Recombinant cell line and application

Abstract

The invention belongs to the technical field of biology, and discloses a recombinant cell line, and the cell line is one of an MDCK-siat7e-7 # targeting cell line and an MDCK-siat7e-66 # targeting cell line; the preservation unit of the MDCK-siat7e-7 # targeting cell line is the Guangdong Microbial Culture Collection Center; the preservation time is March 8, 2024; the preservation number is GDMCC NO: 64399; the preservation unit of the MDCK-siat7e-66 # targeting cell is the Guangdong Microbial Culture Collection Center; the preservation time is March 8, 2024; the preservation number of the strain is GDMCC NO: 64400. The cell line has relatively high rescue efficiency and multiplication capacity on CAV-2. Meanwhile, the invention also provides application of the recombinant cell line.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biology, and particularly relates to a recombinant cell line and use. BACKGROUND

[0002] Human adenovirus vectors are widely used in the fields of vaccine production, gene therapy, cancer treatment, etc., but the safety and immunogenicity of the vectors themselves limit their clinical application. It is found that CAV-2 can only replicate and grow in cells of canids, and even in human or monkey cells, it has a low level of replication but cannot be packaged into virus particles, has high safety, and does not have immunogenicity to the human body, so CAV-2 has become a research hotspot of viral vectors.

[0003] MDCK is one of the cell lines most suitable for CAV-2 production. MDCK suspension cells use serum-free culture, do not need enzyme digestion for subculture, and directly proliferate in a reactor for production, which has the advantages of low cost, simple culture operation, controllable culture conditions, convenient sampling, low pollution rate, and can realize large-scale production. However, the suspension cells also have the disadvantages of low transfection or electroporation efficiency and difficulty in genomic modification.

[0004] CN112370531B discloses a heat-resistant protective agent for canine distemper, canine parvovirus, canine adenovirus, and canine parainfluenza quadruple live vaccine, and a preparation method and application thereof. The specification records: canine adenovirus virus liquid propagation: take well-grown MDCK suspension cells, inoculate the reactor at a cell density of 6-9x10 5 cells / ml, set the reactor parameters (temperature 37℃, dissolved oxygen 45%-60%, pH 7.1). Culture for 48-72 hours, when the cell density is ≥3x10 6 cells / ml, inoculate the conventional vaccine with canine adenovirus type II seed virus at 1% of the culture volume. Culture for 48-72 hours, when about 50% of the cells show cytopathic effect, harvest the virus liquid and store it at-40℃ or below for testing.

[0005] If MDCK cells are not optimized, the interferon-related antiviral system in MDCK cells will have a great impact on the replication of viruses in them, which will limit the yield of MDCK cell matrix viruses. It is known that interferons have a broad spectrum of antiviral effects and play an important role in the immune resistance of cells to viruses, among which type I interferons are the most important. After type I interferons bind to their receptors, the tail conformation of the cytoplasm of the receptor changes, and then phosphorylates JAK1 (one of the Janus kinase family) and TYK2 (one of the Janus kinase family), thereby further phosphorylating STAT (signal transducer and activator of transcription, with 7 family members, named STAT1-STAT7) to form STAT1-STAT2 dimers, and then with IRF9 (interferon regulatory factor 9) to form an interferon-stimulated gene factor 3 (ISGF3) ternary complex.

[0006] Therefore, in the prior art, by knocking out the type I interferon gene, destroying the type I interferon receptor, and blocking the strong antiviral effect of interferons, the yield of viral vaccines in cell matrix is improved. For example, CN116948975A IFNAR1 gene knockout MDCK cell strain and its construction method and application;

[0007] However, the above-mentioned operation of knocking out the type I interferon gene has limited effect on effectively promoting virus rescue and proliferation, especially for CAV-2 viruses.

[0008] The problem to be solved by the present application is how to develop a cell line that can effectively improve the rescue and proliferation of CAV-2. SUMMARY

[0009] The purpose of the present application is to provide a recombinant cell line that has high rescue efficiency and proliferation capacity for CAV-2.

[0010] Meanwhile, the present application also proposes the use of the recombinant cell line.

[0011] To achieve the above-mentioned purpose, the present application discloses a recombinant cell line, which is one of MDCK-siat7e-7# targeting cell line and MDCK-siat7e-66# targeting cell line.

[0012] The MDCK-siat7e-7# targeting cell line is preserved in the Guangdong Microbial Culture Collection Center, with a preservation time of March 8, 2024, a preservation number of GDMCC No: 64399, and a preservation address of 5th Floor, Building 59, Guangzhou Xianlie Middle Road 100, Guangdong Academy of Microbiology Institute; the taxonomic name is MDCK.

[0013] The MDCK-siat7e-66# targeting cell is preserved in the Guangdong Microbial Culture Collection Center, with a preservation time of March 8, 2024, a preservation number of GDMCC No: 64400, and a preservation address of 5th Floor, Building 59, Guangzhou Xianlie Middle Road 100, Guangdong Academy of Microbiology Institute; the taxonomic name is MDCK.

[0014] Meanwhile, the application also discloses a use of culturing viruses by using the recombinant cell line.

[0015] In the use, the virus is a canine type 2 adenovirus.

[0016] The application has the following beneficial effects:

[0017] The application places E1A, E1B1 and E1B2 under CAGGS, hCMV and mCMV strong promoters respectively, and constructs a targeting vector together with a human Siat7e gene; the CRISPR / Cas9 technology and homologous recombination are used to perform gene targeting on STAT1 gene of MDCK, the targeting vector is integrated into the 4th exon of STAT1 gene, the exogenous gene is introduced, STAT1 is inactivated, and finally a clone with optimal performance is obtained.

[0018] Finally, the application obtains 667 MDCK targeting cells by targeting, 42 clones with positive left homologous arm (HA-L) and right homologous arm (HA-R) and complete insertion fragments (Full length-F1, F2, F3) are obtained, and the accuracy is 6.30%. PCR is performed by taking the clone genome as a template and taking Primer 11 / Primer 12 as primers, and 42 clones have a product with a size of about 915bp, which indicates that all the clones are single-allele recombination; the PCR product is sequenced, and the sequencing result shows that some clones have frame shift mutation on the allele without recombination, some have insertion or deletion of a multiple of 3 bases, and some do not have mutation.

[0019] After screening by detecting virus rescue efficiency and titer of the above-mentioned targeting cells, the MDCK-siat7e-7# targeting cell line and the MDCK-siat7e-66# targeting cell line with significant advantages in rescue efficiency and proliferation are obtained. BRIEF DESCRIPTION OF DRAWINGS

[0020] Figure 1 A development roadmap of the present application;

[0021] Figure 2 A structure diagram of the targeting vector;

[0022] Figure 3 A construction diagram of the plasmid pUC-amp-Siat7e;

[0023] Figure 4 An enzyme digestion identification result of the plasmid 01p15A-cm-HA1-cHS4-PGK-Siat7e-cHS4-HA2;

[0024] Figure 5 An enzyme digestion identification result of the plasmid 01p15A-cm-HA1-cHS4-PGK-Siat7e-cHS4-HA2-amp-ccdB;

[0025] Figure 6 An enzyme digestion identification result of the plasmid 03p15A-amp-CAGGS-E1A-IRES-Neo-CMV-E1B1-mCMV-E1B2;

[0026] Figure 7 An enzyme digestion identification result of the plasmid 03p15A-cm-cHS4-CAGGS-E1A-IRES-Neo-CMV-E1B1-mCMV-E1B2-PGK-Siat7e;

[0027] Figure 8A A sequencing result of pBR322-U6-STAT1-gRNA1-tracrRNAnew-amp;

[0028] Figure 8B A sequencing result of pBR322-U6-STAT1-gRNA2-tracrRNAnew-amp;

[0029] Figure 9 A position diagram of the PCR detection primer of the cloned part;

[0030] Figure 10A A PCR identification result of the cloned part;

[0031] Figure 10B A PCR identification result of the cloned part;

[0032] Figure 10C PCR identification results of partial clones;

[0033] Figures 11A to 11H Mutation identification results of partial particles;

[0034] Figure 12 Identification results of expression levels of E1A, E1B1, E1B2 of different clones;

[0035] Figure 13 Statistical results of pathogenic progress of different cell lines;

[0036] Figure 14A Partial cytopathic effect pictures of different cell lines;

[0037] Figure 14B Partial cytopathic effect pictures of different cell lines;

[0038] Figure 15 Cytopathic effect pictures of CAV2-ELANE F2 generation MDCK-S-7#, 66#;

[0039] Figure 16 Cytopathic effect pictures of CAV2-G9 F3 generation MDCK-S-66#. DETAILED DESCRIPTION

[0040] The application will be described in detail below with reference to the embodiments thereof, and it needs to be noted that, in the description of the application, the specific conditions not mentioned in the embodiments are carried out according to the conventional conditions or the conditions suggested by the manufacturers. The reagents or instruments not mentioned by the manufacturers are all conventional products that can be obtained by market purchase.

[0041] First part of the foregoing

[0042] With reference to the second part to the ninth part of the application, and with reference to Figure 1 The creative idea of the application can be clearly understood in a more systematic way. Figure 1 It is a research and development roadmap of the application.

[0043] The application places E1A, E1B1 and E1B2 under CAGGS, hCMV and mCMV strong promoters respectively, and constructs a targeting vector together with a human Siat7e gene; the CRISPR / Cas9 technology and homologous recombination are used to perform gene targeting on the STAT1 gene of MDCK, the targeting vector is integrated into the 4th exon of the STAT1 gene, the exogenous gene is introduced at the same time, and the STAT1 is inactivated; the cell is evaluated from the rescue efficiency and production titer of the replication-defective recombinant CAV-2, the suspension property, the passage stability and the like, so as to obtain the clone with the optimal performance.

[0044] Figure 2 Figure 1 is a structural schematic diagram of the targeting vector.

[0045] Second part of the targeting vector construction

[0046] 2.1 Gene synthesis

[0047] The DNA fragment as shown in the following was synthesized by Genewiz Biotechnology Co., Ltd. and inserted into the pUC-amp vector, and the plasmid was named pUC-amp-PGK-Siat7e. The synthetic sequence is SEQ ID NO. 1. Figure 3

[0048] 2.2 Construction of 01p15A-cm-HA1-cHS4-PGK-Siat7e-cHS4-HA2-amp-ccdB

[0049] The synthesized pUC57-amp-PGK-Siat7e was digested with AscI enzyme, and the fragment between the 7th base and the 3536th base in SEQ ID NO. 1 was recovered, and the fragment was named PGK-Siat7e-AscI;

[0050] PCR p15A-cm, PCR STAT1-HA1, and PCR STAT1-HA2 were obtained by PCR, and the sequences are SEQ ID NO. 2, SEQ ID NO. 3, and SEQ ID NO. 4, respectively;

[0051] PGK-Siat7e-AscI, PCR p15A-cm, PCR STAT1-HA1, and PCR STAT1-HA2 were subjected to 4-fragment assembly in GB05-dir (source document: Fu J, Bian X, Hu S, Wang H, Huang F, Seibert PM, Plaza A, Xia L, Müller R, Stewart AF, Zhang Y. Full-length RecE enhances linear-linear homologous recombination and facilitates direct cloning for bioprospecting. Nat Biotechnol. 2012 May; 30(5): 440-6.), and the assembled plasmid was named 01p15A-cm-HA1-cHS4-PGK-Siat7e-cHS4-HA2;

[0052] ​The plasmid 01p15A-cm-HA1-cHS4-PGK-Siat7e-cHS4-HA2 was identified by double enzyme digestion with Ncol / EcoRI, and the identification results are shown in Figure 4 PCR amp-ccdB, the sequence of which is shown in SEQ ID NO. 5; the fragment PCR amp-ccdB and the 01p15A-cm-HA1-cHS4-PGK-Siat7e-cHS4-HA2 were co-transformed into the induced GBred-gyrA462 competent cells (source document: Wang H, Bian X, Xia L, Ding X, Muller R, Zhang Y, Fu J, Stewart AF. Improved seamless mutagenesis by recombineering using ccdB for counterselection. Nucleic Acids Res. 2014 Mar; 42(5): e37.), and linear circular recombination was performed to obtain the plasmid 01p15A-cm-HA1-cHS4-PGK-Siat7e-cHS4-HA2-amp-ccdB; the plasmid was identified by double enzyme digestion with ApaLI / EcoRV, and the identification results are shown in Figure 5 .

[0053] 2.3 Construction of 02p15A-amp-CAGGS-E1A-IRES-Neo-CMV-E1B1-mCMV-E1B2

[0054] The fragment CAGGS-E1A-EcoRV / HindIII was obtained by enzyme digestion, and the sequence is shown in SEQ ID NO. 6; the fragment PCR IRES-Neo-SV40_pA -E1B1 was obtained by the method of tandem PCR, and the sequence is shown in SEQ ID NO. 7; the fragment CMV-SpeI / NheI was obtained by enzyme digestion, and the sequence is shown in SEQ ID NO. 8; the fragments PCR mCMV, PCRE1B2-bGH_pA, and PCR p15A-amp were all obtained by PCR, and the sequences are shown in SEQ ID NO. 9, SEQ ID NO. 10, and SEQ ID NO. 11, respectively;

[0055] CAGGS-E1A-EcoRV / HindIII, PCR IRES-Neo-SV40_pA -E1B1, CMV-SpeI / NheI, PCR mCMV, PCRE1B2-bGH_pA, and PCR p15A-amp were subjected to 6-fragment assembly in GBdir, and the assembly plasmid was named as:

[0056] 03p15A-amp-CAGGS-E1A-IRES-Neo-CMV-E1B1-mCMV-E1B2; the plasmid was identified by ApaLI enzyme digestion, and the identification results are shown in Figure 6

[0057] 2.4 Construction of 03p15A-cm-cHS4-CAGGS-E1A-IRES-Neo-CMV-E1B1-mCMV-E1B2-PGK-Siat7e

[0058] 01p15A-cm-HA1-cHS4-PGK-Siat7e-cHS4-HA2-amp-ccdB constructed in 2.2 was digested with NdeI, and a 10225bp fragment was recovered for later use;

[0059] 02p15A-cm-cHS4-CAGGS-E1A-IRES-Neo-CMV-E1B1-mCMV-E1B2 constructed in 2.3 was digested with EcoRV, and an 8607bp fragment was recovered for later use;

[0060] p15A-amp-CAGGS-E1A-IRES-Neo-CMV-E1B1-mCMV-E1B2 was digested with EcoRI / ApaLI, and an 8607bp fragment was recovered for later use;

[0061] The above two fragments were ligated in GBdir to obtain 03p15A-cm-cHS4-CAGGS-E1A-IRES-Neo-CMV-E1B1-mCMV-E1B2-PGK-Siat7e, and the plasmid was identified by EcoRI / ApaLI double enzyme digestion, and the identification results are shown in Figure 7

[0062] Construction of gRNA expression plasmid in the third part

[0063] A pair of gRNAs were designed at the 4th exon of the MDCK STAT1 gene using the gRNA design website (http: / / crispor.tefor.net / ); two oligos were designed for the subsequent expression plasmid construction.

[0064] Oligo-gRNA1:

[0065] TTATATATCTTGTGGAAAGGACGAAACACCGGcagcaaagtgagaaacgtgagtttAagagctaTGCTGGAAACAGCAtagc

[0066] Oligo-gRNA2:

[0067] ​​TTATATATCTTGTGGAAAGGACGAAACACCGG tgtgatgttagacaagcagagttT AagagctaTGCTGGAAACAGCAtagc

[0068] Enzymatic digestion of the fragment pBR322-U6-tracrRNAnew-amp-NheI, the sequence of which is shown in SEQ ID NO. 12;

[0069] The enzymatic fragments were co-transformed with Oligo-gRNA1 and Oligo-gRNA2, respectively, and pBR322-U6-STAT1-gRNA1-tracrRNAnew-amp and pBR322-U6-STAT1-gRNA2-tracrRNAnew-amp were obtained by linear recombination; sequencing was performed to verify the correctness of the clones, and the sequencing results are shown in SEQ ID NO. 13 and SEQ ID NO. 14, respectively. Figure 8A and Figure 8B

[0070] Fourth part of targeting

[0071] (1) Cell preparation: 18-24h before transfection, MDCK cells (MDCK(NBL-2): ATCC CCL-34) were transferred to a 6-well plate so that they reached about 80% confluence at the time of transfection, and the culture medium was replaced with a new one for standby;

[0072] (2) Reagent preparation: X-tremeGENE HP DNA transfection reagent, DNA and diluent (low serum medium) were warmed to room temperature, gently vortexed and centrifuged for standby; TM

[0073] ​​​(3) DNA dilution: Put 100 μL dilution into 1.5 ml centrifuge tube, add 3 μg p15A-cm-cHS4-CAGGS-E1A-IRES-Neo-CMV-E1B1-mCMV-E1B2-PGK-Siat7e, 0.3 ug pBR322-U6-STAT1-gRNA1-tracrRNAnew-amp, 0.3 ug pBR322-U6-STAT1-gRNA2-tracrRNAnew-amp and 1.4 ug Cas9 expression plasmid (source document: Baker O, Gupta A, Obst M, Zhang Y, Anastassiadis K, Fu J, Stewart AF. RAC-tagging: Recombineering And Cas9-assisted targeting for protein tagging and conditional analyses. Sci Rep. 2016 May 24; 6: 25529.) in turn, mix well and reserve;

[0074] (4) Transfection reagent dilution: Put 100 μL dilution into 1.5 ml centrifuge tube, add 25 μL X-tremeGENE TM HP DNA transfection reagent, mix well and reserve;

[0075] (5) Transfection complex incubation: Mix the diluted DNA in step (3) and the diluted transfection reagent in step (4) gently, incubate at room temperature for 15-30 min to obtain the transfection complex;

[0076] (6) Transfection: Add the transfection complex in step (5) dropwise to the cells prepared in step (1), gently shake the culture dish to ensure uniform distribution, and place it in a 37°C cell incubator;

[0077] (7) Plating: About 24 h later, the cells are digested into single cells and transferred to 5 10 cm diameter plates containing complete culture medium without antibiotics, and cultured in a 37°C cell incubator;

[0078] (8) Drug screening: About 24 h later, replace the screening medium containing G418 antibiotic, replace every 2-3 days, and continue to culture for 7-8 days until single colonies are obvious;

[0079] (9) Pick single colonies into 96-well plates, about 2-3 days later (most wells reach more than 80% confluence), divide one well into two wells, 1 well for identification, 1 well for backup preservation;

[0080] (10) When the wells to be used for identification reach a confluence of about 50%, genome extraction and PCR detection are performed.

[0081] After the above operations, a total of 667 clones were obtained for identification.

[0082] Part 5 PCR Identification

[0083] A total of 667 clones were identified. 42 clones were positive for both the left homologous arm (HA-L) and the right homologous arm (HA-R) and had complete inserts (Full length - F1, F2, F3), with an accuracy rate of 6.30%. PCR primers are shown in Table 3, and a schematic diagram of the PCR primer positions is shown below. Figure 9 Some PCR identification results are as follows: Figures 10A to 10C As shown.

[0084] Using cloned genomes as templates and Primer 11 / Primer 12 as primers (sequences shown in Table 2), PCR was performed. All 42 clones produced products of approximately 915 bp, indicating that all clones underwent single-allelic recombination. Next-generation sequencing of the PCR products revealed that some clones had frameshift mutations in the non-recombined alleles, some had insertions or deletions of multiples of 3, while others showed no mutations. Some sequencing results are shown below. Figures 11A to 11H As shown.

[0085] Table 2 Primer sequence list

[0086]

[0087] Part VI. qRT-PCR detection of gene expression levels

[0088] According to the instructions of "Tiangen RNAprep Pure Total RNA Extraction Kit for Cultured Cells / Bacteria (Centrifuged Column), Catalog No. DP430", total RNA of the clones shown in Table 3 was extracted; according to "RaKaRa PrimeScript TM The RT reagent kit with gDNA Eraser (Perfect Real Time), Code No. RR047A, was used to reverse transcribe total RNA into cDNA; according to the instructions of "RaKaRa TB"... Premix Ex Taq TM (Tli RNaseH Plus), Code No. RR420A, followed the instructions for quantitative PCR with fluorescent dye. GT-7# was used as the standard "1" for relative quantification. Results are as follows: Figure 12 As shown, the primer sequences used are listed in Table 4.

[0089] In general, the expression levels of E1A, E1B1, and E1B2 were higher in transposition than in gene targeting; in terms of mRNA expression levels, GT-36# had a relative advantage in the gene targeting clones.

[0090] Table 3 Cloning Information Table

[0091] Genome editing (allele / allele) Clone number Homologous recombination / frame shift mutation GT-7#, GT-33#, GT-36#, GT-78# Homologous recombination / number of deleted bases is a multiple of 3 GT-66# Homologous recombination / no mutation GT-81#, GT-83# Transposition T-5#, T-6#, T-8#, T-11#, T-12#

[0092] Table 4 Primer Sequence Table

[0093]

[0094] Seventh Part Comparison of Rescue Efficiency of CAV2-5-8G by MDCK Targeting Cell Lines

[0095] The rescue efficiency of the MDCK modified cell line is crucial for the rescue of the replication-defective recombinant CAV2 virus. In order to improve the rescue efficiency, a cell line suitable for CAV2 rescue was screened. According to the mRNA expression levels of E1A, E1B1, E1B2, and siat7e, MDCK targeting cell lines MDCK-siat7e-7# (GT-7# in Table 4), MDCK-siat7e-33# (GT-33# in Table 4), MDCK-siat7e-36# (GT-36# in Table 4), MDCK-siat7e-66# (GT-66# in Table 4), MDCK-siat7e-78# (GT-78# in Table 4) based on CRISPR-Cas9 technology and MDCK transposition cell line MDCK-E1-11# (T-11# in Table 4) based on PiggyBac transposition technology were used for the rescue of replication-defective CAV2-5-8G.

[0096] The rescued replication-defective CAV2-5-8G is a recombinant canine type 2 adenovirus, which is preserved in the China Center for Type Culture Collection; the preservation date is March 13, 2024; the preservation number is CCTCC NO: V202415; the address of the preservation unit is Wuhan, Wuhan University, China; the classification name is Recombinant canine adenovirus type 2 CAV2-5-8G (Recombinant canine adenovirus type 2).

[0097] The transfection system was a single hole of a 6-well plate, and the plasmid used was:

[0098] p15A-cm-CAV2-delE1-mCMV-ERA-G-SV40 polyA (referred to as plasmid CAV2-5-8G), and the addition amount of the plasmid CAV2-5-8G was 3ug.

[0099] The nucleotide sequence of the foreign gene of the plasmid CAV2-5-8G is referred to as SEQ ID NO. 13.

[0100] 7.1 X-tremeGENE TM HP DNA transfection rescue method

[0101] MDCK targeting cell lines were inoculated in 6-well plates and transfected when the cell density was 70-90%; X-tremeGENE TM HP DNA transfection reagent, CAV2-5-8G plasmid DNA and diluent (Opti-MEM medium) were restored to room temperature and vortexed gently for standby; 200ul diluent was placed in a sterile test tube, and the plasmid DNA was added and mixed gently; 200ul diluent was placed in a sterile test tube, and 9ul X-tremeGENE TM HP DNA transfection reagent, and the gun head was stirred to mix; the diluted DNA and the diluted transfection reagent were mixed, and the transfection complex was obtained after incubation at room temperature for 20min; the transfection complex was added dropwise to the cells, and the culture plate was gently shaken to evenly distribute the transfection complex, and incubated in a 5% carbon dioxide incubator at 37°C. Each experimental group was repeated in 6-well plates.

[0102] 7.2 Obtaining of recombinant virus CAV2-5-8G

[0103] After transfection for 3-5d, the cells in each experimental group were observed daily, and the rescued virus supernatant was collected for further blind passage. The cells in each experimental group were observed for CPE after blind passage for 3-5d.

[0104] 7.3 Comparison of CAV2-5-8G rescue efficiency

[0105] After blind passage of the F1 generation virus liquid, the cells showed cytopathic effect (CPE), such as swelling, rounding, clustering, clustering into grape-like shape, increased permeability, and severe cell shedding, which were typical cell lesions. The cell lesion process of the six MDCK modified cell lines was compared, as shown in Figure 13 and Figure 14A and Figure 14B .

[0106] MDCK-siat7e-7#, MDCK-siat7e-36#, MDCK-siat7e-66#, MDCK-siat7e-78#, MDCK-E1-11# experimental group part hole cells appeared CPE, MDCK-siat7e-33# experimental group cells CPE less; according to the number of each experimental group of cells, the number of holes, the rescue efficiency of different MDCK modified cell lines from high to low in turn for: MDCK-siat7e-66# (83%) > MDCK-siat7e-7# (66%) = MDCK-siat7e-36# (66%) > MDCK-siat7e-78# (33%) = MDCK-E1-11# (33%) > MDCK-siat7e-33# (16%).

[0107] Apparently, MDCK targeting cell lines progress of cytopathic than transposition cell lines, then the time required for rescue is shortened, MDCK targeting cell lines have higher rescue efficiency.

[0108] Eighth part of different MDCK targeting cell lines to compare the ability of virus production

[0109] 8.1 different MDCK targeting cell lines to proliferate replication defective CAV2-5-8G virus suspension production

[0110] MDCK-E1 11# and MDCK-siat7e-7#, MDCK-siat7e-33#, MDCK-siat7e-36#, MDCK-siat7e-66#, MDCK-siat7e-78# cells were inoculated in T25 cell bottle, when the cell density reached 80%, the replication defective CAV2-5-8G was inoculated in T25 cell bottle at MOI = 0.05, and then placed in the cell culture box for culture. When 90% of the cells were cytopathic, the cell suspension was collected and the cell pellet was collected, and then repeated freezing and thawing at -80℃ and room temperature, and centrifugation to collect the supernatant, which was the virus suspension produced by different cell lines.

[0111] 8.2 comparison of virus suspension titers produced by different MDCK modified cell lines

[0112] 2*10 4 ~4*10 4MDCK-modified cell lines (MDCK-E1 11#, MDCK-siat7e-7#, MDCK-siat7e-33#, MDCK-siat7e-36#, MDCK-siat7e-66#, and MDCK-siat7e-78#) were inoculated into 96-well plates. When the cell density reached 80%, the culture medium was discarded, and the cells were washed twice with PBS. The collected CAV2-5-8G supernatant was then serially inoculated into the corresponding MDCK-modified cell lines in 96-well plates, with 100 μL of diluted virus inoculated into each well. Viral titers were measured. Cytopathic effects were observed after 3–5 days, and TCID was calculated using the Reed-Muench method. 50 .

[0113] The results showed that the measured viral titer was: TCID of MDCK-siat7e-7#. 50 10 -6.64 TCID of MDCK-siat7e-33# 50 10 -5.67 TCID of MDCK-siat7e-36# 50 10 -6.33 TCID of MDCK-siat7e-66# 50 10 -6.67 TCID of MDCK-siat7e-78# 50 10 -6.64 MDCK-E1 11# TCID 50 10 -6.7 .

[0114] In summary, the viral proliferation capacity of different MDCK-modified cell lines, from highest to lowest, is as follows: MDCK-E111# > MDCK-siat7e-66# > MDCK-siat7e-7# = MDCK-siat7e-78# > MDCK-siat7e-36# > MDCK-siat7e-33#. This indicates that the MDCK-E1 11# transposon cell line we constructed has a higher proliferation titer than the MDCK-targeted cell line and is more suitable for the proliferation of recombinant canine adenovirus type 2.

[0115] This indicates that the cells can increase the proliferation titer of recombinant canine adenovirus type 2, have a strong toxin-producing capacity, save production costs, and thus improve production efficiency.

[0116] In summary, according to the comparison of the rescue efficiency and toxin production capacity of the MDCK modified cell lines, MDCK-siat7e-7# and MDCK-siat7e-66# targeting cell lines can be used for subsequent rescue experiments of replication-defective CAV2, and MDCK-E1-11# transposition cell line is more suitable for virus multiplication experiment after rescue of recombinant virus CAV2.

[0117] The ninth part uses the screened MDCK targeting cell line to rescue the recombinant

[0118] CAV2

[0119] 9.1 Rescue of recombinant CAV2 containing different antigen genes

[0120] The MDCK-siat7e-7# and MDCK-siat7e-66# cells screened above were selected to rescue the recombinant viruses CAV2-ELANE and CAV2-G9, wherein CAV2-ELANE was not rescued successfully in MDCK-E1-11# cells for multiple times.

[0121] The transfection system was a single hole of a 6-well plate, and the plasmids used were p15A-cm-CAV2-mCMV-ELANE-SV40polyA (abbreviated as CAV2-ELANE) and p15A-cm-CAV2-delE1-mCMV-ERA G optimized according to canine adenovirus type II optimized-SV40polyA (abbreviated as CAV2-G9), and the addition amount of the plasmids was 3ug.

[0122] 9.2 Transfection:

[0123] The MDCK-siat7e-7# and MDCK-siat7e-66# cells were inoculated in a 6-well plate, and when the cell density was 70-90%, transfection was performed; X-tremeGENE TM HP DNA transfection reagent was used for transfection of CAV2-ELANE and CAV2-G9 plasmids; 200ul diluent was placed in a sterile test tube, and the plasmid DNA was added and mixed gently; 200ul diluent was placed in a sterile test tube, and 9ul X-tremeGENE TM HP DNA transfection reagent was used for transfection of CAV2-ELANE and CAV2-G9 plasmids; 200ul diluent was placed in a sterile test tube, and the plasmid DNA was added and mixed gently; 200ul diluent was placed in a sterile test tube, and 9ul X-tremeGENE

[0124] 9.3 MDCK-siat7e-7# and MDCK-siat7e-66# targeting cell lines rescue recombinant virus CAV2

[0125] After 3-5 days of transfection, the cells in each experimental group were observed, and the supernatant was collected for further blind passage. The cells in each experimental group were observed for CPE after 3-5 days of blind passage.

[0126] When the recombinant virus CAV2-ELANE experimental group was blindly passed to the F2 generation, the MDCK-Siat7e-7# and MDCK-Siat7e-66# cells showed typical CPE, and the cells were large and round, gathered into grape-like clusters, and fell off. Figure 15 The MDCK-S7# and MDCK-S66# cells showed obvious CPE. When the CAV2-G9 plasmid experimental group was blindly passed to the F3 generation, the MDCK-S 66# cells showed typical CPE, the cells were large and round, gathered into grape-like clusters, and fell off, etc. (such as Figure 16 ).

[0127] Two viruses were rescued: recombinant virus CAV2-ELANE and recombinant virus CAV2-G9.

[0128] The recombinant virus CAV2-ELANE is a recombinant canine adenovirus type 2, which is preserved in the China Center for Type Culture Collection, with a preservation date of March 13, 2024, a preservation number of CCTCC NO: V202422, and an address of China. Wuhan. Wuhan University. Its classification and naming are as follows: recombinant canine adenovirus type 2 CAV2-ELANE (Recombinant canine adenovirus type 2).

[0129] The recombinant virus CAV2-G9 is a recombinant canine adenovirus type 2, which is preserved in the China Center for Type Culture Collection, with a preservation date of March 13, 2024, a preservation number of CCTCC NO: V202421, and an address of China. Wuhan. Wuhan University. Its classification and naming are as follows: recombinant canine adenovirus type 2 CAV2-G9 (Recombinant canine adenovirus type 2).

[0130] The above experiments again demonstrate that the MDCK-siat7e-7# and MDCK-siat7e-66# targeting cell lines are suitable for the rescue of recombinant virus CAV2, which can improve the rescue efficiency of recombinant virus CAV2, reduce the research cost of the vaccine, and facilitate the development of recombinant canine adenovirus type 2 vector vaccine.

Claims

1. A recombinant cell line, characterized in that, The cell line is one of the MDCK-siat7e-7# and MDCK-siat7e-66# target cell lines; The MDCK-siat7e-7# targeting cell line is deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 8, 2024, with accession number GDMCC NO:64399. The deposit address is: 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. The taxonomic name is: canine kidney cell MDCK. The MDCK-siat7e-66# target cells were deposited at the Guangdong Provincial Center for Microbial Culture Collection on March 8, 2024, with accession number GDMCC NO:64400. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou. The taxonomic name is canine kidney cells MDCK.

2. Use of the recombinant cell line for culturing viruses as described in claim 1.

3. The use according to claim 2, characterized in that, The virus in question is canine adenovirus type 2.

Images