Recombinant triple-helical collagen with high temperature stability and self-assembly, and preparation method and application thereof

Abstract

The application belongs to the field of biological materials, and particularly relates to a recombinant triple-helical collagen protein with high-temperature stability and low-temperature self-assembly characteristics, and a preparation method and application thereof. The application provides a recombinant triple-helical collagen protein, the protein is efficiently expressed through a prokaryotic system, and the recombinant triple-helical collagen protein with high purity is obtained after separation and purification, so that the preparation cost is low, the protein has self-assembly characteristics and high heat-resistant stability under low-temperature conditions, and can enter human epidermis and dermal tissue in a short time, and can be effectively applied to skin repair and anti-wrinkle.

Description

Technical Field

[0001] This invention belongs to the field of biomaterials, specifically relating to a high-temperature stable and self-assembled recombinant triple-helix collagen, its preparation method, and its application. Background Technology

[0002] Type III collagen is an important member of the collagen family, mainly found in human skin, fascia, tendons, and other areas, providing these tissues with elasticity and strength. Type III collagen has a triple helix structure, strong cell adhesion, promotes tissue regeneration, and has high repair efficiency, making it effective for skin repair, anti-aging, moisturizing, and regeneration.

[0003] Type III collagen, also known as infant collagen, accounts for up to 80% of the skin of infants and young children. It is gradually lost with age, and after adulthood, dermal cells lose their ability to synthesize it, leading to decreased skin elasticity and increased wrinkles.

[0004] Traditional methods for extracting type III collagen have drawbacks. Animal-derived collagen differs in sequence from natural collagen, which can easily induce allergic reactions when used in humans. Furthermore, the extraction process can easily damage collagen activity and structure, leading to loss of function. Natural type III collagen has a short half-life in vivo, and unmodified type III collagen is prone to denaturation at high temperatures, losing its triple-helix structure and thus affecting its bioactivity. Therefore, there is an urgent need to design a biomaterial containing recombinant triple-helix collagen (humanized type III collagen) with low-temperature self-assembly and high-temperature stability for application in skin repair and anti-wrinkle fields. Summary of the Invention

[0005] The main objective of this invention is to provide a high-temperature stable and self-assembled recombinant triple-helix collagen, its preparation method, and its application.

[0006] One aspect of the present invention is to provide a recombinant triple-helix collagen having the amino acid sequence shown in SEQ ID NO. 1.

[0007] SEQ ID NO.1:

[0008] GPRGERGYYGYGGAPGPGPATPTGKYKAYYGGAGPAGAPGPGPATPTGKYKAYYGGAPGEKGEGGPRGDKGETGERGEPGPRGERGEPGGKGERGAPGEKGEGGPRGDKGETGERGEPGP RGERGEPGKGERGAPGEKGEGGPRGDKGETGERGEPGPRGERGEPGGKGERGAPGEKGEGGPRGDKGETGERGEPGPRGERGEPGKGERGAPGEKGEGGPRGDKGETGERGEPGPRGERG.

[0009] Optionally, the recombinant triple-helix collagen has an amino acid sequence with more than 90% sequence identity with the amino acid sequence shown in SEQ ID NO.1, and retains the same biological function as the amino acid sequence shown in SEQ ID NO.1.

[0010] Optionally, one or more amino acid residues may be added, substituted, deleted, or inserted into the amino acid sequence shown in SEQ ID NO.1, while retaining the same biological function as the amino acid sequence shown in SEQ ID NO.1.

[0011] One aspect of the present invention is to provide a nucleic acid molecule encoding a recombinant triple-helix collagen with high temperature stability and self-assembly, the nucleotide sequence of which is shown in SEQ ID NO.2.

[0012] SEQ ID NO.2:

[0013] ggcccgcgcggcgaacgcggctattatggctatggcggcgcgccgggcccgggcccggcg

[0014] accccgaccggcaaatataaagcgtattatggcggcgcgggcccggcgggcgcgccgggc

[0015] ccgggcccggcgaccccgaccggcaaatataaagcgtattatggcggcgcgccgggcgaa

[0016] aaaggcgaaggcggcccgcgcggcgataaaggcgaaaccggcgaacgcggcgaaccgggc

[0017] ccgcgcggcgaacgcggcgaaccgggcggcaaaggcgaacgcggcgcgccgggcgaaaaa

[0018] ggcgaaggcggcccgcgcggcgataaaggcgaaaccggcgaacgcggcgaaccgggcccg

[0019] cgcggcgaacgcggcgaaccgggcaaaggcgaacgcggcgcgccgggcgaaaaaggcgaa

[0020] ggcggcccgcgcggcgataaaggcgaaaccggcgaacgcggcgaaccgggcccgcgcggc

[0021] gaacgcggcgaaccgggcggcaaaggcgaacgcggcgcgccgggcgaaaaaggcgaaggc

[0022] ggcccgcgcggcgataaaggcgaaaccggcgaacgcggcgaaccgggcccgcgcggcgaa

[0023] cgcggcgaaccgggcaaaggcgaacgcggcgcgccgggcgaaaaaggcgaaggcggcccg

[0024] cgcggcgataaaggcgaaaccggcgaacgcggcgaaccgggcccgcgcggcgaacgcggc.

[0025] One aspect of the present invention is to provide a vector comprising a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO.2.

[0026] One aspect of the present invention is to provide an engineered bacterium comprising the aforementioned carrier. Preferably, the engineered bacterium is *Escherichia coli*.

[0027] One aspect of the present invention is to provide a method for preparing recombinant triple-helix collagen with high-temperature stability and self-assembly, specifically:

[0028] (1) Gene fragments were synthesized according to the nucleotide sequence shown in Seq ID NO.2, and the synthesized gene fragments were ligated overnight using T4 ligase and inserted between the restriction sites NcoⅠ and XhoⅠ on the pET32a plasmid to obtain recombinant plasmids;

[0029] (2) The recombinant plasmid was mixed with DH5α competent cells, electrolyzed, and then sorbitol solution was added. After mixing, the mixture was transferred to a sterile EP tube and incubated at 37°C for 1 hour. The mixture was then spread on ampicillin sodium-LB solid plates and incubated at 37°C upside down for 24 hours until a single colony grew. Single colonies were picked for colony PCR to verify the correctness of the positive clones. The recombinant prokaryotic expression vector was successfully constructed.

[0030] (3) Select plasmid vectors that are correctly expressed in the colonies, transform them into Escherichia coli BL21, screen single-spot clones with ampicillin sodium-LB solid plates, add 5 ml of LB medium and incubate overnight, transfer the bacterial culture at a volume ratio of 1:100 to LB medium, incubate in a shake flask at 37°C until the OD600 is between 0.4 and 0.6, add IPTG at a volume ratio of 1:5000 to LB medium, incubate at 20°C for 8-12 hours, centrifuge to collect the bacterial cells, and store them for further purification;

[0031] (4) Wash the precipitate with PBS buffer, resuspend the precipitate with 20-40 ml volume, lyse the bacteria with lysozyme and Triton-X, and then sonicate in an ice-water mixed environment for 2 seconds of sonication, 5 seconds of interval, sonication for 20 min, centrifugation at 12000 r / min for 20 min, and collect the supernatant.

[0032] (5) The induced supernatant was purified by cation exchange chromatography, and the protein corresponding to the elution peak was collected to obtain recombinant triple helix collagen with a purity of 98%.

[0033] Another aspect of the present invention is to provide a high-temperature stable and self-assembling recombinant triple-helix collagen, wherein the high-temperature stable and self-assembling recombinant triple-helix collagen of the present invention has the ability to self-assemble into a gel at low temperatures.

[0034] Another aspect of the present invention is to provide a high-temperature stable and self-assembled recombinant triple-helix collagen, wherein the high-temperature stable and self-assembled recombinant triple-helix collagen of the present invention has high heat stability.

[0035] Another aspect of the present invention is to provide an application of a high-temperature stable and self-assembled recombinant triple-helix collagen, preferably, said application is for the preparation of biomaterials that promote skin repair and anti-wrinkle effects.

[0036] The beneficial technical effects of the present invention are as follows:

[0037] Recombinant triple-helix collagen was prepared by constructing a prokaryotic expression system using designed nucleic acids encoding recombinant triple-helix collagen through genetic engineering technology. The recombinant triple-helix collagen prepared in this invention exhibits low-temperature self-assembly and high-temperature stability, and can penetrate human epidermal and dermal tissues within a short time, making it effective for skin repair and anti-wrinkle applications. Attached Figure Description

[0038] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0039] Figure 1 Image showing the low-temperature self-assembly of recombinant triple-helix collagen into a gel.

[0040] Figure 2 Circular dichroism chromatograms of recombinant triple-helix collagen at different temperatures;

[0041] Figure 3 : A diagram of mouse skin fibroblast proliferation experiment;

[0042] Figure 4 WB plot of Laminin protein;

[0043] Figure 5 : Human Raman transdermal experiment diagram;

[0044] Figure 6 Human anti-wrinkle experiment results. Detailed Implementation

[0045] The following detailed description of embodiments of the invention provided in the accompanying drawings is not intended to limit the scope of the claimed invention, but merely to illustrate selected embodiments of the invention. All other embodiments obtained by those skilled in the art based on the embodiments of the invention without inventive effort are within the scope of protection of the invention.

[0046] Example 1: Preparation of recombinant triple-helix collagen

[0047] Gene fragments were synthesized according to the nucleotide sequence shown in Seq ID NO.2, and the synthesized gene fragments were ligated overnight using T4 ligase and inserted between the restriction sites NcoⅠ and XhoⅠ on the pET32a plasmid to obtain recombinant plasmids;

[0048] The recombinant plasmid was mixed with DH5α competent cells, electroporated, and then sorbitol solution was added. After mixing, the mixture was transferred to a sterile EP tube and incubated at 37°C for 1 hour. The plasmid was then spread on ampicillin sodium-LB agar plates and incubated upside down at 37°C for 24 hours until a single colony grew. Single colonies were picked for colony PCR to verify the correctness of the positive clones, and the recombinant prokaryotic expression vector was successfully constructed.

[0049] Select plasmid vectors that are correctly expressed from the colonies and transform them into Escherichia coli BL21. Select single-spot clones using ampicillin sodium-LB solid plates, add 5 ml of LB medium and incubate overnight. Transplant at a volume ratio of 1:100 between bacterial culture and LB medium. Incubate in shake flasks at 37°C until the OD600 reaches 0.6. Add IPTG at a volume ratio of 1:5000 between IPTG and LB medium, incubate at 20°C for 12 hours, centrifuge to collect the bacterial cells, and store for further purification.

[0050] Wash the precipitate with PBS buffer, resuspend the precipitate in 30 ml, lyse the bacteria with lysozyme and Triton-X, and then sonicate in an ice-water mixed environment for 2 seconds, 5 seconds interval, sonicate for 20 min, centrifuge at 12000 r / min for 20 min, and collect the supernatant.

[0051] The induced supernatant was purified by cation exchange chromatography, and the protein corresponding to the elution peak was collected to obtain recombinant triple helix collagen with a purity of 98%.

[0052] Example 2: Low-temperature self-assembly properties of recombinant triple-helix collagen

[0053] The recombinant triple-helix collagen prepared in Example 1 was refrigerated at 4°C, and its gelation was observed with the naked eye.

[0054] The results showed that the prepared recombinant triple-helix collagen had the property of low-temperature self-assembly into a gel. Figure 1 ).

[0055] Example 3: High thermal stability experiment of recombinant triple-helix collagen self-assembled at low temperature

[0056] The recombinant triple-helix collagen obtained in Example 1 was lyophilized. A certain mass of the lyophilized powder was weighed and dissolved in a certain volume of deionized water to prepare a solution with a final concentration of 10 μM. The solution was placed in a micro-volume cuvette with a thickness of 1 mm to investigate the effect of temperature on the conformation of the recombinant triple-helix collagen. After reaching the set temperature and stabilizing, the mixture was incubated for 10-15 min, and the recombinant triple-helix collagen was analyzed by circular dichroism spectroscopy with a scanning wavelength range of 190-260 nm and an interval of 1 nm.

[0057] Circular dichroism spectroscopy was used to study the conformational changes of recombinant triple-helix collagen at different temperatures. The results showed that recombinant triple-helix collagen exhibited a strong absorption peak between 190-200 nm and possessed strong thermal stability. Figure 2 ).

[0058] Example 4: In vitro experiment on the promotion of skin fibroblast proliferation by recombinant triple-helix collagen with high temperature stability and self-assembly.

[0059] Mouse skin fibroblasts were selected and cultured in complete culture medium at 37°C and 5% carbon dioxide, with the cell concentration adjusted to 1.0 × 10⁻⁶ cells / year. 5 cells / ml - 5.0 × 10 5 Cells / ml, passaged for 24-36 hours, ready for use; discard the culture medium in the culture flask, digest and collect the cells, and prepare 5.0 × 10⁶ cells / ml complete cell culture medium. 5 cells / ml - 8.0×10 5 Cell suspension of cells / ml was seeded into 96-well cell culture plates at 100 μL per well and cultured at 37°C with 5% CO2. After 24 h, the suspension was replaced with PBS buffer and cultured at 37°C with 5% CO2 for another 24 h. The prepared cell culture plates were then cleaned of PBS buffer and 0.05 mg / ml of standard (commercially available animal-derived type III collagen) and 0.05 mg / ml of recombinant triple-helix collagen from Example 1 were added. For the negative control, PBS was added at 100 μL per well, and the plates were cultured at 37°C with 5% CO2 for 64-72 h. 20 μL of MTT solution was added to each well, and the plates were cultured at 37°C with 5% CO2 for 6 h. All procedures were performed under aseptic conditions. After discarding the liquid in the culture plates, 100 μL of DMSO was added to each well, mixed well, and the absorbance was measured at 570 nm using a microplate reader with 630 nm as the reference wavelength. The results were recorded.

[0060] The results showed that the high-temperature stability and self-assembled recombinant triple-helix collagen of this application significantly promoted the proliferation of skin fibroblasts compared with the standard (Table 1). Figure 3 ).

[0061] Table 1: Experimental results on promoting the proliferation of mouse skin fibroblasts

[0062]

[0063] Example 5: High-temperature stability and in vivo anti-wrinkle experiment of self-assembled recombinant triple-helix collagen in animals

[0064] (1) Constructing a photoaging mouse model: Six-week-old SPF-grade ICR mice were divided into a blank group, a standard group, and an experimental group. After the hair on the back of the ICR mice was shaved, they were treated with ultraviolet lamps for 8 consecutive weeks to induce skin aging.

[0065] (2) After 8 weeks, the blank group received no treatment, the standard group received 0.05 mg / ml of standard (commercially available animal-derived type III collagen) applied to the irradiated area, and the experimental group received 0.05 mg / ml of recombinant triple-helix collagen from Example 1 applied to the irradiated area. The application was performed once a day for 8 weeks.

[0066] (3) Regularly observe the skin condition at the irradiation site, record the data, collect the skin tissue from the back of the mouse, and use the WB method to detect the content of Laminin protein.

[0067] The results showed that, visually, the skin on the backs of mice in the standard and experimental groups was smooth, with few wrinkles and a certain degree of elasticity. In contrast, the skin on the backs of mice in the blank group showed severe photoaging, dryness, looseness, increased wrinkles, and melanin deposition. Western blotting showed that the expression level of Laminin protein in the experimental group was slightly higher than that in the standard group, and the expression levels of Laminin protein in both the experimental and standard groups were significantly higher than those in the blank group, demonstrating that the high-temperature stability and self-assembled recombinant triple-helix collagen of this invention have excellent skin repair and anti-wrinkle effects. Figure 4 ).

[0068] Example of results: High-temperature stability and self-assembly of recombinant triple-helix collagen in human trials.

[0069] Select a suitable subject whose skin is in good condition and who has not used any other drugs or cosmetics that may affect the test results.

[0070] (1) The high-temperature stability and skin permeability of the self-assembled recombinant triple-helix collagen of the present invention were verified by human Raman transdermal experiments. Subjects applied 0.1 mg / ml of the high-temperature stable and self-assembled recombinant triple-helix collagen of the present invention, and the skin was scanned using a confocal Raman spectrometer at 0, 05, 2, 3, 4, 6, 8, and 12 h, and the Raman spectral signals were recorded. The results showed that at the corresponding 0, 05, 2, 3, 4, 6, 8, and 12 h, the relative permeability of the high-temperature stable and self-assembled recombinant triple-helix collagen of the present invention was 0%, 0.21%, 0.95%, 2.38%, 2.76%, 4.18%, 6.03%, and 7.20%, respectively. The collagen entered the epidermis at 3 h and the dermis at 4 h. Figure 5 ).

[0071] (2) The anti-wrinkle efficacy of cosmetics was tested using T / ZHCA 006-2019 "Test Method for Anti-wrinkle Efficacy of Cosmetics". The condition of the crow's feet before the subjects used the collagen of this invention was recorded. The subjects applied 0.1 mg / ml of the high-temperature stable and self-assembled recombinant triple-helix collagen of this invention once a day for 4 weeks, and the condition of the crow's feet was observed. The results showed that after 4 weeks of application of the high-temperature stable and self-assembled recombinant triple-helix collagen of this invention, there was a significant anti-wrinkle effect. Figure 6 ).

[0072] The above description is merely an optional embodiment of the present invention and does not limit the patent scope of the present invention. All equivalent structural transformations made using the contents of the present invention's specification and drawings under the inventive concept of the present invention, or direct / indirect applications in other related technical fields, are included within the patent protection scope of the present invention.

Claims

1. A recombinant triple-helical collagen protein that is stable at high temperatures and self-assembles, characterized in that, The amino acid sequence of the high-temperature stable and self-assembled recombinant triple-helical collagen protein is shown as SEQ ID NO.

1.

2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the high-temperature stable and self-assembled recombinant triple-helical collagen protein of claim 1.

3. The nucleic acid molecule of claim 2, wherein, The sequence of the nucleic acid molecule is shown as SEQ ID NO.

2.

4. A vector, characterized by, The vector comprises the nucleic acid molecule of claim 2 or 3.

5. An engineered bacterium, characterized in that, The engineered bacteria comprise the nucleic acid molecule of claim 2 or 3 or the vector of claim 4.

6. The engineered bacterium of claim 5, wherein, The engineered bacteria are Escherichia coli.

7. A method of preparing a high temperature stable and self-assembling recombinant triple helical collagen protein according to claim 1, characterized by, The nucleic acid shown as SEQ ID NO. 2 is introduced into a plasmid, then transformed into Escherichia coli, cultured, induced for expression, and finally the recombinant triple-helical collagen protein is obtained through separation and purification.

8. Use of the high-temperature stable and self-assembled recombinant triple-helical collagen protein of claim 1 in the preparation of a biological material for skin repair and anti-wrinkle.

Images