.

[0014] The present application has the following beneficial effects: The application obtains a new function of a polyphenol oxidase coding gene (MSU_Locus is LOC_Os04g53300), and specific site deletion of 6bp (GCGACT) in the exon sequence can cause brown glume of rice; the glume color changes to normal by knocking out the gene in the brown glume mutant material. Compared with the prior art, the method involved in the application has great innovation, the InDel marker with deletion of 6bp (GCGACT) is firstly found to be associated with the brown glume trait, and the polyphenol oxidase coding gene (MSU_Locus is LOC_Os04g53300) located in the InDel marker controls the glume color generation; meanwhile, the application creates a method for quickly and directly obtaining brown glume, that is, precisely editing the polyphenol oxidase coding gene to obtain the material with deletion of 6bp at the corresponding sequence site, and the glume of the material shows brown color, which provides an efficient and feasible method for creating materials suitable for mechanical seed production of hybrid rice. BRIEF DESCRIPTION OF DRAWINGS

[0015] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or the prior art description will be briefly introduced. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0016] Figure 1 The glume phenotype of the brown glume mutant.

[0017] Figure 2 The phenotype analysis of backcross F1 and F2.

[0018] Figure 3 The gene positioning interval analysis.

[0019] Figure 4 The alignment diagram of the mutation site and the sequence near the mutation site of the hcm mutant and the reference gene sequence of Nipponbare.

[0020] Figure 5 The alignment diagram of the corresponding amplified sequence of Xiangzaoxian No. 42 and the reference gene sequence of Nipponbare.

[0021] Figure 6 The knockout vector structure diagram of knocking out the polyphenol oxidase gene in the brown glume mutant material.

[0022] Figure 7 The sequence and phenotype analysis of the polyphenol oxidase gene knockout material of the brown glume mutant material.

[0023] Figure 8 The vector structure diagram of the precise editing of Xiangzaoxian No. 42.

[0024] Figure 9 Phenotype of the hull of Xiangzaoxian 42 precise editing materials and controls, wherein C27, C28, C29 and C30 are the precise editing strains.

[0025] Figure 10 Sequencing results of PCR amplification sequences of Xiangzaoxian 42 precise editing materials C28, C29 and C30 and alignment results of the sequences of wild type Xiangzaoxian 42 and hcm mutant.

[0026] Figure 11 Results of online analysis of the sequencing peak chart of the PCR amplification sequence of Xiangzaoxian 42 precise editing material C27 on the website (http: / / skl.scau.edu.cn / dsdecode / ). DETAILED DESCRIPTION

[0027] The technical solutions of the present application will be described below in conjunction with the embodiments of the present application, and obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor fall within the scope of protection of the present application.

[0028] The experimental methods used in the following experimental examples are conventional methods unless otherwise specified; the materials, reagents, etc. used are reagents and materials available from commercial channels unless otherwise specified.

[0029] Example 1: Radiation mutagenesis of Xiangzaoxian 42 to obtain brown hull mutant material and mutant gene In the radiation mutagenesis mutant library of Xiangzaoxian 42 as the parent, normal planting, conventional water and fertilizer management were carried out, and a mutant with brown hull color was found hcm (hull color mutant), which was stably expressed after multiple generations of selfing, and was named Shihexi No. 1. The rice seed hcm was deposited in the China Center for Type Culture Collection (China, Wuhan) on July 15, 2025, and was classified and named as Oryza sativa hcm, with the deposit number CCTCC NO: P202521 and the deposit address being Wuhan University, Wuhan, China. The hull color of the mutant showed brown, which was obviously different from the yellow hull of the control Figure 1 ).

[0030] hcm were used as the female parent and the male parent, respectively, and were backcrossed with wild type Xiangzaoxian 42 using conventional hybridization methods. After harvesting the seeds, normal planting and planting were continued, and conventional water and fertilizer management was carried out. The hull color of the BC1F1 plants was investigated at the harvest period, and the results showed that hcm ​The BC1F1 plants of the mutant as female or male parent have brown seeds hcm The mutant is consistent with the parent, and the seed color is brown Figure 2 , indicating that this color trait is controlled by a dominant gene, i.e. hcm The mutation is a dominant mutation.

[0031] The BC1F2 seeds were harvested and planted in the base of the Rice Institute of Hunan Agricultural University. The observation of the hull traits of the BC1F2 population showed that the hull color of the BC1F2 plants was obviously separated. If the phenotype is controlled by a dominant gene, the number of hulls showing brown color in the population should be about 3 times that of normal hull color. Statistical analysis of the phenotype showed that the chi-square test results of 9 independent experiments were all greater than 0.05 p Figure 2 ), indicating that the experimental data conforms to the segregation ratio of 3:1. This further indicates that the phenotype of the mutant is controlled by a dominant single gene locus.

[0032] ZH11 and hcm were crossed and selfed to obtain the F2 population, which was planted in the garden base of Hunan Agricultural University. During the grain filling period, the leaves of plants showing brown (poo11) and normal yellow (pool2) were selected according to the hull color, and mixed in equal amounts; the leaves of the parent ZH11 and hcm mutant were used as references. Wuhan Shuanglu Green Source Research Institute Co., Ltd. was entrusted to use GSR40K (Patent name: Rice Green Gene Chip and Application; Application No. 2018800836058) for difference analysis and comparison between samples.

[0033] ​DNA was extracted from leaf samples using conventional methods. DNA concentration was measured using a UV spectrophotometer, and DNA meeting quality requirements (concentration above 50 ng / μL, 260 / 280 between 18 and 2.0) was uniformly diluted to a concentration of 50-100 ng / μL. The DNA template was first denatured into single strands using NaOH, neutralized, and then reacted with whole-genome amplification reagent at 37°C for 20-24 hours. The amplified whole-genome DNA was then broken down into small fragments and reacted at 37°C for 1 hour. The fragmented DNA was then mixed thoroughly with isopropanol and other reagents, incubated at 4°C for 30 minutes, and then centrifuged at 3000g for 20 minutes. After discarding the supernatant, the DNA was dried at room temperature for 1 hour; a solvent (containing 10%-30% formamide) was added to dissolve the DNA, and the mixture was incubated at 48°C for 1 hour; the resuspended DNA was then placed in a dry bath at 95°C for 20 minutes; the cooled DNA was spotted onto the corresponding positions on the chip, and the mixture was incubated in a hybridization oven at 48°C for 16-24 hours; after hybridization, the chip underwent single-base extension, with fluorescent signals on the bases, thus increasing the intensity of the fluorescence signal for easy scanning; the chip was scanned using an iScan scanner; the raw data generated by the scan was analyzed and genotyped using Genome Studio software. Based on the Nipponbare Genome 6th Edition, the framework of each chromosome was constructed, and the relationship between specific loci of the offspring and parental genotypes was compared.

[0034] like Figure 3 As shown, the obvious differential regions between pool 11 and pool 2 are located on chromosomes 4, 6, and 12. Considering that pool 2 has the same phenotype as ZH11 (i.e., the genotype of the trait-related region in pool 2 is the same as that in ZH11, shown in red), and that this gene is a dominant mutation, meaning the heterozygous genotype in F2 is brown husk, the differential regions on chromosomes 6 and 12 are excluded. Therefore, it is inferred that the trait-related region is located within the 1.7MB region of Chr04, ranging from 30.9 to 32.6MB. Figure 3 The area indicated by the red arrow.

[0035] Furthermore, utilizing hcmBC1F2 population constructed with wild type Xiangzaoxian 42, combined with BSA (bulk segregant analysis) trait positioning based on genome resequencing, analysis was carried out. Gene resequencing was entrusted to Huada Gene, and the data volume of parents was 12 Gb, and two mixed pools were measured 20 Gb. Based on the resequencing data, the splicing and comparison analysis was carried out by entrusting Chengdu Baisbailer Biotechnology Co., Ltd. with MH63 genome (http: / / rice.hzau.edu.cn / cgi-bin / gb2 / gbrowse / MH63RS2 / ) as reference, and it was found that there was only one candidate gene (MSU_Locus was LOC_Os04g53300) associated with phenotype in the 1.7 MB interval of Chr04, which implied that the gene was very likely to be hcm the gene of brown glume mutation. The gene encodes a polyphenol oxidase, and in the mutant, the exon region of the gene is deleted by 6 bases (GCGACT). hcm

[0036] Using primers: PO-BamH1F3: CCGCACGGGATCCACCGCGA; PO-Sac1R3: tagcGAGCTCCGTATGTGACATGCAGGAAGC.

[0037] The leaf DNA of Xiangzaoxian 42 and hcm was used as a template for PCR, respectively, to amplify a 637 bp sequence containing the mutation site, and after sequencing, it was compared with the Nipponbare reference genome sequence (https: / / rapdb.dna.affrc.go.jp / tools / blast) to determine hcm that the corresponding 6 bp sequence (GCGACT, the sequence shown by the red box) in the wild type was missing, Figure 4 the position of the missing sequence is 31751341-31751346 bases of chromosome 4 of Nipponbare genome ( Figure 4 and Figure 5 ), since the base before GCGACT is T, so the missing sequence can also be interpreted as TGCGAC, which corresponds to 31751340-31751345 bases of chromosome 4 of Nipponbare genome ( Figure 4 and Figure 5 ). Subsequently, 5 pairs of primers were synthesized according to the Nipponbare reference gene sequence: POHind3F1: ATCCCAAGCTTCCGATATGATCAACGACGTTCGCTC; PO-Pst1R1: GGTCGACCCTGCAGGACACG;​ PO-Section2F1:CGCCATGGAGAGCATCAACGTA; PO-Section2R1: CATGGGAAGAAGAGCCAGCA; PO-Section2F2: GCCGTTGCGCTCATGAAGAA; PO-Section2R2:CCCAGTATCCTCTCATGGAAGTAC; PO-Section2F3:GAGTGGCTCATGAGATTCTGTG; PO-Section2R3:AAGAAGAAGCTGGCGTCGAG; 2F4-4: CAACCCCGTCCACAGATGGA; 2R4-4: GCCGATGTCGTCCAGCAAGT.

[0038] Xiangzaoxian No. 42 and hcm Using mutant leaf DNA as templates, the gene nucleotide sequence containing exons, introns, UTRs, and part of the promoter sequence was obtained from Xiangzaoxian 42 and hcm mutants after amplification, sequencing, and splicing. hcm Except for the deletion of 6 bp (GCGACT), the mutant sequence is no different from that of Xiangzaoxian 42. The nucleotide sequence of the gene LOC_Os04g53300 in Xiangzaoxian 42 that lacks the InDel marker is shown in SEQ ID No. 1.

[0039] Example 2: Knocking out this gene in brown husk mutant material resulted in normal husk color. Given hcm The mutant is a dominant mutation in a single gene; this invention knocks out the mutant. hcm Candidate genes in the mutant were identified to determine whether the husk had returned to normal.

[0040] In March 2022, with hcmThe mutant is backgrounded by using CRISPR-Cas9 gene editing technology, and double target sites are designed for knockout. The knockout target sites are T1: GCGAAGGGTACTCTGGAGGT and T2: GCTCTTGCACCGCAAGACGA. The design of gene knockout, vector construction and genetic transformation of rice are entrusted to Wuhan Boyuan Biotechnology Co., Ltd., and the reference literature method (Xing et al. BMC Plant Biology 2014, 14:327) is used for reference. The vector map is shown in Figure 6 .

[0041] The specific construction steps are as follows: 1. The following template sequence and amplification primer are synthesized by conventional chemical synthesis method Template: Gcgaagggtactctggaggtgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcagctcttgcaccgcaagacga; Primer: 40166_0(+): cagtGGTCTCatgcagcgaagggtactctggaggtg; 40166_0(-): cagtGGTCTCaaaactcgtcttgcggtgcaagagctgc.

[0042] 2. One 50 μL system is made and the amplification reaction is carried out according to the following procedure: PCR system and procedure Component Volume Nuclease-free Water 20 μL Biorun Pfu PCR Mix 25 μL 40166_0(+) (100uM) 2 μL 40166_0(-) (100uM) 2 μL Template 1 μL Total volume 50 μL PCR procedure Step Cycle number 94℃ for 5 min 1 94°C for 30 sec 30 50°C for 45 sec 30 72°C for 12 sec 30 72°C for 10 min 1 16°C for 30 min 1 T1-T2 (193bp) were cut out under UV light and placed in a system for gel recovery. The recovery procedure is described in the reagent kit instructions. The recovered DNA was dissolved in a total volume of 30 μL water (recovered product labeled rDNAt1). After testing, the product was ligated with a vector.

[0043] 3. Enzymatic cleavage and ligation Enzymatic cleavage and ligation system and reaction conditions Volume Nuclease-free Water 8 μL 10* Buffer 2 μL BsaI / Eco31I 1 μL T4 ligase 1 μL Plasmid vector 4 μL rDNAt1 4 μL Total 20 μL Reaction conditions: Step Cycle 37°C for 20 min 1 37°C for 10 min 5 20°C for 10 min 5 37°C for 20 min 1 80°C for 5 min 1 4. Transformation 5 μL of the ligation product was used to transform E. coli competent cells using conventional methods. The transformed cells were plated on kanamycin-resistant plates and incubated at 37°C for 12 hours.

[0044] 5. Sequencing to identify positive clones, extraction of plasmids, transformation of Agrobacterium EHA105, and transformation of mutants using Agrobacterium-mediated callus transformation hcm

[0045] ​After the test tube seedlings grow stably, the obtained transgenic lines are subjected to target fragment amplification and sequencing identification, and effective knockout mutant materials are screened and obtained. Use TGFastTM Plant Genomic Rapid Extraction Kit (Catalog No: TM0301) to perform operation according to the instruction steps. Design specific PCR amplification primers for the position of the target site of the CRISPR material: PO-Section2F1: CGCCATGGAGAGCATCAACGTA; PO-Section2R1: CATGGGAAGAAGAGCCAGCA; Genotype detection of mutants. Using the extracted DNA as a template, the gene fragment is amplified by PCR using the aforementioned primers, and after sequencing, the sequence of the amplified fragment is aligned to screen for mutant plants with non-3 integer multiple deletions or increases at the target site of the gene (CrPO-1 and CrPO-2). Continue to plant and manage with regular water and fertilizer until the harvest period. Observe the pod color of the knockout material, which returns to normal yellow Figure 7 ) color.

[0046] Example 3: Precise editing in wild-type material to obtain 6bp deletion material with brown pod In November 2023, Xiangzao Xian No. 42 was used as the background to perform precise editing of the HCM gene using gene precise editing technology (Lin et al., Nature Biotechnology, 2021, 39: 923-927). Gene precise editing design, vector construction, and plant genetic transformation were commissioned to Wuhan Boyuan Biotechnology Co., Ltd. The precise editing vector is shown in Figure 8 The vector construction process is as follows: The following template sequence and amplification primers were synthesized by conventional chemical synthesis method Template (SEQ ID No. 2): aggaagacggaggcgaggttgtttcagagctatgctggaaacagcatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctccagcaatatgccgaacctcgcctccgtcaaataagcttgacgcggttctatctagttacgcgttaaaccaactagaaaaacaaagcaccagtggtctagtggtagaatagtaccctgccacggtacagacccgggttcgattcccggctggtgcacggcgccagcgcgacgctgcgtttcagagctatgctggaaacagcatagcaagttgaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc Primer: D15738_0C1 (+): cagtCGTCTCatgcaaggaagacggaggcgaggttg (SEQ ID No. 3); D15738_0C1 (-): cagtCGTCTCatcaagcaccgactcggtgccac (SEQ ID No. 4).

[0047] 2. Do a 50 μL system and follow the procedure below to perform the amplification reaction: PCR system and procedure Component Volume Nuclease-free Water 20 μL Biorun Pfu PCR Mix 25 μL D15738_0C1 (+) (100 uM) 2 μL D15738_0C1 (-) (100 uM) 2 μL Template 1 μL Total volume 50 μL PCR procedure Step Cycle number 94℃ for 5 min 1 94℃ for 30 sec 30 50℃ for 45 sec 30 72℃ for 22 sec 30 72°C for 10 min 16°C for 30 min T1-T2 (369bp) was cut out under UV light and put into a system for gel recovery. The recovery procedure is described in the reagent kit manual. The recovered DNA was dissolved in 30 μL of water (the recovered product is marked as rDNA T1). After testing, the product was connected with a vector.

[0048] 3. Vector enzyme digestion Enzyme digestion connection system Component Volume Nuclease-free Water 13 μL 10* Buffer 2 μL BsaI / Eco31I 1 μL Plasmid vector 4 μL Total 20 μL Reaction condition: 37°C enzyme digestion 1 hours 4. rDNA T1 enzyme digestion Enzyme digestion connection system and reaction condition Component Volume Nuclease-free Water 13 μL 10* Buffer 2 μL BsmBI / Esp3I 1 μL rDNA T1 4 μL Total 20 μL Reaction condition: 37°C 1 hours The vector enzyme digestion and the recovered fragment enzyme digestion product were combined and purified by a PCR purification kit (the purified product is marked as P-rDNA T1) for the next step of connection reaction 5. Connection reaction Reaction system Component Volume Nuclease-free Water 5.5 μL 10* Buffer 1 μL T4_ligase 1 μL P-rDNA T1 2.5 μL Total 10 μL Reaction condition: 20°C 1 hours 6. Transformation 5 μL of the ligation product was used to transform E. coli competent cells using a conventional method 7. The positive clones were identified by sequencing, the plasmid was extracted and transformed into Agrobacterium EHA105, and Xiangzao Xian No. 42 was transformed by using Agrobacterium-mediated callus transformation method to obtain positive lines.

[0049] The four mutant lines (C27, C28, C29, and C30) provided by the company were planted in Changsha in 2024, and the conventional water and fertilizer management was carried out, and at the harvest period, the hulls of the four lines were all brown (Fig. 1). Figure 9 After extracting DNA from the leaves at the harvest period, the primers J78458-F2 (6bp): cgtcatcgaggggatcgag and J78458-380R2 (6bp): cacaaatccgtctctccatctg were used for amplification and sequencing, and compared with the wild type Xiangzao Xian No. 42 and hcm mutant sequence, it was found that three materials (C28, C29, C30) had 6 bp homozygous deletion at this gene site, and the deletion sequence was consistent with the hcm mutant deletion sequence (Fig. 2). Figure 10 Another line C27 was decoded using the default parameters on the website (http: / / skl.scau.edu.cn / dsdecode / ), and it was found to be a heterozygous 6 bp deletion (Fig. 3). Figure 11 The above successfully realized the directional rapid and accurate editing of the gene (MSU_Locus is LOC_Os04g53300) sequence in the wild type material, and obtained the material corresponding to 6 bp deletion (GCGACT), and the hull showed brown. This application example provides a basis for subsequent use of the gene sequence to modify the hull traits of the restorer line material, so as to realize the mechanized seed production based on mixed planting and mixed harvesting.

[0050] The above only describes the preferred embodiments of the present application and does not limit the present application, and any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. An InDel marker for the brown glume trait in rice, characterized in that: The nucleotide sequence of the InDel marker is GCGACT, which is located between the sequences of 31751341-31751346 bases on the 4th chromosome of rice.

2. The gene of claim 1, wherein the InDel marker is deleted, characterized in that: The gene is rice LOC_Os04g53300 gene.

3. Use of the InDel marker of claim 1 or the gene of claim 2 in changing the glume color of rice.

4. Use according to claim 3, characterized in that, The steps of the use are selected from any one of the following: ① using gene editing technology to construct a rice material in which the InDel marker of claim 1 is deleted in the LOC_Os04g53300 gene of rice; ② using gene editing technology to knock out a rice material containing the LOC_Os04g53300 gene with the InDel marker sequence deleted.

5. Use of the InDel marker of claim 1 or the gene of claim 2 in preparing brown glume material.

6. Use according to claim 5, characterized in that, The steps of the use are selected from any one of the following: ① using gene editing technology to construct a rice material in which the InDel marker of claim 1 is deleted in the LOC_Os04g53300 gene of rice; ② constructing a rice material containing the gene containing the InDel marker sequence of claim 2.

7. A method of making a brown husked rice material, characterized by, The steps are as follows: (1) designing a template sequence and a primer pair according to the InDel marker of claim 1 and the gene of claim 2, and constructing a precise editing vector; (2) using the precise editing vector of step (1) to prepare a precise editing plant in which the InDel marker of claim 1 is deleted, i.e. a brown glume rice material, taking a normal color glume rice as background.

8. The method of producing a brown husked rice material according to claim 7, wherein: The template sequence in step (1) is shown in SEQ ID No.

2.

9. The method of producing a brown husked rice material of claim 7, wherein: The primer pair sequence in step (1) is shown in SEQ ID No. 3 and SEQ ID No.

4.

10. Use of brown husked Oryza sativa material produced by the method according to any one of claims 7 to 9, characterized in that, The use is the cultivation of germplasm innovation or hybrid rice parents.

Images