A SNP molecular marker related to yak wool yield, body side wool length and head wool length and application thereof

Abstract

The present application relates to the technical field of molecular biology detection, and particularly relates to a SNP molecular marker related to yak wool yield, body side wool length and head wool length and application. The molecular marker is located at position 25393687 of chromosome 6 of yak reference genome Bosgu_v3.0 version European Nucleotide Archive registration number GCA_005887515.1, and the mutation base is C or G. The method can quickly identify corresponding traits, can be used for yak molecular marker assisted breeding, and is not limited by yak breeds and ages. Therefore, in production, individuals with genotypes of CG or GG at the site can be preferentially selected as parents for scale breeding, the accuracy and effectiveness of selection of yak wool yield, body side wool length and head wool length traits are greatly improved, and the economic benefits of yak breeding are improved.

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection technology, and in particular to a SNP molecular marker and its application related to yak hair production, body hair length and head hair length. Background Technology

[0002] Tianzhu white yaks primarily inhabit the high-altitude grasslands above 3,000 meters in Tianzhu Tibetan Autonomous County, Gansu Province. This region is characterized by thin air, harsh climate, and large temperature differences between day and night. These yaks have adapted to the harsh environment thanks to their cold resistance and ability to thrive on roughage. They have a wide range of uses and extremely high economic value. Yak meat and milk are high-quality food products, while their pure white wool is the core value, used to weave high-end clothing, tents, etc. Their tail hair is also used in traditional theatrical false beards and high-end decorative materials, possessing both cultural and practical value. Improving their wool production performance, increasing the yield per head and the length of wool fibers, is of great significance. It can directly increase the income of herders, provide more high-value textile raw materials per head, and support the sustainable development of the wool textile industry. It is also an effective means of preventing population degradation and can enhance the breed's survival ability in high-altitude, cold environments.

[0003] Single nucleotide polymorphisms (SNPs) are variations in the DNA sequence caused by mutations in a single nucleotide across the entire genome. These variations mainly fall into four categories: transitions, transversions, deletions, and insertions, with transitions and transversions being the most common. A transition involves the substitution between purine bases (A and G) and pyrimidine bases (T and C), while a transversion involves the substitution between purine and pyrimidine bases. SNPs appearing in coding regions can affect gene function, leading to changes in biological traits, and therefore can serve as biomarkers associated with certain traits. Due to their high density, stable inheritance, and the ability to be automated, SNPs can be used for marker-assisted breeding, linkage analysis, and biodiversity research.

[0004] FGF5 Fibroblast growth factor 5 gene FGF5 This gene can bind to its receptor FGFR1-4, thereby initiating signal transduction processes to regulate cell growth. Among the many factors affecting hair length in mammals, this gene plays a crucial role. It is not only an important growth factor influencing the periodic activity of hair follicles and hair growth, but also the known factor with the strongest controlling effect on the transition of hair follicles from the anagen (growth) to the telogen (resting) phase. In addition to its proven role in mice, current research also indicates that… FGF5 Genes can also cause changes in the fur growth of many mammals, including dogs, cats, and rabbits. This is why... FGF5 Genes have become important candidate genes for studying the wool production performance of yaks and for genetic improvement. Summary of the Invention

[0005] The purpose of this invention is to provide an SNP molecular marker related to yak wool production, body hair length, and head hair length, and its application.

[0006] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0007] This invention provides an SNP molecular marker associated with yak hair production, body hair length, and head hair length. The molecular marker is located at position 25393687 on chromosome 6 of the yak reference genome Bosgu_v3.0 version European Nucleotide Archive accession number GCA_005887515.1, with a mutated base of C or G.

[0008] Preferably, the nucleotide sequence containing the molecular marker is shown in SEQ ID NO.1, where the molecular marker is located at position 201.

[0009] Preferably, based on the mutated base type of the molecular marker, the yak individual genotypes are divided into CC, CG, and GG; the yak individuals with genotype GG have significantly higher body hair length, head hair length, and hair yield than individuals with genotypes CC and CG; the yak individuals with genotype CG have significantly higher head hair length than individuals with genotype CC.

[0010] Preferably, the yak is a Tianzhu white yak.

[0011] This invention provides the application of reagents for detecting the aforementioned molecular markers in the detection of traits such as hair yield, body hair length, and head hair length in yaks, or in the early breeding of these traits.

[0012] Preferably, yak individuals are screened by detecting the molecular markers.

[0013] Preferably, the reagent comprises primer pairs for amplifying the molecular marker.

[0014] Preferably, the nucleotide sequences of the primer pair are shown in SEQ ID NO.2~3.

[0015] This invention provides a method for detecting the wool yield, body hair length, and head hair length of yaks, comprising the following steps:

[0016] (1) Extract yak genomic DNA as template DNA;

[0017] (2) The template DNA obtained in step (1) was amplified by PCR using primers as shown in SEQ ID NO.2~3 to obtain PCR amplification products;

[0018] (3) The PCR amplification product obtained in step (2) is purified and genotyping is performed to classify the yak individual genotypes into CC, CG and GG; the yak individuals with genotype GG have significantly higher body hair length, head hair length and hair production than individuals with genotypes CC and CG; the yak individuals with genotype CG have significantly higher head hair length than individuals with genotype CC.

[0019] This invention provides a method for early selection of traits such as wool yield, body hair length, and head hair length in yaks, comprising the following steps:

[0020] (1) Extract yak genomic DNA as template DNA;

[0021] (2) The template DNA obtained in step (1) was amplified by PCR using primers as shown in SEQ ID NO.2~3 to obtain PCR amplification products;

[0022] (3) Purify the PCR amplification product obtained in step (2) and perform genotyping detection. When the SNP molecular marker base is C, the genotype is CC or CG; when the SNP molecular marker base is G, the genotype is GG; the body hair length, head hair length and hair yield of yak individuals with genotype GG are significantly higher than those with genotypes CC and CG; the head hair length of yak individuals with genotype CG is significantly higher than that of yak individuals with genotype CC; select yak individuals with genotypes CG or GG for early breeding of hair yield, body hair length and head hair length traits.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] This invention analyzes the correlation between locus genotypes and traits such as wool production, lateral hair length, and head hair length in yaks. It identifies SNP loci associated with these traits, with the SNP molecular marker located at position 25393687 on chromosome 6 of the yak reference genome Bosgu_v3.0, European Nucleotide Archive accession number GCA_005887515.1, and the mutated base being C or G. Based on genotyping, individual yak genotypes were classified into CC, CG, and GG. Yaks with genotype GG exhibited significantly higher lateral hair length, head hair length, and wool production than those with genotypes CC and CG (P<0.05). Yaks with genotype CG had significantly higher head hair length than those with genotype CC (P<0.05).

[0025] This invention can rapidly identify corresponding traits through PCR and gene sequencing, and can be used for molecular marker-assisted breeding of yaks. It is not limited by yak breed or age. Therefore, in production, individuals with the CG or GG genotype at this locus can be preferentially selected as parents for large-scale breeding, which greatly accelerates the accuracy and effectiveness of selecting traits such as wool yield, body hair length, and head hair length in yaks, and improves the economic benefits of yak breeding. Attached Figure Description

[0026] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0027] Figure 1 These are sequencing peak diagrams of three genotypes in this embodiment of the invention; a is CC type; b is CG type; c is GG type. Detailed Implementation

[0028] This invention utilizes multiple primer pairs designed sequentially to amplify DNA from Tianzhu white yaks using PCR, followed by gene sequencing. Genotyping analysis of the target fragment amplified by one primer pair (SEQ ID NO.2 and SEQ ID NO.3) revealed a single SNP site with three genotypes. Analysis using MEGA 11.0 and BioEdit software identified the SNP site located at nucleotide 201 of the SEQ ID NO.1 sequence. Further analysis using SPSS 25.0 software revealed the correlation between the genotype of the mutation site and traits such as hair yield, lateral hair length, and head hair length in Tianzhu white yaks. The results showed that Tianzhu white yaks with genotype GG had significantly higher lateral hair length, head hair length, and hair yield than those with genotypes CC and CG (P<0.05); Tianzhu white yaks with genotype CG had significantly higher head hair length than those with genotype CC (P<0.05).

[0029] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be described in detail below with reference to embodiments. It should be noted that the following embodiments are given for illustrative purposes only and are not intended to limit the scope of this invention. Reagents not described in detail in this invention are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art. Those skilled in the art can make various modifications and substitutions to this invention without departing from its spirit and purpose.

[0030] Example 1: SNP site identification

[0031] (1) Sample collection of Tianzhu white yak

[0032] This invention uses the Tianzhu White Yak breed as the testing subject. Blood samples were collected from 759 Tianzhu White Yaks in Xiamiaoergou Village, Dachaigou Town, Tianzhu Tibetan Autonomous County, Wuwei City, Gansu Province. The wool production performance of the Tianzhu White Yaks was measured, including wool yield, skirt hair length, lateral hair length, head hair length, and back hair length. 5ml of blood was collected from the jugular vein using EDTA anticoagulant blood collection tubes and stored at -20℃.

[0033] (2) Isolation, extraction and purification of genomic DNA

[0034] Genomic DNA was extracted from blood samples of Tianzhu white yaks using the TIANamp Blood Genomic DNA Kit; DNA quality and concentration were determined by 1.5% agarose gel electrophoresis and Thermo Scientific Nano Drop 2000c.

[0035] (3) Primer design and screening

[0036] Based on the FGF5 gene of Tianzhu white yak published by Ensemble (accession number: ENSBGRG00000010381), multiple primer pairs were designed on its DNA sequence using Primer 5.0 software. PCR amplification was performed on Tianzhu white yak DNA samples, and the gene sequencing results were analyzed. A pair of primers containing an SNP site was selected, and its primer sequence information is as follows:

[0037] F: 5'-GCCTGGGAGTAAGTGGAT-3' (shown in SEQ ID NO. 2);

[0038] R: 5'-CTGGACCTTTAACTGGAAGA-3' (shown in SEQ ID NO. 3).

[0039] (4) PCR amplification of the target gene fragment

[0040] The PCR reaction mixture consisted of 25 μL: 12.5 μL of 2× Taq PCR Mix, 1 μL of DNA template (100 ng / μL), 1 μL each of forward and reverse primers (10 μmol / L), and 9.5 μL of enzyme-free sterile water. The PCR amplification program was as follows: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 30 s, 54.5 ℃ annealing for 30 s, 72 ℃ extension for 1 min, 30 cycles; 72 ℃ extension for 5 min, and cooling at 4 ℃. After amplification, the amplification products were detected by electrophoresis on a 1.5% agarose gel.

[0041] (5) Gene sequencing

[0042] The PCR reaction solution, after passing the tests, was sent to Shanghai Sangon Biotech Co., Ltd. for bidirectional Sanger sequencing. The amplified target sequence is shown in SEQ ID NO.1, with the SNP site located at position 201 of the sequence shown in SEQ ID NO.1. The sequencing peak diagram at the mutation site is shown below. Figure 1 As shown.

[0043] SEQ ID No.1

[0044] GAGCATGAACAGACAAGCAGGCAGAGAGAGACCGAAAGAGAAGGGTGCTCAGCCTCACCTAGTACCTCAGCCTGGGAGTAAGTGGATAAAGTACAGAGGCCACAGAGAAGGCTCTGACTAACCCTCAGGGTCTTGGGGAAACAATTACCTCGTGCTTCTCTCAATGATTCTCAAGGCATCTTGAGAAAAAGACCAGACAC CTTCTCCCTTGCAACGGCTGCTGAAAAAAACCTGCACACTAGGGATCTGACTGCATTGTCTATTTAGGGTCTTCCAGTTAAAGGTCCAGAGAAGGCAATGGCACCCCACTCCAGTACTCTTGCCTGGAAAATCCCATGGACAGAGGAGCCTGGTAGGCTGCAGTCCATGGGGTCGCTAGAGTCAGACACGACTGAGCGACT

[0045] Example 2: Correlation between different SNP molecular marker genotypes and traits of hair production, lateral hair length, and head hair length.

[0046] (1) Genotyping

[0047] All individuals underwent steps (4) and (5) of Example 1 to determine their specific genotypes based on gene sequencing results. Three genotypes were detected in the test population, and the genotype frequencies and allele frequencies are shown in Table 1.

[0048] Genotyping of blood DNA samples from 759 Tianzhu white yaks using PCR and gene sequencing revealed three genotypes at the SNP molecular marker site of the FGF5 gene: homozygous CC, heterozygous CG, and homozygous GG. The frequencies of the three genotypes were 0.352 (CC), 0.485 (CG), and 0.163 (GG).

[0049] Table 1. Genotypes and allele frequencies of the FGF5 gene SNP loci in Tianzhu white yak.

[0050]

[0051] (2) Association analysis between SNP genotype and hair phenotypic value

[0052] To determine whether the SNP marker prepared in this invention is related to the differences in hair traits of Tianzhu white yaks, least squares statistical correlation analysis was performed on the three genotypes of the SNP locus at position 201 of SEQ ID NO.1 and the phenotypic values ​​of skirt hair length, body side hair length, head hair length, back hair length, and hair yield of Tianzhu white yaks using SPSS 25.0 software. The association between the genotype of this SNP locus and hair traits was calculated, and the results are shown in Table 2.

[0053] The model used is as follows:

[0054] Y j =μ+G j +e j ; where Y j Indicates the observed hair trait value; G j The genetic effect of genotype j; μ e represents the overall mean of each trait; j This indicates the random residual effect. Differences between groups were tested using LSD multiple comparisons, and the results are expressed as Mean ± SE.

[0055] Table 2. Association analysis of FGF5 gene polymorphism and coat traits in Tianzhu white yaks.

[0056]

[0057] Note: Different lowercase superscript letters indicate significant differences (P < 0.05). This indicates a significant difference (P < 0.05).

[0058] Table 2 shows that the polymorphism at locus 25393687 on chromosome 6 of Tianzhu white yaks was significantly correlated with the length of lateral hair, head hair, and hair yield (P<0.05). Specifically, Tianzhu white yaks with genotype GG had significantly longer lateral hair, head hair, and hair yield than those with genotypes CC and CG (P<0.05); Tianzhu white yaks with genotype CG had significantly longer head hair than those with genotype CC (P<0.05).

[0059] This embodiment identifies a SNP marker that is significantly associated with the wool production, lateral hair length, and head hair length traits of Tianzhu white yaks. Therefore, selecting individuals with the dominant genotype will help improve the wool production, lateral hair length, and head hair length traits of Tianzhu white yaks.

[0060] Based on the above results, the mutation sites of this invention can be used as potential genetic markers to improve the wool production performance of Tianzhu white yaks for auxiliary selection of Tianzhu white yaks.

[0061] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of reagents for detecting molecular markers in the preparation of reagents for early breeding of yak wool yield, body hair length, and head hair length traits, characterized in that, The molecular marker is located at position 25393687 on chromosome 6 of the yak reference genome Bosgu_v3.0 version European Nucleotide Archive accession number GCA_005887515.1, with a mutated base of C or G; The yak individuals with genotype GG had significantly longer body hair, longer head hair, and higher hair yield than those with genotypes CC and CG; the yak individuals with genotype CG had significantly longer head hair than those with genotype CC. The yaks mentioned are Tianzhu white yaks.

2. The application as described in claim 1, characterized in that, The nucleotide sequence containing the molecular marker is shown in SEQ ID NO.1, where the molecular marker is located at position 201.

3. The application as described in claim 1, characterized in that, The reagents include primer pairs for amplifying the molecular marker.

4. The application as described in claim 3, characterized in that, The nucleotide sequences of the primer pairs are shown in SEQ ID NO.2~3.

5. A method for detecting the wool yield, body hair length, and head hair length of yaks, characterized in that, Includes the following steps: (1) Extract yak genomic DNA as template DNA; (2) The template DNA obtained in step (1) was amplified by PCR using primers as shown in SEQ ID NO.2~3 to obtain PCR amplification products; (3) The PCR amplification product obtained in step (2) is purified and genotyping is performed to classify the yak individual genotypes into CC, CG and GG; the yak individuals with genotype GG have significantly higher body hair length, head hair length and hair production than individuals with genotypes CC and CG; the yak individuals with genotype CG have significantly higher head hair length than individuals with genotype CC.

6. A method for early selection of traits such as wool yield, body hair length, and head hair length in yaks, characterized in that, Includes the following steps: (1) Extract yak genomic DNA as template DNA; (2) The template DNA obtained in step (1) was amplified by PCR using primers as shown in SEQ ID NO.2~3 to obtain PCR amplification products; (3) Purify the PCR amplification product obtained in step (2) and perform genotyping detection. When the SNP molecular marker base is C, the genotype is CC or CG; when the SNP molecular marker base is G, the genotype is GG; the body hair length, head hair length and hair yield of yak individuals with genotype GG are significantly higher than those with genotypes CC and CG; the head hair length of yak individuals with genotype CG is significantly higher than that of yak individuals with genotype CC; select yak individuals with genotypes CG or GG for early breeding of hair yield, body hair length and head hair length traits.

Images