Preparation method for microwave-assisted synthesis of near-infrared electrochemical luminescence gold nanocluster and application of gold nanocluster in miRNA detection
Methionine-coated gold nanoclusters were prepared by microwave-assisted method, and TEOA@Au NPs/Co3O4/NiCo2O4 was used as a co-reactant and co-catalyst to solve the problem of low electrochemiluminescence efficiency of gold nanoclusters, thus achieving highly sensitive detection of MicroRNA-107, which has the potential for clinical diagnostic applications.
Patent Information
- Application Number
- CN202511228707.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-29
- Publication Date
- 2025-12-12
AI Technical Summary
Existing gold nanoclusters exhibit poor efficiency in electrochemiluminescence, limiting their widespread application in biosensors. In particular, the slow charge transfer in electrochemiluminescence leads to low efficiency of gold nanoclusters in electrochemiluminescence, further restricting their application in bioassays.
Methionine-coated gold nanoclusters were prepared using a microwave-assisted method, and TEOA@Au NPs/Co3O4/NiCo2O4 was used as a co-reactant and co-catalyst. The microwave-assisted method was used to improve the near-infrared fluorescence and electrochemiluminescence efficiency, and a high-sensitivity microRNA-107 detection method was developed.
It significantly improves the intensity of near-infrared electrochemiluminescence, achieves high-sensitivity detection of MicroRNA-107, has good biocompatibility and electrocatalytic performance, and is suitable for early clinical diagnosis of cancer.
Smart Images

Figure CN121108973A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of analytical chemistry and nanotechnology, and particularly to a preparation method of microwave-assisted synthesis of near-infrared electrochemiluminescence gold nanoclusters and application thereof in miRNA detection. BACKGROUND
[0002] Electrochemiluminescence (ECL) technology combines the characteristics of electrochemistry and chemiluminescence, and has attracted more and more attention in the application of biosensing (immunoassay and gene analysis strategy) due to its inherent advantages such as high sensitivity, zero background signal, simple setup, good controllability, and short time consumption. It is well known that ECL emitters play a crucial role in the development and application of ECL. In addition, various types of ECL luminophores (such as organic small molecules, polymers, and inorganic materials) have also been widely developed. Among them, gold nanoclusters (Au NCs) are considered as a promising biocompatible ECL luminophore with multiple properties such as low toxicity, chemical stability, ultrafine size, unique optical properties, and high biocompatibility.
[0003] However, due to the slow charge transfer in the electrogeneration process, Au NCs generally have the problem of poor ECL efficiency, which is still a major challenge, which limits the wide application in ECL bioassay. Generally speaking, the conventional synthesis method of Au NCs is usually a simple, single-point, green synthesis method without using reducing agents under water conditions. It is well known that Au NCs (BSA−Au NCs, GSH−Au NCs) prepared by this method usually show two PL peaks, i.e. a visible fluorescence peak from the core and a near-infrared fluorescence peak from the surface state. In particular, methionine (Met)-encapsulated Au NCs exhibit strong luminescence (608 nm) and weak luminescence (825 nm). However, the ECL emission spectrum of Met-Au NCs is affected by the surface state (835 nm). Therefore, adjusting the surface state is an effective way to improve the ECL efficiency. Microwave-assisted method for preparing nanomaterials has the advantages of high pressure, high yield, and short reaction time, and is one of the most promising nanomaterial preparation technologies. However, there are few reports on the ECL performance of Au NCs using microwave-assisted method. In the present application, Met-Au NCs are prepared by microwave-assisted method, and the near-infrared fluorescence and ECL emission thereof are different from those prepared by ordinary mild method, and the near-infrared ECL intensity is significantly improved.
[0004] On this basis, the present application uses TEOA@AuNPs / Co3O4 / NiCo2O4 as a co-reactant and a reaction-accelerating agent, and prepares new Met−Au NCs with near-infrared fluorescence and ECL performance by microwave-assisted method. The metal nanoclusters exhibit good sensing potential in the detection of MicroRNA-107. SUMMARY
[0005] To solve the above technical problems, the application provides a microwave-assisted synthesis of near-infrared electrochemiluminescence gold nanoclusters and application thereof in miRNA detection. Specifically, it relates to an electrochemiluminescence analysis method using methionine (Met) coated gold nanoclusters as a marker, triethanolamine (TEOA) modified gold nanoparticles / Co3O4 / NiCo2O4 as a co-reactant and a reaction accelerator. The Met stabilized Au NCs prepared by the microwave-assisted method have higher fluorescence and electrochemiluminescence efficiency at 835 nm than the Au NCs prepared by the ordinary mild method. In addition, the TEOA@Au NPs / Co3O4 / NiCo2O4 composite shows a "two birds with one stone" effect in ECL performance. First, TEOA@Au NPs as a co-reactant can generate a large number of reducing intermediate free radicals TEOA •+ without adding a co-reactant in the solution. Second, because Au NPs / Co3O4 / NiCo2O4 has good electrocatalytic effect and excellent catalytic performance, it can be used as a new type of reaction catalyst for TEOA catalysis. Therefore, a "signal-off" ECL biosensor for high-sensitivity detection of MicroRNA-107 is developed.
[0006] The first object of the application is to provide a microwave-assisted synthesis of near-infrared electrochemiluminescence gold nanoclusters, comprising the following steps: (1) under stirring, gold source and alkali are added to a Met solution to obtain a mixed solution, and microwave irradiation reaction is performed, and solid-liquid separation is performed to obtain a Met-Au NCs solution; (2) the Met-Au NCs solution is activated with EDC and NHS, a DNA solution is added and mixed, and then dialysis is performed to obtain a Met-Au NCs-DNA composite, i.e. the near-infrared electrochemiluminescence gold nanocluster.
[0007] In some embodiments of the application, in step (1), the gold source is selected from HAuCl4·3H2O; the mass ratio of the gold source to Met is 0.5:(10-12); the alkali is selected from sodium hydroxide and / or potassium hydroxide; In some embodiments of the application, in step (2), the activation time is 30-60 min; the microwave power in the microwave irradiation reaction is 200-400 W, and the irradiation time is 10-30 min.
[0008] The second object of the application is to provide a near-infrared electrochemiluminescence gold nanocluster obtained by the preparation method.
[0009] A third object of the present application is to provide an electrochemiluminescence sensor, taking GCE as a base electrode, modifying TEOA@Au NPs / Co3O4 / NiCo2O4 on the surface of the base electrode, and then modifying the obtained near-infrared electrochemiluminescence gold nanoclusters on the surface to obtain the electrochemiluminescence sensor.
[0010] A fourth object of the present application is to provide a preparation method of the electrochemiluminescence sensor, comprising the following steps: S1, dissolving TEOA and a gold source in a solvent, stirring and heating to obtain a TEOA@Au NPs solution; S2, mixing a 2-methyl imidazole solution and a Co(NO3)2·6H2O solution, and reacting at room temperature for aging, and drying to obtain ZIF-67; S3, dispersing ZIF-67 in a nickel source solution, centrifuging to obtain a solid phase and drying to obtain egg yolk shell particles, and annealing to obtain Co3O4 / NiCo2O4; S4, mixing and reacting the TEOA@Au NPs solution obtained in step S1 and the Co3O4 / NiCo2O4 solution to obtain TEOA@Au NPs / Co3O4 / NiCo2O4; S5, modifying TEOA@Au NPs / Co3O4 / NiCo2O4 on the surface of GCE to obtain TEOA@Au NPs / Co3O4 / NiCo2O4 / GCE, and dropping Met-Au NCs-DNA on TEOA@Au NPs / Co3O4 / NiCo2O4 / GCE and incubating overnight to obtain the electrochemiluminescence sensor.
[0011] In some embodiments of the present application, in step S1, the gold source is selected from HAuCl4·3H2O; and the concentration of the gold source is 35-45 mM; The concentration of TEOA is 20-60 mM; The heating temperature is 100℃, and the heating time is 50 min.
[0012] In some embodiments of the present application, in step S2, the molar ratio of the 2-methyl imidazole solution to Co(NO3)2·6H2O is (15-30):1; The room temperature aging reaction time is 12-36 h; The drying temperature is 50-90℃, and the time is 4-8 h.
[0013] In some embodiments of the present application, in step S3, the mass ratio of ZIF-67 to the nickel source is 1:(1-2); The nickel source is selected from one or more of Ni(NO3)2.6H2O, NiSO4 and NiCl2; The drying temperature is 50-90 DEG C, and the time is 8-12 h. The annealing treatment condition is: increasing the temperature to 250-450 DEG C at 0.5-2 DEG C / min, and the annealing time is 1-3 h.
[0014] In some embodiments of the application, in step S4, the mass ratio of Au and Co3O4 / NiCo2O4 in TEOA@Au NPs is 0.025-0.05.
[0015] A fifth object of the application is to provide the use of the electrochemiluminescence sensor in detecting MicroRNA-107, and the detection process further comprises a duplex-specific nuclease (DSN).
[0016] In some embodiments of the application, the following steps are included: adding the electrochemical sensor into a mixed solution containing MicroRNA-107 to be detected and a duplex-specific nuclease (DSN) for incubation, and measuring the ECL signal response of the electrochemical sensor in the electrolyte to realize qualitative and quantitative detection of MicroRNA-107.
[0017] In some embodiments of the application, in the quantitative detection, the standard curve is prepared by the following method: A series of MicroRNA-107 standard solutions with different concentrations are provided, mixed with the duplex-specific nuclease (DSN) to obtain a mixed solution, then the electrochemical sensor is added into the mixed solution respectively, and the ECL signal response is detected, and according to the linear correlation between the ECL signal value and the logarithm of the concentration of MicroRNA-107, a standard curve is obtained.
[0018] The above technical solution of the application has the following advantages compared with the prior art: The application provides a method for synthesizing near-infrared electrochemiluminescence gold nanoclusters by microwave assistance, and the preparation method is green, environmentally friendly, simple and fast, and has good reproducibility.
[0019] The application develops a precedent for developing Au NCs with high electrochemiluminescence efficiency by microwave assistance, and also explores the application prospect of TEOA@Au NPs / Co3O4 / NiCo2O4 in the field of biological analysis.
[0020] The application provides a novel reaction catalyst Au NPs / Co3O4 / NiCo2O4 for catalyzing TEOA, and the reaction catalyst has good electrocatalytic effect and excellent catalytic performance.
[0021] The application provides a preparation method of the sensor, and the Met-Au NCs / TEOA@Au NPs / Co3O4 / NiCo2O4 system can be used for sensitive detection of MicroRNA-107 in a range of 10 fM to 10 nM, and the detection limit is 0.68 fM. In modern biological analysis, the method can provide a new perspective for improving the ECL response of the Met-Au NCs / TEOA@Au NPs / Co3O4 / NiCo2O4 system, and provide a new insight for improving the sensitivity of nucleic acid detection. The sensor is simple to operate, has good repeatability, and has important scientific significance and application value for early clinical diagnosis of cancer. BRIEF DESCRIPTION OF DRAWINGS
[0022] In order to make the content of the application more easily understood, the application will be further described in detail below according to specific embodiments of the application and in combination with the drawings, in which, Figure 1 A high-magnification transmission electron microscope image of Met-Au NCs prepared in the embodiments of the application.
[0023] Figure 2 A size distribution histogram of Met-Au NCs prepared in the embodiments of the application.
[0024] Figure 3 Ultraviolet absorption and fluorescence spectrum diagrams of Met-Au NCs prepared in the embodiments of the application.
[0025] Figure 4 A fluorescence lifetime curve diagram of Met-Au NCs prepared in the embodiments of the application.
[0026] Figure 5 An electrochemiluminescence spectrum diagram of Met-Au NCs prepared in the embodiments of the application.
[0027] Figure 6 FT-IR spectrum diagrams of methionine and Met-Au NCs prepared in the embodiments of the application.
[0028] Figure 7 XPS spectrum diagrams of methionine and Met-Au NCs prepared in the embodiments of the application.
[0029] Figure 8 A SEM diagram of TEOA@Au NPs / Co3O4 / NiCo2O4 prepared in the embodiments of the application.
[0030] Figure 9 Elemental mapping of TEOA@Au NPs / Co3O4 / NiCo2O4 prepared in the embodiments of the present application.
[0031] Figure 10 XPS spectrum of TEOA@Au NPs / Co3O4 / NiCo2O4 prepared in the embodiments of the present application.
[0032] Figure 11 Electrochemiluminescence response curve of the assembly process of the MicroRNA-107 electrochemiluminescence sensor in the embodiments of the present application.
[0033] Figure 12 Electrochemical impedance spectrum curve of the assembly process of the MicroRNA-107 electrochemiluminescence sensor in the embodiments of the present application.
[0034] Figure 13 Electrochemiluminescence response curve of the MicroRNA-107 sensor prepared in the embodiments of the present application to 10 fM ~ 10 nM MicroRNA-107.
[0035] Figure 14 Linear calibration curve of the sensor prepared in the embodiments of the present application to 10 fM ~ 10 nM MicroRNA-107.
[0036] Figure 15 Selectivity test diagram of the MicroRNA-107 electrochemiluminescence sensor prepared in the embodiments of the present application.
[0037] Figure 16 Stability test diagram of the MicroRNA-107 electrochemiluminescence sensor prepared in the embodiments of the present application.
[0038] Figure 17 Repeatability test diagram of the MicroRNA-107 electrochemiluminescence sensor prepared in the embodiments of the present application.
[0039] Figure 18 Preparation process flow diagram of the sensor provided in the embodiments of the present application. DETAILED DESCRIPTION
[0040] The present application will be further described below in conjunction with the drawings and specific embodiments, so that those skilled in the art can better understand the present application and implement it, but the embodiments are not limiting to the present application.
[0041] Example 1 This embodiment provides a method for preparing near-infrared electrochemiluminescence gold nanoclusters with microwave assistance and its application in miRNA detection, as detailed below: I. Preparation of TEOA@Au NPs / Co3O4 / NiCo2O4 / GCE and Met−Au NCs−DNA complex, as detailed below: S1: Under vigorous stirring, add 0.4 mL of a solution with a concentration of 6.25 mg·mL⁻¹. −1 HAuCl4·3H2O and 0.5 mL of solution with a concentration of 22 mg·mL −1 NaOH was added sequentially to 2 mL of a solution with a concentration of 30 mg·mL⁻¹. −1 A mixed solution was obtained by irradiating the Met (methionine) solution with a household microwave oven at 300 W for 20 min. The resulting precipitate was centrifuged at 10000 rpm / min for 5 min, and the solid was collected and redispersed in 2 mL of ultrapure water to obtain a Met-Au NCs solution. The obtained Met-Au NCs were structurally characterized, and the results are shown in the figure. Figures 1 to 7 .
[0042] S2: Take 1 mL of the Met-Au NCs solution obtained in step S1, and use 30 mg·mL⁻¹ −1 After activation with EDC and NHS for 40 min, the activated Met-Au NCs were centrifuged and purified. 1 mL of 2 μM DNA solution (sequence: SH−TTTTTGAGGCGCAGTCTATGATAGCCCTGTACAATGCTGCTTAGACTGCG−COOH) was added and mixed at 4 °C for 4 h. The mixture was then dialyzed through a 3 kDa Millipore filter membrane for 72 h to obtain the Met-Au NCs-DNA complex.
[0043] S3: Add 1 mL of 0.1 M TEOA and 100 μL of 42.8 mM HAuCl4·3H2O to 17.5 mL of aqueous solution at 100℃, stir and heat for 50 min to obtain TEOA@Au NPs solution.
[0044] S4: 25 mL of 4 mM 2-methylimidazole solution (methanol) was quickly poured into 1 mL of 4 mM Co(NO3)2·6H2O solution (methanol), aged at room temperature for 24 h, heated at 70 °C for 6 h, and dried to obtain ZIF-67.
[0045] S5: 40 mg of ZIF-67 obtained in step S4 was dispersed in an ethanol solution of Ni(NO3)2·6H2O (80 mg). After stirring for 30 min, it was centrifuged and collected, and the obtained egg yolk shell particles were annealed after drying at 70°C for 10 h. The annealing temperature was increased by 1°C·min −1 to 350°C, and the annealing time was 2 h, to obtain a Co3O4 / NiCo2O4 solution.
[0046] S6: 400 μL of TEOA@Au NPs solution prepared in step S3 was mixed with 2 mL of Co3O4 / NiCo2O4 solution obtained in step S5, with a concentration of 2 mg·mL -1 for 24 h, and the solid-liquid separation was performed to obtain the material TEOA@Au NPs / Co3O4 / NiCo2O4, which was then dispersed in ultrapure water and stirred for standby. The obtained material TEOA@Au NPs / Co3O4 / NiCo2O4 was subjected to structural characterization, and the results are shown in FIG. 6. Figures 8 to 10 .
[0047] S7: 10 μL of TEOA@Au NPs / Co3O4 / NiCo2O4 with a concentration of 2 mg·mL −1 was modified on the surface of a GCE to obtain TEOA@Au NPs / Co3O4 / NiCo2O4 / GCE. 20 μL of Met-Au NCs-DNA was dropped on TEOA@Au NPs / Co3O4 / NiCo2O4 / GCE and incubated overnight. The modified GCE was incubated in 3 wt% BSA for 30 min to block the excess active groups, to obtain a Met-Au NCs-DNA-TEOA@Au NPs / Co3O4 / NiCo2O4 / GCE electrochemiluminescence biosensor.
[0048] Detection of MicroRNA-107 The modified Met-Au NCs-DNA-TEOA@Au NPs / Co3O4 / NiCo2O4 / GCE electrochemiluminescence biosensor was incubated with 5 μL of MicroRNA-107 [purchased from Shanghai Sangon Biotech Co., Ltd. (Shanghai, China), AGCAGAUUGUACAGGGCUAUCA] and 5 μL of 0.2 U double-stranded specific nuclease [DSN, SH−TTTTTGAGGCGCAGTCTATGATAGCCCTGTACAATGCTGCTTAGACTGCG−COOH, purchased from Evrogen (Moscow, Russia)]. The separated Met-Au NCs and residual DNA fragments were washed away with ultrapure water. The modified GCE was measured in 0.1 M, pH 7.4 phosphate electrolyte (PBS buffer prepared from dipotassium hydrogen phosphate, potassium dihydrogen phosphate, and potassium chloride). The experimental results are shown below. Figures 11 to 12 .
[0049] Characterization and performance testing like Figure 1 The high-magnification transmission electron microscopy image shown indicates that the Met-Au NCs have a uniform particle size; and Figure 2 The particle size was 2.4 ± 0.2 nm, and the particles were monodisperse.
[0050] from Figure 3 (Curve a) shows that in the ultraviolet range, the absorption spectrum of Met-Au NCs decreases significantly with increasing wavelength. The fluorescence emission spectrum of Met-Au NCs shows a strong peak at 828 nm and a weak peak at 530 nm. Figure 3 (Curve b).
[0051] The fluorescence lifetime curves of Met−Au NCs were fitted using an exponential model, as follows: Figure 4 As shown, the fluorescence lifetime of Met-Au NCs is 132.02 ns at an emission wavelength of 828 nm.
[0052] like Figure 5 As shown, the ECL spectrum of Met-Au NCs is at 820 nm, and the maximum PL emission spectrum is at 828 nm.
[0053] To further demonstrate the formation of Met-Au NCs, the FT-IR spectra of methionine and Met-Au NCs are as follows: Figure 6 As shown.
[0054] like Figure 7 The XPS spectra shown indicate that Met-Au NCs are mainly composed of Au, S, C, N, and O. High-resolution XPS of Au is observed in Au 4f...7 / 2 (84.1 eV) and Au 4f 5 / 2 (87.8 eV) Figure 7 The presence of two strong peaks indicates the coexistence of Au(I) and Au(0) metallic states within the Au NCs.
[0055] These results indicate that the preparation of methionine-protected Au NCs was successful.
[0056] As Figure 8 The SEM images show that a large number of Au NPs were successfully modified onto the surface of Co3O4 / NiCo2O4.
[0057] As Figure 9 The elemental mapping of TEOA@Au NPs / Co3O4 / NiCo2O4 shows that the elements Co, O, Ni, and Au belong to Au NPs and Co3O4 / NiCo2O4 structures, respectively, indicating that Au NPs were modified onto the surface of Co3O4 / NiCo2O4.
[0058] The chemical composition and element valence of TEOA@Au NPs / Co3O4 / NiCo2O4 were analyzed by XPS. As shown in Figure 10 The prepared TEOA@Au NPs / Co3O4 / NiCo2O4 sample contains Au, Ni, Co, O, and C.
[0059] The above results indicate the successful synthesis of TEOA@Au NPs / Co3O4 / NiCo2O4.
[0060] As Figure 11 The bare GCE and TEOA@Au NPs / Co3O4 / NiCo2O4 / GCE did not show obvious electrochemiluminescence signals (curves a and b). The electrochemiluminescence emission reached a maximum after interaction with Met−Au NCs-DNA (curve c). A significant decrease in the electrochemiluminescence signal was observed after DSN-assisted MicroRNA-107 cycling amplification (curve d), indicating the detachment of Met−Au NCs from the electrode surface. These results verified the successful preparation of the biosensor.
[0061] Next, electrochemical impedance spectroscopy was applied to evaluate the assembly process of the electrochemiluminescence biosensor. As Figure 12As shown, the bare GCE presented a semicircular domain, representing the mass transfer process (curve a). After modification of the electrode with TEOA@Au NPs / Co3O4 / NiCo2O4, a slightly larger arch was obviously shown than the bare GCE, indicating an increase in electron transfer resistance (curve b). After interaction with Met−Au NCs−DNA, the electron transfer resistance was further increased (curve c). The specific DNA−RNA binding and nuclease cleavage can trigger the detachment of Au NCs, promoting the acceleration of electron transfer and the decrease of impedance (curve d). The changes in electrode impedance values correspond to the assembly process of the biosensor, confirming the success of the electrode assembly process.
[0062] Preparation of detection standard curve The prepared electrochemiluminescence biosensor was tested for the response signal to different concentrations of MicroRNA-107, and the results are shown in Figure 13 . As can be seen from the figure, from 10 fM to 10 nM, the ECL response gradually decreased with the increase of the concentration of MicroRNA-107. In addition, as shown in Figure 14 , the ECL signal showed an excellent linear correlation with the logarithm of the concentration of MicroRNA-107. The corresponding linear regression equation is I ECL = −13.074 – 2.117 lg C (R 2 = 0.9980). The obtained LOD is 0.68 fM, and the obtained biosensor realizes sensitive detection of MicroRNA-107.
[0063] Selectivity test To evaluate the selectivity, the response of the prepared electrochemiluminescence biosensor to 1 nM target MicroRNA-107 was compared with the response of blank samples and 10 nM other miRNA sequences [MicroRNA-21 (sequence: UAGCUUAUCAGACUGAUGUUGA) and MicroRNA-141 (sequence: GGUAGAAAUGGUCUGUCACAAU) purchased from Shanghai Sangon Biological Engineering Co., Ltd. (Shanghai, China)], and the experimental results are shown in Figure 15 . As can be seen from the figure, the ECL intensity of the control miRNA and the blank sample decreased very little, while the target MicroRNA-107 caused a significant decrease in ECL intensity. In addition, the ECL response to MicroRNA-107 was comparable to that observed in the mixture of MicroRNA-107 and potential interferents, further proving the high selectivity of the biosensor.
[0064] Stability test The prepared electrochemiluminescence biosensor was tested for 5 times repeatedly when detecting 0.1 pM and 1 nM MicroRNA-107, and the experimental results are shown in Figure 16 From the figure, it can be seen that the biosensor showed good operational stability under 10 cycles of continuous scanning from 0 to +1.6 V, with relative standard deviation (RSD) of 2.84% (0.1 pM) and 3.18% (1 nM) for MicroRNA-107 detection Figure 16 ).
[0065] Reproducibility test Seven electrochemiluminescence biosensors were prepared in parallel according to Example 1, and the response signals of the prepared electrochemiluminescence biosensors to 10 pM MicroRNA-107 were tested, and the experimental results are shown in Figure 17 From the figure, it can be seen that reproducibility was evaluated by measuring 10 pM MicroRNA-107. As shown in Figure 17 , there was no significant difference between 7 electrodes, with RSD as low as 2.05% (10 pM), indicating that the designed biosensor had good reproducibility.
[0066] Obviously, the above examples are only examples for clarity and do not limit the embodiments. For those skilled in the art, other different forms of changes or variations can be made on the basis of the above description. Here, it is not necessary and impossible to enumerate all the embodiments. The obvious changes or variations derived therefrom are still within the protection scope of the present application.
Claims
1. A method for preparing near-infrared electrochemiluminescent gold nanoclusters with microwave assistance, characterized in that, Includes the following steps: (1) Under stirring conditions, gold source and alkali were added to methionine solution to obtain mixed solution, and microwave irradiation reaction was carried out. Solid-liquid separation was performed to obtain Met-Au NCs solution; (2) The Met-Au NCs solution was activated with EDC and NHS, DNA solution was added and mixed, and then dialyzed to obtain the Met-Au NCs-DNA complex, namely the near-infrared electrochemiluminescent gold nanoclusters.
2. The preparation method according to claim 1, characterized in that, In step (1), the gold source is selected from HAuCl4·3H2O; the mass ratio of the gold source to methionine is 0.5:(10~12); the base is selected from sodium hydroxide and / or potassium hydroxide; In step (2), the activation time is 30~60min; the microwave power in the microwave irradiation reaction is 200~400W, and the irradiation time is 10~30min.
3. A near-infrared electrochemiluminescent gold nanocluster, characterized in that, Obtained by the preparation method according to any one of claims 1 to 2.
4. An electrochemiluminescence sensor, characterized in that, Using GCE as the base electrode, TEOA@Au NPs / Co3O4 / NiCo2O4 is modified on the surface of the base electrode, and then the near-infrared electrochemiluminescent gold nanoclusters obtained in claim 3 are modified on the surface to obtain the electrochemiluminescent sensor.
5. A method for preparing an electrochemiluminescence sensor as described in claim 4, characterized in that, Includes the following steps: S1. Dissolve TEOA and gold source in a solvent, stir and heat to obtain TEOA@Au NPs solution; S2. Mix 2-methylimidazole solution and Co(NO3)2·6H2O solution, age at room temperature, and dry to obtain ZIF-67; S3. Disperse ZIF-67 in a nickel source solution, centrifuge to collect the solid phase and dry it to obtain egg yolk shell particles, and perform annealing treatment to obtain Co3O4 / NiCo2O4; S4. Mix the TEOA@Au NPs solution obtained in step S1 with the Co3O4 / NiCo2O4 solution to obtain TEOA@Au NPs / Co3O4 / NiCo2O4; S5. Modify the GCE surface with TEOA@Au NPs / Co3O4 / NiCo2O4 to obtain TEOA@Au NPs / Co3O4 / NiCo2O4 / GCE. Drop-coat Met-Au NCs-DNA onto TEOA@Au NPs / Co3O4 / NiCo2O4 / GCE and incubate overnight to obtain the electrochemiluminescence sensor.
6. The preparation method according to claim 5, characterized in that, In step S1, the gold source is selected from HAuCl4·3H2O; the concentration of the gold source is 35~45 mM; The concentration of TEOA is 20~60 mM; The heating temperature is 100℃, and the heating time is 50 min; In step S2, the molar ratio of 2-methylimidazole solution to Co(NO3)2·6H2O is (15~30):1; The aging reaction time at room temperature is 12~36 h; The drying temperature is 50~90℃, and the time is 4~8 hours.
7. The preparation method according to claim 5, characterized in that, In step S3, the mass ratio of ZIF-67 to nickel source is 1:(1~2); The nickel source is selected from one or more of Ni(NO3)2·6H2O, NiSO4, and NiCl3; The drying temperature is 50~90℃, and the time is 8~12 h; Annealing conditions: heat to 250-450℃ at a rate of 0.5-2℃ / min, annealing time 1-3h; In step S4, the mass ratio of Au to Co3O4 / NiCo2O4 in TEOA@Au NPs is 0.025~0.
05.
8. The application of the electrochemiluminescence sensor of claim 4 in the detection of miRNA, wherein the detection process further includes a double-stranded specific nuclease; the miRNA includes MicroRNA-107.
9. The application according to claim 8, characterized in that, Includes the following steps: The electrochemical sensor was incubated in a mixture containing miRNA and double-stranded specific nuclease. The ECL signal response of the electrochemical sensor was measured in the electrolyte to achieve qualitative and quantitative detection of miRNA.
10. The application according to claim 8, characterized in that, In the quantitative detection, the standard curve is prepared by the following method: A series of miRNA standard solutions of different concentrations were provided and mixed with double-stranded specific nucleases to obtain a mixture. Then, an electrochemical sensor was added to the mixture and the ECL signal response was detected. Based on the linear correlation between the ECL signal value and the logarithm of the miRNA concentration, a standard curve was obtained.
Citation Information
Cited By
Beta-cyclodextrin modified electrochemical luminescence gold-cerium bimetallic nanocluster, preparation method and application of nanocluster in electrochemical luminescence-impedance dual-mode detection of malathion
CN122104225A
A beta-cyclodextrin modified electrochemiluminescence gold cerium bimetallic nanocluster, a preparation method and application thereof in electrochemiluminescence-impedance dual-mode detection of malathion
CN122104225B