Method for preparing bionic calculus bovis from engineering bacteria, bionic calculus bovis and application of bionic calculus bovis

Abstract

The invention relates to a method for preparing bionic calculus bovis from engineering bacteria, the bionic calculus bovis and application of the bionic calculus bovis, and belongs to the technical field of traditional Chinese medicine raw material preparation. According to the method, natural oxgall is used as a fermentation substrate, a fermentation reaction system is used for preparing the bionic calculus bovis, and the fermentation reaction system uses synthetase high-expression engineering bacteria as a fermentation strain for direct in-vitro fermentation; the preparation method of the synthase high-expression engineering bacterium comprises the following steps: constructing an overexpression plasmid, introducing the plasmid into a vector to construct an engineering strain, and carrying out expanding culture to obtain the synthase high-expression engineering bacterium. The bionic calculus bovis prepared by the method is highly consistent with natural calculus bovis in component, the content of cholic acid (CA) is 8.5%-20.0%, the content of deoxycholic acid (DCA) is 2.0%-6.5%, the fingerprint similarity is greater than or equal to 88.0%, and pharmacological experiments show that the bionic calculus bovis prepared by the method has the same acting effect as the natural calculus bovis and is superior to that of each pair of calculus bovis.

Description

TECHNICAL FIELD

[0001] The present application belongs to the technical field of traditional Chinese medicine raw material preparation, and particularly relates to a method for preparing biomimetic bovine calculus with an engineered bacterium, biomimetic bovine calculus and application thereof. BACKGROUND

[0002] Bovine calculus (Bovis Calculus) is a dry gallstone of Bos taurus domesticus Gmelin, and is one of the most valuable traditional Chinese medicines. It is recorded in Shennong's Herbal Classic that "Bovine calculus is the essence of all herbs, and is the best medicine in the world, which cannot be replaced by other medicines", and is praised as "the treasure of medicines". As a traditional Chinese precious medicinal material, bovine calculus is widely used in clinical practice of traditional Chinese medicine and has a large demand. There are more than 90 kinds of Chinese patent medicines using bovine calculus in Chinese Pharmacopoeia. Since the probability of natural bovine calculus is extremely low, the resource is increasingly scarce. Therefore, it is urgent to find an effective substitute for natural bovine calculus to alleviate the shortage of natural bovine calculus and meet the demand of clinical medicine.

[0003] At present, the substitutes for bovine calculus mainly include artificial bovine calculus, in-vivo cultivated bovine calculus and in-vitro cultivated bovine calculus. The artificial bovine calculus is simply mixed by bovine gall powder, cholic acid, porcine deoxycholic acid, taurine, bilirubin, cholesterol and trace elements. The in-vitro cultivated bovine calculus is prepared by adding deoxycholic acid, cholic acid and complex bilirubin calcium into fresh bovine bile. The in-vivo cultivated bovine calculus is cultivated in the live body of a bovine. However, the artificial bovine calculus and the in-vitro cultivated bovine calculus are quite different from natural bovine calculus in composition, and their efficacy, especially in the treatment of acute and severe clinical conditions, cannot completely replace natural bovine calculus. The in-vivo cultivated bovine calculus has similar composition to natural bovine calculus, but it is difficult to be industrialized, causes serious harm to animals, and is affected by individual differences, cultivation time and other factors, so that the quality is difficult to control. Therefore, the substitutes for natural bovine calculus are still difficult to meet the clinical demand.

[0004] Chinese invention patent CN103316046B discloses an enzymatic production process of in vitro cultivation of bovine bezoar. First, fresh bovine bile is prepared by enzymatic fermentation, calcium hydroxide is added to the biological bovine bile, and after stirring and ultrasonic treatment, it is fully dissolved and heated to boiling to prepare stone bovine bile. During the shaking cultivation of the stone bovine bile, dilute acid is added to destroy the colloidal balance of the stone bovine bile and promote the formation of the stone core. After the addition of hydrochloric acid, when brown-red spherical objects appear, the product is obtained by standing and stratifying cultivation. The product of in vitro cultivation of bovine bezoar has the same characteristics, structure and composition as natural bovine bezoar, but the content of related components needs to be further improved. Chinese invention patent application CN1563393A discloses an enzymatic natural bovine bezoar preparation method. Escherichia coli is cultured, and β-GA enzyme is prepared based on the formation of bovine bezoar. The β-GA enzyme solution is added to the bovine bile stored at room temperature for several hours. The β-GA enzyme catalyzes the reaction of effective components such as bilirubin, cholic acid, bovine bezoar solution, cholesterol and inorganic salts to generate brown-yellow bilirubin calcium salt precipitate. After drying and pressing into bovine bezoar shape, it is "enzymatic natural bovine bezoar". But the content of cholic acid and deoxycholic acid in the product obtained by this method needs to be further improved.

[0005] It is reported that not less than 43 components have been isolated and identified from bovine bezoar and substitutes, mainly including bile pigments, bile acids, amino acids, proteins, cholesterol and trace elements. Among them, bile pigments and bile acids are considered to be the main active ingredients of bovine bezoar and substitutes and important indicators for quality evaluation. Our research group has conducted research on the formation mechanism, pharmacodynamic material basis and mechanism of natural bovine bezoar. It is the earliest to reveal that the main pharmacodynamic material of natural bovine bezoar is active bile acid component, and points out that the formation mechanism is the bile acid in vivo fermentation transformation mediated by gallbladder (duct) inflammation pathogenic bacteria, that is, the bile is fermented and transformed under the action of bacteria to produce various active bile acids and their derivatives, which constitute the main pharmacodynamic material basis of bovine bezoar.

[0006] Therefore, there is an urgent need to provide a preparation method of bovine bezoar substitutes with high content of cholic acid and deoxycholic acid and similar composition to natural bovine bezoar. SUMMARY

[0007] This invention addresses the problems existing in the prior art by providing a method for preparing biomimetic bezoar using in vitro fermentation and enzyme engineering bioengineering technology. This method utilizes synthetic biology principles: constructing a synthetic enzyme plasmid, using engineered bacteria to highly express the target synthetic enzyme, using natural bovine bile as a substrate, and employing engineered bacteria, the synthetic enzyme, or bezoar-forming bacteria as any form of fermentation bioreaction system. Through in vitro fermentation or enzymatic transformation of substances in bovine bile, biomimetic bezoar is prepared, exhibiting a high degree of consistency with the components of natural bezoar. The content of cholic acid (CA) is 8.5%-20.0%, the content of deoxycholic acid (DCA) is 2.0%-6.5%, and the liquid chromatography fingerprint similarity is ≥88.0%. The biomimetic bezoar prepared by this method is of excellent quality, can compensate for the scarcity of natural bezoar resources, protects animals, is readily available, and achieves the same therapeutic effects as natural bezoar, used for regulating metabolism, clearing heat and detoxifying, treating upper respiratory tract infections, protecting nerves, treating stroke, protecting the liver and gallbladder, or lowering blood lipids, etc.

[0008] The first aspect of this invention is to provide a method for preparing biomimetic bezoar, the method using bezoar derived from bovine gallstones (Catharanthus bovis). Bos taurus domesticus Gmelin Using natural bovine bile as a fermentation substrate, a fermentation and / or enzymatic reaction system was constructed, and biomimetic bovine gallstones were prepared using fermentation and / or enzyme engineering bioengineering technology.

[0009] Preferably, the fermentation and / or enzymatic reaction system is selected from at least one of the following: synthetic enzyme plasmids, synthetic enzyme high-expression engineered bacteria, and bezoar-forming bacteria, as the fermentation strain for direct in vitro fermentation.

[0010] Preferably, the strain of the bezoar-forming bacteria includes: *Lactobacillus sarcopenia* (…). Lactobacillus sakei St. George's bacteria () Georgenia satyanarayanai ), wandering cocci ( Vagococcus fessus Lactobacillus curvaturei ( Lactobacillus curvatus ), Weissella cephalosporium ( Weissella ceti ), Bacillus sicca ( Bacillus siamensis ), Citrobacter freundii ( Citrobacter Freundii ), Escherichia coli ( Escherichia Coli ), Klebsiella pneumoniae ( Klebsiella pneumoniae Ornithine-lysinic raulophilus ( Raoultella ornithino- lytica ) or Candida albicans ( Candida zeylanoides At least one of the following.

[0011] Preferably, the engineered bacterial vector is selected from Escherichia coli (Escherichia coli). Escherichia Coli ), yeast ( Saccharomyces ), lactic acid bacteria ( Lactococcus lactis ) and Bifidobacteria ( Bifidobacterium At least one of the following.

[0012] Preferably, the synthetic enzyme is selected from at least one of the following: bile salt hydrolase (BSH), 7a-steroid dehydrogenase (7a-HSDH), 7b-steroid dehydrogenase (7b-HSDH), and 7a-dehydroxylase.

[0013] Preferably, the engineered bacteria are prepared by the following steps: (1) Constructing overexpression plasmid BSH, 7a-HSDH, 7b-HSDH, 7a-dehydroxylase; (2) Constructing engineered strains: introducing the recombinant plasmid into the carrier strains Escherichia coli and / or yeast and / or lactic acid bacteria and / or bifidobacteria, and screening the transgenic engineered strains stably expressing BSH, 7a-HSDH, 7b-HSDH, and 7a-dehydroxylase with high yield; (3) Expanding the engineered strains, and the process is completed.

[0014] Preferably, the biomimetic calculus bovis is prepared by fermentation biotechnology, and the specific process is as follows: The synthetic enzyme high-expression engineered bacteria and / or calculus bovis forming bacteria separated from natural calculus bovis are taken, natural bovine bile is used as the substrate, and bovine blood and / or nutrient medium are added or not added, and then the mixture is placed in a fermentation tank for fermentation for 7-30 days, low-temperature drying, and shaping, and the biomimetic calculus bovis is obtained.

[0015] Preferably, the biomimetic calculus bovis is prepared by enzyme engineering biotechnology, and the specific process is as follows: Natural bovine bile is used as the substrate, bovine blood and / or nutrient medium are added or not added, at least one synthetic enzyme of bile salt hydrolase, 7a-steroid dehydrogenase, 7b-steroid dehydrogenase, and 7a-dehydroxylase is added, the mixture is placed in a bioreactor, the reaction conditions are controlled, and the reaction is performed for 10-36 h, low-temperature drying, and shaping, and the biomimetic calculus bovis is obtained.

[0016] The second aspect of the present application relates to a biomimetic calculus bovis prepared by the preparation method.

[0017] The third aspect of the present application relates to the application of the biomimetic calculus bovis prepared by the preparation method in preparing natural calculus bovis substitute products for adjusting metabolism of the body, clearing heat and detoxifying, upper respiratory tract infection, protecting nerves, stroke, protecting liver and gallbladder, or reducing blood lipids.

[0018] Preferably, the natural calculus bovis substitute product is a drug, a health product, or a cosmetic.

[0019] Compared with the prior art, the present application has the following beneficial effects: (1) the present application is based on the principle of enzymatic synthesis biology, realizes the conversion of biomimetic bovine bile acid with cholic acid content of 8.5%-20.0% and deoxycholic acid content of 2.0%-6.5%, and liquid phase fingerprint similarity of ≥88.0%; (2) the biomimetic bovine bile prepared by the present application has excellent quality and can replace the shortage of natural bovine bile resources. The biomimetic bovine bile prepared by the present application has high active related substance content, has the characteristics of protecting animals, being easy to obtain, and realizing the same therapeutic effect as natural bovine bile, and the biomimetic bovine bile prepared by the present application is used for adjusting metabolism of the body, clearing heat and detoxifying, treating upper respiratory tract infection, protecting nerves, treating stroke, protecting liver and gallbladder, reducing blood lipids, etc., and has better effect than each proportion. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 : UPLC-MS detection of bile acid components in natural bovine bile and biomimetic bovine bile, wherein a is natural bovine bile and b is biomimetic bovine bile; the numbers 1-9 in the figure represent different chemical components, wherein 1: sodium taurocholate, 2: sodium glycocholate, 3: sodium taurochenodeoxycholate, 4: taurochenodeoxycholic acid, 5: cholic acid, 6: sodium glycochenodeoxycholate, 7: glycochenodeoxycholic acid, 8: chenodeoxycholic acid, 9: deoxycholic acid; Figure 2 : Infrared spectra of ten batches of natural bovine bile; Figure 3 : Infrared spectra of ten batches of biomimetic bovine bile; Figure 4 : HPLC chromatograms of ten batches of natural bovine bile (left) and biomimetic bovine bile (right), wherein 1 is cholic acid (CA) and 2 is deoxycholic acid (DCA); Figure 5 : Similarity spectra of natural bovine bile, bovine bile and biomimetic bovine bile, wherein S1 is natural bovine bile, S2 is bovine bile, and S3-S5 is biomimetic bovine bile prepared by the method of example 1 of the present application; Figure 6 : Influence on the convulsive behavior of rats, wherein a is the influence on the convulsive latency, b is the influence on the convulsive duration, and c is the influence on the convulsive grade; Figure 7 : Influence on the content of inflammatory factors in the hippocampus of rats, wherein a is the influence on the content of TNF-α, b is the influence on the content of IL-6, and c is the influence on the content of IL-1β. DETAILED DESCRIPTION

[0021] Experimental Example 1: The bovine gallstone forming bacterial strains are isolated from natural bovine gallstones by macrogenomic sequencing and plate streaking method. The macrogenomic sequencing results are shown in Table 1. The top five dominant bacterial strains in the natural bovine gallstones in terms of abundance of macrogenomic sequencing are: Lactobacillus sakei (Lactobacillus sakei) Lactobacillus sakei ), Staphylococcus saprophyticus (Staphylococcus saprophyticus) Georgenia satyanarayanai ), Micrococcus versutus (Micrococcus versutus) Vagococcus fessus ), Lactobacillus curvatus (Lactobacillus curvatus) Lactobacillus curvatus ), and Weissella ceti (Weissella ceti) Weissella ceti .

[0022] Table 1: Macrogenomic detection of natural bovine gallstone forming bacterial strains

[0023] The natural bovine gallstones are separated by plate streaking method, and 6 strains are obtained by morphological, microscopic and sequencing identification of the bacterial strains, including 5 bacterial strains and 1 fungal strain, which are Bacillus siamensis (Bacillus siamensis) Bacillus siamensis ), Citrobacter freundii (Citrobacter freundii) Citrobacter Freundii ), Escherichia coli (Escherichia coli) Escherichia Coli ), Klebsiella pneumoniae (Klebsiella pneumoniae) Klebsiella pneumoniae ), Raoultella ornithinolytica (Raoultella ornithinolytica) Raoultella ornithino-lytica ), or Candida humilis (Candida humilis) Candida zeylanoides ). The genomic DNA of the isolated bacterial strains is amplified by using universal primers for fungal ITS and bacterial 16S, and the target gene fragments obtained by PCR amplification are subjected to Sanger sequencing. The sequencing results are shown in Table 2.

[0024] Table 2: Sanger sequencing of plate isolated bacterial strains

[0025] Experimental Example 2: Construction of engineering bacteria The construction of engineering bacteria is to introduce the synthesized enzymes of bile salt hydrolase (BSH) (nucleotide sequence is shown in SEQ NO. 1), 7α-steroid dehydrogenase (7α-HSDH) (nucleotide sequence is shown in SEQ NO. 2), 7β-steroid dehydrogenase (7β-HSDH) (nucleotide sequence is shown in SEQ NO. 3), and 7α-dehydroxylase (7α-dehydroxylase) (nucleotide sequence is shown in SEQ NO. 4) into engineering bacteria to obtain Escherichia coli (E. coli / BSH, 7α-HSDH, 7β-HSDH, 7α-dehydroxylase), yeast (Saccharomyces cerevisiae / BSH, 7α-HSDH, 7β-HSDH, 7α-dehydroxylase), lactic acid bacteria (Lactobacillus plantarum / BSH, 7α-HSDH, 7β-HSDH, 7α-dehydroxylase), and Bifidobacterium (Bifidobacterium longum / BSH, 7α-HSDH, 7β-HSDH, 7α-dehydroxylase). Saccharomyces Lactococcus lactis / BSH, 7α-HSDH, 7β-HSDH, 7α-dehydroxylase), and Bifidobacterium (Bifidobacterium longum / BSH, 7α-HSDH, 7β-HSDH, 7α-dehydroxylase).​Bifidobacterium / BSH, 7a-HSDH, 7b-HSDH, 7a-dehydroxylase) transgenic (genetically modified) engineering bacteria.

[0026] SEQ ID NO. 1: Bile salt hydrolase (EF536029.1) ATGTGTACTGGTTTAAGATTCACAGATGATCAAGGAAATTTATACTTTGGCCGTAATCTAGATGTTGGACAGGATTATGGCGAAGGCGTTATTATTACGCCGGGTAATTATCCTCTTCCATATAAGTTCTTAGATAACACCACTACTAAAAAGGCTGTTATTGGAATGGGAATTGTGGTTGATGGCTATCCATCATACTTTGACTGCTATAACGAAGATGGATTAGGCATTGCAGGTTTAAACTTCCCACATTTTGCTAAATTTAGTGATGGTCCTATTGACGGTAAAATCAACTTAGCTTCTTACGAAATTATGCTCTGGGTTACTCAAAACTTTACTCATGTTAGTGAAGTAAAGGAAGCGTTAAAGAATGTTAACTTAGTGAATGAAGCTATTAACACATCATTTGCGGTTGCCCCTCTTCACTGGATCATTAGTGATAGTGACGAAGCCATTATTGTTGAAGTTTCAAAACAATATGGAATGAAAGTCTTTGATGATAAAGTTGGCGTTTTAACTAATAGCCCTGACTTTAACTGGCACCTTACTAACCTTGGTAACTATACTGGTTTAAATCCACATGACGCTACAGCCCAAAGCTGGAACGGTCAAAAAGTTGCTCCTTGGGGTGTAGGAACTGGTAGTTTAGGTCTGCCTGGTGACAGCATTCCAGCCGACCGTTTTGTTAAAGCTGCTTACTTAAACGTAAACTATCCAACTGCTAAAGGTGAAAAAGCAAACGTCGCTAAATTCTTTAACATCTTAAAGTCTGTTGCCATGATCAAAGGCAGTGTAGTCAACGATCAAGGCAAGGACGAATATACTGTTTATACTGCATGCTACTCTTCTGGAAGCAAGACTTACTACTGTAATTTTGAAGATGATTTTGAATTAAAGACTTATAAACTAGATGATCACACGATGAATTCAACCAGTCTTGTGACTTACTAG SEQ ID NO. 2: 7a-hydroxysteroid dehydrogenase (JN191345.1) ATGAAAAGATTAGAAGGAAAAGTCGCAATAGTAACATCATCTACTAGAGGAATAGGACGTGCATCTGCAGAAGCATTAGCAAAAGAAGGTGCTTTAGTATATCTAGCAGCACGTTCAGAGGAATTAGCTAATGAAGTTATAGCAGATATAAAAAAGCAAGGTGGAGTAGCTAAGTTTGTTTACTTTAATGCTAGAGAAGAAGAAACTTACACTTCAATGGTAGAAAAAGTTGCTGAAGCTGAAGGCAGGATAGATATATTAGTTAATAACTACGGTGGAACAAATGTTAATTTAGATAAGAACTTAACTGCTGGAGATACAGATGAATTCTTTAGAATATTAAAAGATAACGTTCAAAGTGTATACTTACCAGCAAAAGCTGCTATACCACATATGGAAAAAGTAGGCGGTGGAAGCATAGTTAATATCTCAACTATAGGATCAGTTGTTCCAGATATATCAAGAATAGCTTACTGTGTATCAAAATCCGCTATAAACTCTTTAACTCAAAACATAGCATTACAATATGCAAGAAAGAATATCAGATGTAATGCAGTATTACCTGGTTTAATAGGAACTAGAGCAGCACTCGAAAATATGACTGATGAATTTAGAGACTCATTCTTAGGACATGTTCCTTTAAATAGAGTAGGAAGACCAGAAGATATAGCAAATGCAGTTTTATACTATGCCTCTGATGATTCAGGTTATGTAACAGGAATGATTCATGAAGTTGCAGGAGGTTTTGCATTAGGAACTCCTCAATATTCAGAATACTGTCCAAGATAA SEQ ID NO. 3: 7beta-hydroxysteroid dehydrogenase (KF052988.1) ATGACATTGAGAGAAAAATATGGAGAATGGGGAATTATTTTAGGCGCTACTGAAGGTGTCGGAAAAGCATTTTGTGAAAGGCTTGCCAAAGAAGGTATGAATGTCGTAATGGTCGGACGCCGTGAAGAAAAATTAAAAGAGCTCGGTGAGGAACTAAAAAACACTTATGAGATTGATTATAAAGTCGTAAAAGCAGACTTTTCGCTGCCAGATGCTACTGACAAAATTTTTGCTGCAACAGAAAATCTGGATATGGGATTTATGGCCTATGTAGCCTGCTTACACTCTTTTGGCAAAATCCAGGATACACCTTGGGAAAAGCATGAGGCAATGATCAACGTAAACGTTGTTACATTTATGAAATGCTTCTATCACTATATGAAAATCTTTGCTGCACAGGATCGCGGTGCTGTCATCAACGTATCTTCTATGACTGGAATTTCCAGTTCACCATGGAATGGCCAATATGGTGCAGGAAAGGCATTCATTTTAAAAATGACAGAGGCTGTTGCCTGTGAAACGGAAAAGACCAATGTTGATGTGGAAGTCATCACTTTGGGAACTACTCTGACACCAAGTCTTTTAAGCAACCTGCCTGGCGGACCACAGGGGGAAGCTGTTATGAAGACTGCTCAAACACCGGAAGAAGTTGTGGACGAAGCTTTTGAAAAATTAGGAAAAGAACTGTCTGTCATTTCCGGAGAGCGTAATAAAGCCAGCGTCCATGACTGGAAAGCGAATCATACAGAAGATGACTATATCCGCTATATGGGATCTTTCTATCAAGAATAA SEQ ID NO. 4: 7a-dehydroxylase (M15813.1) TCGATACGATACTTTGGCAGATATGATAAGCCAAAGGAAAAGAAAGGAAGGAAAAGTTCATGAAACTTGTACAGGACAAAATTACAATTATCACAGGCGGAACCTGGAATCGGATTCGCAGCAAAACTCTTTATTGAGAATGGAGCAAAAGTCTCCATATTTGGCGAGACCCAGGAAGAGGTAGACACAGCGCTGGCTCAGTTAAAGGAACTCTATCCG Example 1: Preparation of biomimetic bezoar by fermentation with natural bezoar-forming bacteria Take fresh ox bile, autoclave at 121°C and 15 psi for 20 minutes, cool to 37°C, add 20% anticoagulated ox blood, and add 5% Lactobacillus salicylate (by weight of fresh ox bile). Lactobacillus_sakei St. George's bacteria () Georgenia_satyanarayanai ), wandering cocci ( Vagococcus_fessus Lactobacillus curvatus, Lactobacillus cereus Weissella ceti A mixed strain of five bacteria (in a mass ratio of 1:1:1:1:1) was used for fermentation at 37℃ and pH 7.0-8.0 for 25 days. The fermented product was then freeze-dried to obtain the biomimetic bezoar. HPLC-ELSD analysis showed that the cholic acid (CA) content was 13.252% and the deoxycholic acid (DCA) content was 3.076%, meeting the standards for natural bezoar.

[0027] Example 2: Fermentation preparation of biomimetic bezoar using transgenic (genetically modified) engineered bacteria including E. coli (BSH, 7α-HSDH), Lactococcus lactis (7β-HSDH), and Bifidobacterium (7α-dehydroxylase). Fresh bovine bile was sterilized by high-pressure steam at 121℃ and 15psi for 20 minutes, then cooled to 37℃. 20% anticoagulated bovine blood was added, along with 5% of a mixed bacterial culture (3:1:1 mass ratio) consisting of *E. coli* (BSH, 7α-HSDH), *Lactococcus lactis* (7β-HSDH), and *Bifidobacterium* (7α-dehydroxylase). Fermentation was carried out at 37℃ and pH 7.0-8.0 for 15 days. The fermented product was then freeze-dried to obtain biomimetic bezoar. HPLC-ELSD analysis showed a CA content of 17.635% and a DCA content of 4.501%, meeting the standards for natural bezoar.

[0028] Example 3: Preparation of biomimetic bovine gallstones by enzyme engineering method Fresh bovine bile was sterilized by high-pressure steam at 121℃ and 15 psi for 20 min, and then mixed with a crude enzyme extract (mass ratio 2:1:1:1) composed of bile salt hydrolase (BSH), 7a-steroid dehydrogenase (7a-HSDH), 7b-steroid dehydrogenase (7b-HSDH), and 7a-dehydroxylase, with enzyme dosage of 0.1 mg / mL and 0.25 mM nicotinamide adenine dinucleotide phosphate (NADP + ), under the conditions of reaction temperature of 37℃ and pH value of 7.0-8.0, with 300 rpm stirring. After 24 h, the product was freeze-dried to obtain biomimetic bovine gallstones. The CA content was 16.334% and the DCA content was 4.027% by HPLC-ELSD method, reaching the standard of natural bovine gallstones.

[0029] Example 4: Preparation of biomimetic bovine gallstones by mixed fermentation of bile salt hydrolase (BSH) and natural bovine gallstone separation bacteria Fresh bovine bile was sterilized by high-pressure steam at 121℃ and 15 psi for 20 min, and then cooled to 37℃. Anticoagulant bovine blood was added at a concentration of 20%. Bacillus siamensis, Citrobacter freundii, Escherichia coli, Klebsiella pneumoniae, Raoultella ornithino-lytica, and Candida zeylanoides were added at a ratio of 1:1:1:1:1:1, with a bacterial inoculum of 6% of the mass of fresh bovine bile. Bile salt hydrolase (BSH) was also added at an enzyme dosage of 0.1 mg / mL. The fermentation was carried out at a temperature of 37℃ and a pH value of 7.0-8.0 for 7 days. The fermented product was freeze-dried to obtain biomimetic bovine gallstones. The CA content was 17.0465% and the DCA content was 4.922% by HPLC-ELSD method.

[0030] Comparative Example 1 The difference between Example 1 and Comparative Example 1 is that the bacteria Lactobacillus sakei, Staphylococcus sancti, and Enterococcus gallinarum in Example 1 were replaced by Cryptococcus neoformans, Pseudomonas syringae, and Enterococcus citreus.

[0031] Fresh bovine bile was sterilized at 121℃, 15psi high pressure steam for 20min, cooled to 37℃, 20% anticoagulant bovine blood was added, and 5% of fresh bovine bile was added to a mixed bacteria (mass ratio of Vagococcus carniphilus, Pseudomonas syringae, Enterococcus pallens, Lactobacillus curvatus, and Weissella ceti is 1:1:1:1:1) consisting of Vagococcus carniphilus, Pseudomonas syringae, Enterococcus pallens, Lactobacillus curvatus, and Weissella ceti, and the mixed bacteria was fermented. The fermentation temperature was 37℃, the pH value was 7.0-8.0, and the fermentation time was 25 days. The fermented product was freeze-dried. The CA content was 3.557% and the DCA content was 1.133% as determined by HPLC-ELSD method.

[0032] Example 2: Fermentation of genetically modified (genetically modified) engineering bacteria of Bacillus subtilis (Bacillus subtilis / BSH, 7α-HSDH), Lactococcus lactis (Lactococcus lactis / 7β-HSDH), and Bifidobacterium (Bifidobacterium / 7α-dehydroxylase) to prepare biomimetic bovine calculus The difference from Example 2 is that the E. coli engineering strain in Example 2 is replaced by Bacillus subtilis engineering bacteria.

[0033] Fresh bovine bile was sterilized at 121℃, 15psi high pressure steam for 20min, cooled to 37℃, 20% anticoagulant bovine blood was added, and 5% of fresh bovine bile was added to a mixed bacteria (mass ratio of Vagococcus carniphilus, Pseudomonas syringae, Enterococcus pallens, Lactobacillus curvatus, and Weissella ceti is 1:1:1:1:1) consisting of Vagococcus carniphilus, Pseudomonas syringae, Enterococcus pallens, Lactobacillus curvatus, and Weissella ceti, and the mixed bacteria was fermented. The fermentation temperature was 37℃, the pH value was 7.0-8.0, and the fermentation time was 25 days. The fermented product was freeze-dried. The CA content was 3.557% and the DCA content was 1.133% as determined by HPLC-ELSD method.

[0034] Example 3: Enzyme engineering method for preparing biomimetic bovine calculus The difference from Example 3 is that the bile salt hydrolase and 7α-dehydroxylase in Example 3 are replaced by β-galactosidase and lactate dehydrogenase.

[0035] Fresh bovine bile was sterilized by high pressure steam at 121℃, 15 psi for 20 min, then β-galactosidase, 7α-HSDH, 7β-HSDH, lactate dehydrogenase (2:1:1:1) crude extract was added, the enzyme dosage was 0.1 mg / mL and 0.25 mM NADP + , the reaction temperature was 37℃, the pH value was 7.0-8.0, the stirring speed was 300 rpm, and the product was freeze-dried after 24 h. The CA content was 4.621% and the DCA content was 1.033% by HPLC-ELSD method.

[0036] Test Example 1 The similarity of natural bovine bezoar and the bionic bovine bezoar of Example 1 was detected by taking 9 kinds of cholic acid components as indexes. The natural bovine bezoar and the bionic bovine bezoar were crushed, passed through a 50 mesh sieve, 3 g of which was dissolved in 10 mL of 80% methanol, ultrasonic extracted for 30 min, and filtered. The bile acid components of the natural bovine bezoar and the bionic bovine bezoar were detected by UPLC-MS, and the results showed that the main components of the bionic bovine bezoar and the natural bovine bezoar were basically the same, and the contents of cholic acid, chenodeoxycholic acid and deoxycholic acid of the bionic bovine bezoar were slightly higher than those of the natural bovine bezoar, see Figure 1 ; the infrared spectrometer was used to detect ten batches of natural bovine bezoar and bionic bovine bezoar, and the results showed that there was almost no difference between the infrared spectra of the natural bovine bezoar and the bionic bovine bezoar, except that the number of peaks of the bionic bovine bezoar was slightly more than that of the natural bovine bezoar in the range of 1000-1500 cm -1 , see Figure 2 and Figure 3 ; the similarity of the natural bovine bezoar, the bionic bovine bezoar and the fresh bile was evaluated by HPLC-ELSD method, and the chromatograms of the bionic bovine bezoar and the natural bovine bezoar both appeared obvious CA and DCA chromatographic peaks, and there were almost no CA and DCA chromatographic peaks in the chromatogram of the bovine bile, the similarity of the natural bovine bezoar and the fresh bovine bile was 60.4%, and the similarity of the natural bovine bezoar and the bionic bovine bezoar was 91.3%, see Figure 4 and Figure 5 .

[0037] The results of UPLC-MS, infrared spectrum detection and HPLC-ELSD detection showed that the components of the bionic bovine bezoar were basically the same as those of the natural bovine bezoar, and could be used as a substitute for the natural bovine bezoar.

[0038] Pharmacological Experiment 1: Hypolipidemic effect of bionic bovine bezoar C57BL / 6 male mice, weighing 18-22 g, were purchased from Guangdong Medical Laboratory Animal Center, license number SCXK (Yue) 2022-0002. After 7 days of adaptive feeding, they were randomly divided into blank group, model group, treatment group (natural cow-bezoar high and low dose groups, high and low dose groups of the biomimetic cow-bezoar prepared in Examples 1-4, high and low dose groups of the biomimetic cow-bezoar prepared in Comparative Examples 1-3), 8 in each group, and entered the experimental period. Among them, except for the blank group, the rest of the mice were fed with high-fat high-cholesterol feed for 5 weeks to induce hyperlipidemia model, and the treatment group mice were continuously administered with high and low doses of natural cow-bezoar, biomimetic cow-bezoar prepared in Examples 1-4 and Comparative Examples 1-3 for 28 days, and the dosages were 75 mg / kg and 300 mg / kg, respectively. The blank group and the model group were administered with the same dose of normal saline. The experimental results are shown in Table 3.

[0039] Table 3: Serum biochemical analysis results of mice in each group (mean ± standard deviation, n = 8)

[0040] Note: compared with the blank group, # P < 0.05, ## P < 0.01; compared with the model group, each treatment group * P < 0.05, ** P < 0.01; compared with Example 1-low, each treatment group & P < 0.05, && P < 0.01.

[0041] Compared with the model group, both natural cow-bezoar and biomimetic cow-bezoar prepared in Examples 1-4 can significantly reduce the levels of total cholesterol (TC), triglyceride (TG), and low-density lipoprotein cholesterol (LDC-C) in mice, and increase the level of high-density lipoprotein cholesterol (HDL-C), with significant differences, indicating that biomimetic cow-bezoar prepared in Examples 1-4 and natural cow-bezoar can improve blood lipid levels, and their pharmacological effects are basically the same. The effect of biomimetic cow-bezoar prepared from Comparative Examples 1-3 is significantly lower than that of biomimetic cow-bezoar prepared in Examples 1-4.

[0042] Pharmacodynamic experiment 2: hepatoprotective effect of biomimetic cow-bezoar Kunming mice, male, weighing 22-25 g, purchased from Guangdong Medical Experimental Animal Center, license number SCXK (Yue) 2022-0002. After adaptive feeding for 7 days, they were randomly divided into blank group, model group, treatment group (natural cow-bezoar high and low dose groups, high and low dose groups of the biomimetic cow-bezoar prepared in Examples 1-4, high and low dose groups of the biomimetic cow-bezoar prepared in Comparative Examples 1-3), 8 in each group, into the experimental period. Among them, the treatment group was continuously administered with low and high doses of natural cow-bezoar, biomimetic cow-bezoar prepared in Examples 1-4, and biomimetic cow-bezoar prepared in Comparative Examples 1-3 for 7 days, and the dosages were 75 mg / kg and 300 mg / kg, respectively. The blank group and the model group were administered with the same dose of normal saline. Two hours after the last administration, the mice in the rest groups were intraperitoneally injected with 0.2% CCl4-olive oil solution to induce acute liver injury, with a dose of 2 mg / kg. The blank group was given the same amount of olive oil, and blood was taken for biochemical analysis 24 hours later. The experimental results are shown in Table 4.

[0043] Table 4: Serum biochemical analysis results of mice in each group (mean ± standard deviation, n=8)

[0044] Note: compared with the blank group, # P<0.05, ## P<0.01; compared with the model group, each treatment group * P<0.05, ** P<0.01; compared with Example 1-low group, each treatment group & P<0.05, && P<0.01.

[0045] Compared with the model group, both natural cow-bezoar and biomimetic cow-bezoar prepared in Examples 1-4 can significantly reduce the levels of liver function indicators AST and ALT, reduce the level of oxidative stress indicator MDA, and increase the level of superoxide dismutase SOD in liver tissue, indicating that biomimetic cow-bezoar prepared in Examples 1-4 and natural cow-bezoar both have antioxidant and liver protection effects, and their effects are basically the same. The high dose of Comparative Examples 1-3 has a certain positive regulation effect on the contents of AST, ALT, MDA and SOD of the acute liver injury model, but the overall effect is significantly weaker than that of Example 1. The regulation effect of AST, ALT, MDA and SOD of the acute liver injury model, the antioxidant and liver protection effects of biomimetic cow-bezoar obtained from Examples 1-4 and natural cow-bezoar are basically the same, and are better than those of Comparative Examples 1-3.

[0046] Pharmacodynamic experiment 3: Anti-high fever convulsion effect of biomimetic cow-bezoar SD rats, male, weight 40-60 g, purchased from Guangdong Medical Experimental Animal Center, license number: SCXK (Yue) 2022-0002. After adaptive feeding for 5 days, they were randomly divided into blank group, model group, treatment group (natural cow-bezoar high and low dose groups, biomimetic cow-bezoar prepared in examples 1-4 high and low dose groups, biomimetic cow-bezoar prepared in comparative examples 1-3 high and low dose groups), 8 rats in each group, into the experimental period. Except for the blank group, the rest of the rats in each group were stimulated with 45 ± 0.5 ℃ hot water on the 1st, 3rd, 5th, 7th, 9th, 11th, 13th, 15th day of the experiment in the morning to construct a high fever convulsion rat model, and on the 2nd day of the experiment, except for the blank group and the model group, the rest of the groups were given intragastric administration every afternoon, until the 15th day of the experiment, specifically, the positive drug group (positive) was given intragastric administration of 50 mg / kg bw of valproate sodium every day, the natural cow-bezoar, examples 1-4 and comparative examples 1-3 groups were given intragastric administration of low and high doses of natural cow-bezoar, examples 1-4 and comparative examples 1-3 prepared biomimetic cow-bezoar every day, the low and high doses were 300 mg / kg bw and 900 mg / kg bw respectively, the blank group and the model group were given intragastric administration of the same amount of normal saline. On the second day of the end of the experiment, the convulsion behavior of the rats, including convulsion latency, convulsion duration, convulsion onset grade, was tested, and after the test, the rats in each group were anesthetized with isoflurane inhalation, the hippocampus was taken, and the content of TNF-α, IL-6, IL-1β in the hippocampus was detected by Elisa kit. The experimental results are shown in Figure 6 and Figure 7 (Note: compared with the Model group, each administration group *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; the symbols of the groups are explained as follows: Control represents the blank group, Model represents the convulsion model group, Positive indicates the positive drug group, D-L represents the natural cow-bezoar low dose group, D-H represents the natural cow-bezoar high dose group, FD1-L represents the example 1 biomimetic cow-bezoar low dose group, FD1-H represents the example 1 biomimetic cow-bezoar high dose group, FD2-L represents the example 2 biomimetic cow-bezoar low dose group, FD2-H represents the example 2 biomimetic cow-bezoar high dose group, FD3-L represents the example 3 biomimetic cow-bezoar low dose group, FD3-H represents the example 3 biomimetic cow-bezoar high dose group, FD4-L represents the example 4 biomimetic cow-bezoar low dose group, FD4-H represents the example 4 biomimetic cow-bezoar high dose group, VFD1-L represents the comparative example 1 low dose group, VFD1-H represents the comparative example 1 high dose group; VFD2-L represents the comparative example 2 low dose group, VFD2-H represents the comparative example 2 high dose group; VFD3-L represents the comparative example 3 low dose group, VFD3-H represents the comparative example 3 high dose group; n=8).

[0047] Compared with the hyperpyrexia convulsion model group, the bionic calculus bovis and natural calculus bovis treatment of example 1-4 group significantly shortened the convulsion duration of rats, reduced the severity of convulsion in rats, and reduced the expression levels of TNF-α, IL-6, and IL-1β in hippocampal tissue, indicating that the bionic calculus bovis and natural calculus bovis of example 1-4 group both have the effects of inhibiting inflammation and resisting hyperpyrexia convulsion, and the pharmacological effects of the two are basically the same. At the same time, the effect of example 1-4 group is obviously better than that of comparative example 1-3.

[0048] Through the above research, a method for preparing bionic calculus bovis by in vitro fermentation and enzyme engineering biological engineering technology is constructed. According to the conversion rule of the components of bovine bile and the components contained in natural calculus bovis, a synthesis enzyme plasmid is constructed, and / or a high expression engineering bacteria of synthesis enzyme is screened, and / or a bovine calculus formation bacteria isolated from natural calculus bovis is used as a fermentation strain to directly ferment in vitro. In any combination of the above forms of enzymes, engineering bacteria, and bovine calculus formation bacteria, the highest degree of bionic calculus bovis is formed.

[0049] The prepared bionic calculus bovis has basically the same effect as natural calculus bovis in adjusting the body metabolism, clearing heat and detoxifying, treating upper respiratory tract infection, protecting nerves, treating stroke, protecting liver and gallbladder, or treating diseases related to lowering blood lipids, and can be used as a substitute for natural calculus bovis.

Claims

1. A method for preparing biomimetic bezoar using engineered bacteria, characterized in that: The method uses natural bovine bile as a fermentation substrate and a fermentation reaction system to prepare biomimetic bezoar, wherein... The fermentation reaction system uses engineered bacteria that highly express synthetic enzymes as the fermentation strain for direct in vitro fermentation. The engineered bacteria were prepared by the following steps: (1) Construct overexpression plasmids containing bile salt hydrolase, 7α-steroid dehydrogenase, 7β-steroid dehydrogenase and 7α-dehydroxylase; (2) Construction of engineered strains: The recombinant plasmid was introduced into the vector strains Escherichia coli and / or yeast and / or lactic acid bacteria and / or Bifidobacterium, and transgenic engineered strains that stably and highly express bile salt hydrolase, 7α-steroid dehydrogenase, 7β-steroid dehydrogenase and 7α-dehydroxylase were screened. (3) The preferred engineered strains include Lactobacillus johnsonii. Lactobacillus johnsonii Lactobacillus gasseri Lactobacillus gasseri The engineered strain is then propagated to obtain the desired product.

2. The method for preparing biomimetic bezoar according to claim 1, characterized in that, The biomimetic bezoar was prepared using fermentation bioengineering technology, specifically through the following process: Using engineered bacteria that highly express synthetic enzymes, with natural bovine bile as a substrate, and with or without the addition of bovine blood and nutrient culture medium, fermentation is carried out for 7-30 days, followed by freeze-drying and shaping to obtain biomimetic bezoar.

3. A biomimetic bezoar, characterized in that... The biomimetic bezoar is prepared using the method described in any one of claims 1-2.

4. The use of a biomimetic bezoar prepared by the method according to any one of claims 1-2 or the biomimetic bezoar according to claim 3 in the preparation of a natural bezoar substitute product for regulating metabolism, clearing heat and detoxifying, treating upper respiratory tract infections, protecting nerves, treating stroke, protecting the liver and gallbladder, or lowering blood lipids.

5. In the application according to claim 4, the natural bezoar substitute product is a medicine or health product.

Images