Linear RNA precursor, circular RNA and preparation method and application thereof

Abstract

The invention discloses a linear RNA (Ribonucleic Acid) precursor, a circular RNA as well as a preparation method and application of the linear RNA precursor and the circular RNA. The linear RNA precursor comprises a 5'outer homologous arm, a 3 'intron, a 3' exon, a 5 'inner homologous arm, a 5' spacer, an IRES sequence, an insertion exogenous sequence GOI, a 3 'spacer, a 3' inner homologous arm, a 5 'exon, a 5' intron and a 3 'outer homologous arm from the 5'end to the 3' end. The DNA sequences of the 5'and 3 'outer homologous arms, the 5' and 3 'spacers and the 5' and 3 'inner homologous arms are sequences shown as Seq ID No.1 to Seq ID No.6 in sequence. Through optimization of the homologous arms on the inner side and the outer side, the splicing activity of the intron can be better exerted, and the cyclization efficiency is improved; through spacer optimization, translation efficiency, cyclization efficiency and stability are improved. According to the preparation method disclosed by the invention, through optimization of multiple steps, the cyclization efficiency and the stability, purity and quality of the circular RNA are improved, and large-scale production is easy to realize.

Description

Technical Field

[0001] This application relates to the field of circular RNA technology, and in particular to a linear RNA precursor, circular RNA, its preparation method and application. Background Technology

[0002] mRNA is a completely new type of biological drug, and mRNA technology will transform the entire biopharmaceutical industry.

[0003] mRNA technology possesses platform-like characteristics, enabling rapid research and development, easy scale-up, and high production efficiency, thereby reducing drug costs. This technology can be widely used in vaccines, protein replacement therapies, cell and gene therapies, thus attracting significant investment from industry and academia in technology and product development. Currently, mRNA technology primarily utilizes linear mRNA, with 5' cap and 3' polyA structures at their ends. In eukaryotes, a series of enzymes mediate the degradation of linear RNA, resulting in poor stability and a relatively short duration of action after entering cells, necessitating repeated administration. Therefore, RNA technologies with relatively longer half-lives are highly anticipated.

[0004] Naturally occurring circular RNA (circRNA) was first discovered in yeast cells and subsequently confirmed to be widely present in eukaryotes. Its main form is non-coding RNA (ncRNA), and some circRNAs can also be translated into active proteins. The linear RNA precursor forms a closed, terminal-less circular loop through backsplicing. Based on this structure, circRNAs exhibit greater stability. Lacking linear ends for nuclease recognition / binding, circRNAs avoid most enzymatic degradation activities and are less susceptible to breakage and degradation due to cellular environmental factors. Therefore, they can be continuously expressed in cells. Studies have shown that compared to linear RNA, circRNAs can mediate more efficient and persistent RNA editing, with effects lasting up to 21 days.

[0005] Because of these advantages, scientists are dedicated to developing efficient RNA circularization methods that can be applied to RNA technology platforms. Currently, in vitro RNA circularization can be performed through several methods: chemical synthesis, enzymatic ligation, and permuted intron-exon (PIE).

[0006] Chemical synthesis achieves cyclization through the ligation of DNA-RNA hybrids, but the ligation efficiency is low, and the resulting bonds are 2',5'-phosphodiester bonds instead of the natural 3',5'-phosphodiester bonds. Therefore, it is not commonly used in actual production. Enzymatic methods use several nucleic acid ligases to catalyze the in vitro cyclization of linear RNA precursors. This method has precise ligation sites, but the cyclization efficiency is low for long RNA molecules, and the increased RNA length leads to more byproducts. The cyclization efficiency is affected by the RNA sequence and secondary structure, making it difficult to scale up for mass production.

[0007] The most common method currently is to construct a PIE system using RNA with splicing activity for circularization. This method is simple and low-cost, typically requiring only the addition of Mg. 2+ GTP, when reacted at a specific temperature, can link linear RNA precursors into circular RNA. Researchers first rearranged the elements of intronic circRNA, confirming that the reaction could generate circular exons, such as... Figure 1 As shown in the diagram. It was subsequently discovered that since the internal sequence of the Exon does not participate in circularization, a foreign sequence can be inserted, resulting in a 3'halfIntron-Exon2-GOI-Exon1-5'halfIntron structure, thereby achieving the circularization and engineered design of the target gene. Here, "Exon2-GOI-Exon1" represents the circularly linked RNA sequence, and "GOI" represents the inserted foreign sequence.

[0008] Based on different reaction mechanisms, splicing-active RNAs can be divided into Group I introns and Group II introns.

[0009] Group II intron-catalyzed cyclization is independent of the 3' exon, thus resulting in fewer base residues. While it's possible to design algorithms to screen for GOI terminal sequences homologous to EBS, thereby eliminating residues, this requires individual screening for each sequence and cannot guarantee success. The Group II intron forms a 2',5'-phosphodiester bond at the linker site, instead of the naturally occurring 3',5'-phosphodiester bond, which may affect protein expression and immune responses.

[0010] Class I introns are more suitable as platform technologies for applications across different sequences. The most studied Td introns originate from the Td gene of T4 phage, while Ana introns originate from the pre-tRNA Leu of the algae Anabaena. A 2018 study by Wesselhoeft indicated that Ana introns have a higher circularization efficiency than Td introns.

[0011] Class I intron circularized RNA design, such as Figure 2 The circular RNA (circular RNA) consists of lateral homologous arms, introns, exons, medial homologous arms, and spacers. While studies have shown that optimizing sequences such as lateral homologous arms and spacers can improve circularization efficiency and stability, developing new linear RNA precursor sequences to achieve higher circularization efficiency and stability, or providing more methods for achieving circular RNA with high circularization efficiency and stability, remains a key research focus and challenge in this field. Furthermore, existing circular RNA purification technologies are difficult to scale up and are costly, significantly limiting the large-scale production and widespread application of circular RNA. This is also a pressing problem to be solved in the field of circular RNA production technology. Summary of the Invention

[0012] The purpose of this application is to provide a novel linear RNA precursor, circular RNA, its preparation method, and its application.

[0013] To achieve the above objectives, this application adopts the following technical solution:

[0014] The first aspect of this application discloses a linear RNA precursor, which, from its 5' end to its 3' end, sequentially includes a 5' outer homologous arm, a 3' intron, a 3' exon (Exon2), a 5' inner homologous arm, a 5' spacer, an IRES sequence, an inserted exogenous sequence GOI, a 3' spacer, a 3' inner homologous arm, a 5' exon (Exon1), a 5' intron, and a 3' outer homologous arm; furthermore, the 5' end of the linear RNA precursor is phosphorylated, and the 3' end is hydroxyl-modified; the DNA sequence of the 5' outer homologous arm is the sequence shown in Seq ID No. 1, the DNA sequence of the 3' outer homologous arm is the sequence shown in Seq ID No. 2, the DNA sequence of the 5' spacer is the sequence shown in Seq ID No. 3, the DNA sequence of the 3' spacer is the sequence shown in Seq ID No. 4, the DNA sequence of the 5' inner homologous arm is the sequence shown in Seq ID No. 5, and the DNA sequence of the 3' inner homologous arm is the sequence shown in Seq ID No. 6.

[0015] In this application, linear RNA precursor refers to linear RNA that can undergo intron-exon cleavage and circularization to form circular RNA, hence the term linear RNA precursor. The DNA sequence of the 5' outer homologous arm refers to the DNA sequence that can be transcribed from the sequence shown in Seq ID No. 1 to obtain the 5' outer homologous arm of this application. That is, the sequence shown in Seq ID No. 1 is not a direct RNA sequence of the 5' outer homologous arm, but rather a DNA sequence capable of being transcribed to generate RNA with the 5' outer homologous arm. The explanations for the DNA sequences of the 3' outer homologous arm, the 5' spacer, etc., are similar and will not be repeated here.

[0016] It should be noted that the key to this application lies in the sequence optimization and design of the 5' outer homologous arm, 3' outer homologous arm, 5' spacer, 3' spacer, 5' inner homologous arm, and 3' inner homologous arm, which improves the efficient circularization efficiency of RNA and the stability of circular RNA. It is understood that other elements in the linear RNA precursor of this application, such as the 3' intron, 3' exon, IRES sequence, inserted exogenous sequence GOI, 5' exon, and 5' intron, can refer to existing technologies; the inserted exogenous sequence GOI can be determined according to the polypeptide or protein to be expressed, and is not specifically limited here.

[0017] The second aspect of this application discloses a DNA containing a DNA sequence transcribed to produce the linear RNA precursor of this application.

[0018] A third aspect of this application discloses a recombinant plasmid or a linearized template thereof containing a sequence for generating the linear RNA precursor of this application.

[0019] It should be noted that existing technologies can generate linearized templates without using complete plasmids, and then directly generate the linear RNA precursor of this application from the linearized templates. It is understood that the key to this application lies in the sequence design of the linear RNA precursor. As for the specific plasmid vectors or other sequences of the linearized templates used, existing technologies can be consulted.

[0020] The fourth aspect of this application discloses a circular RNA, which is formed by intron-exon splicing exchange of the linear RNA precursor of this application, or by in vitro transcription and intron-exon splicing circularization of the recombinant plasmid or its linearized template of this application.

[0021] The fifth aspect of this application discloses a host cell containing the linear RNA precursor of this application, the DNA of this application, the recombinant plasmid of this application or its linearized template, or the circular RNA of this application.

[0022] The sixth aspect of this application discloses the use of the linear RNA precursor of this application, the DNA of this application, the recombinant plasmid of this application or its linearized template, the circular RNA of this application, or the host cell of this application in the preparation of nucleic acid drugs or in cells that highly express target genes.

[0023] It should be noted that the nucleic acid drugs in this application include, but are not limited to, preventive and / or therapeutic vaccines, protein replacement therapy preparations, cell and gene therapy reagents. As for the specific dosage form, it can be determined according to the actual needs of use, and no specific limitation is made here.

[0024] It should also be noted that the circular RNA of this application has advantages such as high circularization efficiency and good stability; therefore, when used as an RNA vaccine or drug, it has high purity and stability, and can better meet the needs of RNA therapy. As for the specific disease targeted by the vaccine or drug, it mainly depends on the inserted exogenous GOI sequence, and no specific limitation is made here. It is understood that regardless of the specific disease targeted, any RNA vaccine using the circular RNA described in this application as its basic framework structure—that is, sequentially comprising from the 5' end to the 3' end a 5' outer homologous arm, a 3' intron, a 3' exon, a 5' inner homologous arm, a 5' spacer, an IRES sequence, an inserted exogenous sequence GOI, a 3' spacer, a 3' inner homologous arm, a 5' exon, a 5' intron, and a 3' outer homologous arm; and having a phosphorylated 5' end and a hydroxyl-modified 3' end; the DNA sequence of the 5' outer homologous arm is shown in Seq ID No. 1, the DNA sequence of the 3' outer homologous arm is shown in Seq ID No. 2, the DNA sequence of the 5' spacer is shown in Seq ID No. 3, the DNA sequence of the 3' spacer is shown in Seq ID No. 4, the DNA sequence of the 5' inner homologous arm is shown in Seq ID No. 5, and the DNA sequence of the 3' inner homologous arm is shown in Seq ID No. 4. The sequences shown in No. 6 can all improve the circulation efficiency and stability of RNA vaccines to varying degrees.

[0025] The seventh aspect of this application discloses a method for preparing the circular RNA of this application, comprising using the recombinant plasmid or its linearized template as a template, generating the circular RNA of this application using an integrated IVTC process, and then purifying the reaction product by affinity chromatography and / or membrane separation to obtain high-purity circular RNA. High-purity circular RNA refers to RNA with a purity greater than 90%. Purification of the reaction product can be performed directly on the product after the reaction, or on subsequent intermediates of the product after the reaction, such as intermediates that have undergone some processing of the reaction product or pre-purified products, followed by affinity chromatography and / or membrane separation purification.

[0026] It should be noted that the preparation method of this application integrates in vitro transcription and circularization processes to achieve an integrated IVTC process, which improves the circularization efficiency and the stability of circular RNA. A novel purification process was designed, including the ACE-PolyA affinity chromatography method and the ultrafiltration membrane-based purification process, which effectively improves the purity and quality of circular RNA and solves the process scale-up problem of current technology, making it easy to scale up for large-scale production.

[0027] In one implementation of this application, the IVTC integrated process is an integrated process that combines the three-step process of in vitro transcription-TFF purification-cyclization into one step.

[0028] In one implementation of this application, the IVTC integrated process includes in vitro transcription using the recombinant plasmid or its linearized template, followed by direct adjustment of reaction conditions to generate the circular RNA of this application without TFF (tangential flow filtration) purification.

[0029] It should be noted that the general process involves first performing in vitro transcription using a recombinant plasmid as a template to generate a linear RNA precursor, then purifying the in vitro transcribed product using TFF, and finally performing intron-exon cleavage and circularization on the purified product. The IVTC integrated process of this application omits the TFF purification step and directly performs intron-exon cleavage and circularization on the in vitro transcribed product, thus achieving a one-step reaction operation. Circular RNA can be prepared simply by presetting the reaction conditions for both in vitro transcription and circularization.

[0030] In one implementation of this application, affinity chromatography purification includes using an affinity ligand of XY, modifying ligand Y on an adsorption column, adding ACE-X to the reaction product, and using the affinity adsorption of XY to separate circular RNA and linear RNA precursors to obtain high-purity circular RNA; wherein, ACE is a DNA oligonucleotide-attached chimeric element designed based on RNA sequence, used to pair with the corresponding RNA sequence.

[0031] In one implementation of this application, ACE-X is ACE-PolyA.

[0032] In one implementation of this application, the length of PolyA is 10A-100A.

[0033] It should be noted that the embodiments in this application use ACE-PA30, i.e., PolyA with a length of 30A. ACE-PA30 can bind linear RNA precursors but cannot bind circular RNA. Linear RNA precursors bound to ACE-PA30 can adsorb the ligands of the Oligo DT column, while circular RNA is not adsorbed or adsorbed weakly, thus allowing the separation of linear and circular RNA. It can be understood that the ACE-polyA-Oligo DT concept can be extended to a broad range of ACE-XY. As long as there are affinity ligands for XY, corresponding ACE-X can be designed for any DNA / RNA sequence. The resulting NA-ACE-X complex can be affinity-adsorbed by immobilized Y ligands for purification or analysis of any DNA and / or RNA.

[0034] In one implementation of this application, membrane separation purification includes direct membrane separation purification and / or space structure-induced membrane separation purification; direct membrane separation purification includes directly using a separation membrane to separate the reaction product into circular RNA and linear RNA precursors at room temperature to obtain high-purity circular RNA; space structure-induced membrane separation purification includes inducing the space structure of the reaction product, and using a separation membrane to separate the circular RNA and linear RNA precursors under space structure-induced conditions to obtain high-purity circular RNA.

[0035] In one implementation of this application, the space structure-induced membrane separation and purification employs at least one of the following methods:

[0036] 1) Under temperature-induced conditions, circular RNA and linear RNA precursors were separated using a separation membrane; the temperature-induced conditions were 25-90℃.

[0037] 2) After chemical induction, the circular RNA and linear RNA precursors are separated using a separation membrane; preferably, the chemical reagent used for chemical induction is urea; preferably, the concentration of urea is 2-10 mol / L.

[0038] 3) Combining 1) and 2), under the condition of simultaneous chemical reagent induction and temperature induction, a separation membrane is used to separate circular RNA and linear RNA precursors.

[0039] It should be noted that the key to this application lies in inducing changes in spatial structure using temperature and / or chemical reagents, and then utilizing the spatial structural differences between circular RNA and linear RNA precursors to improve membrane separation efficiency. Regarding the specific separation membrane used, existing technologies can be referenced, including but not limited to hollow fiber or flat sheet membranes. The membrane material also includes but is not limited to PES, mPES, PVDF, regenerated cellulose, and stabilized cellulose. As for the pore size of the separation membrane, it should be sufficient to effectively separate circular RNA and linear RNA precursors; for example, the pore size of a typical separation membrane is 10-300 kDa. It can be understood that if the circular RNA and linear RNA precursor sequences are relatively long, a larger pore size separation membrane can be used. Other factors affecting the separation of circular and linear RNA precursors, including but not limited to sample concentration, injection flow rate, and transmembrane pressure difference, can be adjusted according to the specific design of the circular and linear RNA precursors. For example, the sample concentration can be 1-1000 μg / mL, the injection flow rate can be 40-200 mL / min, and the transmembrane pressure difference can be 0-25 psi. No specific limits are set here.

[0040] Due to the adoption of the above technical solutions, the beneficial effects of this application are as follows:

[0041] This application's linear RNA precursor utilizes optimized design of the inner and outer homologous arms to facilitate intron splicing activity, thereby enabling the over-covalent linking of the 5' and 3' exons to achieve circularization and improve circularization efficiency. Optimized design of the spacer facilitates the recruitment of translation initiation factors to the IRES sequence, promoting ribosome binding and assembly and improving translation efficiency. Furthermore, the optimized design of the inner and outer homologous arms and the spacer enhances the effective circularization efficiency of the linear RNA precursor and the stability of the resulting circular RNA.

[0042] The method for preparing circular RNA disclosed in this application optimizes the cyclization and purification processes in several ways. By integrating in vitro transcription and cyclization, a simpler and more convenient integrated IVTC process is achieved, which improves cyclization efficiency and the stability of circular RNA. Through newly designed purification processes, such as affinity chromatography based on ACE-PolyA and / or membrane separation purification based on ultrafiltration membranes, the purity and quality of circular RNA are effectively improved, and the process scale-up problem is solved, establishing a large-scale production process that is easy to scale up. Attached Figure Description

[0043] Figure 1 This is a schematic diagram illustrating the mechanism of action of the PIE system in synthesizing circular RNA in this application;

[0044] Figure 2 This is a schematic diagram of the structure of the linear RNA precursor in the embodiments of this application;

[0045] Figure 3 This is a graph showing the test results of the circularization efficiency of different linear RNA precursors in the embodiments of this application;

[0046] Figure 4 This is a graph showing the test results of the effect of adding the PA30 sequence to the linear RNA precursor on the circularization efficiency in the embodiments of this application;

[0047] Figure 5 This is a schematic diagram illustrating the principle of ACE-XY affinity ligand adsorption and separation of RNA or DNA in the embodiments of this application;

[0048] Figure 6 These are the test results of the effect of membrane-separated and purified TMP on the purity of circular RNA in the embodiments of this application;

[0049] Figure 7 This is a schematic diagram illustrating the mechanism by which induced changes in RNA spatial structure promote membrane separation in the embodiments of this application;

[0050] Figure 8 These are the test results of the effect of the TFF process conditions for membrane separation and purification on the purity of circular RNA in the embodiments of this application. Detailed Implementation

[0051] This application first optimized the design of relevant sequences, mainly the inner and outer homologous arms and spacers. Sequence optimization improved the efficient circularization and stability of circular RNA. Furthermore, the production process was optimized for large-scale production: the synthesis process adopted an integrated and highly efficient IVTC process. The purification process employed atmospheric pressure chromatography and membrane technology, overcoming the current limitations of scale-up and high costs associated with purification techniques, thus establishing a process suitable for large-scale production.

[0052] This application employs novel homologous arms (outer and inner sides) and novel spacers. Compared with the T3 sequence in the literature (Wesselhoeft, RA, PS Kowalski, and DG Anderson, Engineering circular RNA forpotent and stable translation in eukaryotic cells. Nature Communications, 2018.9(1).), the novel homologous arm sequence designed in this application, while maintaining a high GC content (60%), adopts a more balanced A / T / G / C base usage frequency, G:C ratio, and A:T ratio. This is beneficial for forming more hydrogen bonds between the two RNA sequences, maintaining stability, and maintaining the flexibility of the RNA double helix. The resulting homologous arms can promote the pairing of introns at both ends without affecting their folding, which is conducive to the introns exercising splicing activity and completing the circularization of exons EXON1 (i.e., the 5' exon in this application) and EXON2 (i.e., the 3' exon in this application) through covalent linkage. Compared with the spacer (A) used in the existing literature T3 sequence, this application's homologous arm sequence is more advanced. 12 C2A 12 C1A 12 The novel spacer A8C1A, which adopts a relatively short average polyA distribution, is optimized in this application. 10 C1A 18 By employing a gradually increasing polyA length and removing one C, the design facilitates the recruitment of translation initiation factors to the IRES, thereby promoting ribosome binding and assembly and improving translation efficiency. Experimental results show that, compared to the T3 sequences in the literature, the linear RNA precursor designed in this application achieves a circularization efficiency of 80-90%, with a maximum of 93%, and no significant RNA breakage. In contrast, the T3 sequence breakage rate in existing literature is 17-60%, resulting in an effective circularization efficiency of only 15%-80%. Furthermore, the circular RNA obtained from the linear RNA precursor in this application exhibits high stability; after continuous circularization at 55℃ for 60 minutes, with sampling every 15 minutes, the circularization efficiency remained essentially unchanged.

[0053] This application adopts an integrated and highly efficient IVTC process, which simplifies the process while improving production capacity, cyclization efficiency, and stability.

[0054] The IVTC process integrates in vitro transcription (IVT), TFF, and cyclization into a single one-step operation, consisting of IVT at 37°C for 1.5 hours and cyclization at 55°C for 15 minutes. This one-step process achieves a high throughput of 6-7 mg / mL and a cyclization efficiency of 80-90% within 105 minutes. The original three-step process required at least twice the time and three separate steps; therefore, the IVTC process is significantly simplified and at least doubles the throughput. Regarding stability, cyclization at 55°C for up to 1 hour, with sampling at 15, 30, 45, and 60 minutes, showed a slow increase in cyclization efficiency without decreasing, indicating that the formed circular mRNA is very stable. In subsequent purification processes, neither chromatography nor membrane processing revealed mRNA degradation or a decrease in the circularity ratio.

[0055] Furthermore, this application develops a technical solution for high-resolution, high-throughput separation of biomacromolecules with very similar physicochemical properties. For example, circular RNA and linear RNA precursors have extremely similar molecular weights, with minimal differences in molecular size, charge, and hydrophobicity. Therefore, atmospheric pressure chromatography and membrane techniques based on these characteristics are often insufficient to separate them, typically requiring SEC and IP-RP (molecular sieve and ion-pair reversed-phase) techniques based on UHPLC (ultra-high pressure and high-pressure liquid chromatography). SEC chromatography suffers from low production efficiency due to its low sample loading volume and slow flow rate. IP-RP chromatography, using organic solvents and high-pressure systems, raises safety concerns, necessitating explosion-proof systems in large-scale production, increasing investment and operational complexity. Developing a simple, effective, and easily scalable circular RNA purification technology is essential and of great significance to the development of circular RNA technology and industry.

[0056] This application develops two widely used separation techniques for the separation of circular RNA and linear RNA precursors. It establishes simple, effective, and easily scalable methods, achieving high-resolution, high-throughput separation. It is understood that the two separation methods of this application are not limited to the separation of circular RNA and linear RNA precursors, but can also be applied to the separation of other biomolecules with similar properties.

[0057] The two separation methods in this application are specifically affinity chromatography and membrane separation, as detailed below:

[0058] a) Novel polyA affinity chromatography

[0059] Based on the affinity adsorption of polyA and Oligo DT column, this application designs two polyA addition and purification processes:

[0060] i.ACE-polyA

[0061] After circularization, PA30 was added to the linear precursor via ACE-PA30. When the sample was loaded onto an Oligo DT column, the T7 circular mRNA flowed through and was collected as the product peak. The precursor, due to the addition of PA30, adsorbed onto the column and could be eluted. T6, containing the PA sequence, had both the circular sequence and the precursor adsorbed. However, the adsorption of the circular RNA was weak, while the adsorption of the precursor-ACE-PA30 was strong. The two could be separated by a linear elution gradient, and the first peak was taken as the circular product peak. The sequences of T6 and T7 are shown in Table 1.

[0062] The concept of ACE-polyA-OligoDT can be extended to a broad range of ACE-XY ligands. As long as there are affinity ligands for XY, corresponding ACE-X ligands can be designed for any DNA / RNA sequence. The resulting NA-ACE-X complex can be immobilized and affinity-adsorbed by Y, thus used for the purification or analysis of any NA. The principle and procedure are as follows: Figure 5 As shown.

[0063] ii. Internal polyA

[0064] Adding PA30 to a DNA template can achieve separation similar to ACE-PA30. However, the internal addition of PA30 affects IVT efficiency and mRNA product homogeneity, as well as the binding of the two intron fragments in the cyclization reaction, thus affecting splicing activity and cyclization efficiency. Our study showed that cyclization efficiency decreased by approximately 2% after the addition of PA30.

[0065] The comparative study of the purification efficiency of ACE-polyA and internal polyA using the two methods above shows that the ACE-polyA method can significantly improve the recovery rate and achieve high purity. In other words, the ACE-polyA method improves both purity and recovery rate simultaneously.

[0066] b) High-resolution membrane separation based on temperature- and urea-induced changes in RNA spatial structure

[0067] Membrane separation technology, as a high-throughput and easily scalable industrial purification technique, is widely used in the biopharmaceutical industry for the separation of biomolecules. However, high-resolution membrane separation requires a significant difference in the size of the molecules being separated, such as a molecular weight difference of about ten times. This is not a problem for separating biomolecules and small chemical molecules, and is therefore widely used for concentration, desalting, and buffer replacement in formulations. For biomolecules with similar physicochemical properties, as well as variants and polymers of biomolecules, membrane separation struggles to achieve high resolution.

[0068] This application aims to achieve high-resolution, high-throughput separation of biomacromolecules with similar molecular characteristics, such as circular mRNA and linear mRNA, using membrane separation technology. These two types of mRNA have extremely similar molecular weights, with very small differences in molecular size, charge, and hydrophobicity, making them difficult to separate.

[0069] This application develops a unique method for membrane separation utilizing differences in molecular structure. Circular RNA forms a circular structure due to its two ends being connected. Linear RNA molecules are longer than circular RNA molecules, but their cross-sections at both ends are extremely small. By using an appropriate permeate flow rate (flux), one end of the linear RNA can be induced to enter the membrane pore, thus allowing the entire linear molecule to pass through. Circular RNA, lacking open ends, has difficulty entering the membrane pore, thereby achieving the separation of circular and linear RNA.

[0070] This application optimizes various process parameters, including membrane pore size, sample concentration, injection flow rate, TMP, and permeate flow rate, further expanding the distinction between cyclic and linear molecular spatial structures, thereby achieving better separation results and higher recovery rates.

[0071] This study demonstrates that a circular RNA purity exceeding 90% was achieved at a loading rate of 80 mL / min combined with TMP at 15-20 psi. Compared to existing processes, this process utilizes easily scalable equipment and significantly increases the loading concentration, thereby overcoming the scale-up bottleneck of existing processes and establishing a low-cost, large-scale production process. Existing stirring cups and flat-plate membranes are only suitable for small-scale laboratory studies, while the hollow fiber column used in this application can be used for both laboratory-scale and ultra-large-scale production. The loading concentration was increased from 0.05 μg / mL to 1-1000 μg / mL, resulting in a more than 20-fold increase in processing capacity per unit volume. Based on this, a maximum purity of 94% and a recovery rate of 81%, or 92% purity and a recovery rate of 90%, were achieved, representing a significant improvement over the 86% purity and 50% recovery rate reported in the literature.

[0072] Furthermore, we achieved even better separation by adjusting the secondary structure of RNA. For example... Figure 7 As shown, adding a high concentration of urea and heating during membrane separation opens up the secondary structure of RNA, allowing circular RNA to gain a larger hydraulic radius and be more trapped. Linear RNA, after reducing its secondary structure, becomes more linear and smooth, which is beneficial for permeation through membrane pores. This results in better separation. In one implementation of this application, as shown... Figure 8 As shown, the average purity increased from 78% at room temperature to 80% after heating treatment, and it can be increased to 84% after treatment with 7M urea.

[0073] The present application will be further described in detail below through specific embodiments. The following embodiments are only for further illustration of the present application and should not be construed as limiting the present application.

[0074] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art.

[0075] Example

[0076] I. Linear RNA Precursor Design and Synthesis

[0077] The linear RNA precursor in this example was designed according to the class I intron circularized RNA design, such as... Figure 2 As shown, the linear RNA precursor in this example includes, from the 5' end to the 3' end, the following sequence: 5' outer homologous arm, 3' intron, 3' exon, 5' inner homologous arm, 5' spacer, IRES sequence, inserted foreign sequence GOI, 3' spacer, 3' inner homologous arm, 5' exon, 5' intron, and 3' outer homologous arm.

[0078] This example focuses on optimizing the design of the inner and outer homologous arms and the spacer. Specifically, the inner and outer homologous arms and the spacer designed in this example are shown in Table 1. The DNA sequence of the 5' outer homologous arm is shown in Seq ID No. 1, the DNA sequence of the 3' outer homologous arm is shown in Seq ID No. 2, the DNA sequence of the 5' spacer is shown in Seq ID No. 3, the DNA sequence of the 3' spacer is shown in Seq ID No. 4, the DNA sequence of the 5' inner homologous arm is shown in Seq ID No. 5, and the DNA sequence of the 3' inner homologous arm is shown in Seq ID No. 6, labeled T6.

[0079] Meanwhile, this example included a polyA-free control, where the 5' spacer did not use the sequence shown in Seq ID No. 3. Instead, Apt-eIF4G was used as the linear RNA precursor to replace the 5' spacer, labeled T7. T7 was identical to T6 except for the replacement of the 5' spacer with Apt-eIF4G. Additionally, a reported linear RNA precursor was used as a control, labeled T3. All sequences are shown in Table 1.

[0080] Table 1. Design of DNA sequences for linear RNA precursors

[0081]

[0082]

[0083] Other elements, such as 3' introns, 5' exons, IRES sequences, inserted exogenous sequences (GOI), 3' exons, 5' introns, etc., are used in this example as follows:

[0084] The DNA sequence of the 3' intron is as follows:

[0085] AACAATAGATGACTTACAACTAATCGGAAGGTGCAGAGACTCGACGGGAGCTACCCTAACGTCAAGACGAGGGTAAAGAGAGAGTCCAATTCTCAAAGCCAATAGGCAGTAGCGAAAGCTGCAAGAGAATG (Seq ID No. 14)

[0086] The DNA sequence of the 3' exon is as follows:

[0087] AAAATCCGTTGACCTTAAACGGTCGTGTGGGTTCAAGTCCCTCCACCCCCA (Seq ID No. 15)

[0088] The DNA sequence of IRES is as follows:

[0089] TTAAAACAGCCTGTGGGTTGATCCCACCCACAGGCCCATTGGGCGCTAGCACTCTGGTATCACGGTACCTTTGTGCGCCTGTTTTATACCCCCTCCCCCAACTGTAACTTAGAAGTAACACACACCGATCAACAGTCAGCGTGGCACACCAGCCACGTTTTGATCAAGCACTTCTGTTACCCCGGACTGAGTATCAATAGACTGCTCACGCGGTTGAAGGAGAAAGCGTTCGTTATCCGGCCAACTACTTCGAAAAACCTAGTAACACCGTGGAAGTTGCAGAGTGTTTCGCTCAGCACTACCCCAGTGTAGATCAGGTCGATGAGTCACCGCATTCCCCACGGGCGACCGTGGCGGTGGCTGCGTTGGCGGCCTGCCCATGGGGAAACCCATGGGACGCTCTAATACAGACATGGTGCGAAGAGTCTATTGAGCTAGTTGGTAGTCCTCCGGCCCCTGAATGCGGCTAATCCTAACTGCGGAGCACACACCCTCAAGCCAGAGGGCAGTGTGTCGTAACGGGCAACTCTGCAGCGGAACCGACTACTTTGGGTGTCCGTGTTTCATTTTATTCCTATACTGGCTGCTTATGGTGACAATTGAGAGATCGTTACCATATAGCTATTGGATTGGCCATCCGGTGACTAATAGAGCTATTATATATCCCTTTGTTGGGTTTATACCACTTAGCTTGAAAGAGGTTAAAACATTACAATTCATTGTTAAGTTGAATACAGCAAA(SeqIDNo.16)

[0090] The insertion of the foreign sequence GOI can be determined according to the specific product. In this example, the specific inserted DNA sequence is:

[0091] ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTG ACCCTGAAGTTCATC TGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGC GCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATC GAGCTGAAGGGCATCGACTTCAAG GAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCG TGCAGCTCGCCGACCACTACCAGCAGAACACCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAA CCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAG (Seq ID No. 17)

[0092] The DNA sequence of the 5' exon is as follows:

[0093] GAGACGCTACGGACTT(Seq ID No.18)

[0094] The DNA sequence of the 5' intron is as follows:

[0095] AAATAATTGAGCCTTAAAGAAGAAATTCTTTAAGTGGATGCTCTCAAACTCAGGGAAACCTAAAT CTAGTTATAGACAAGGCAATCCTGAGCCAAGCCGAAGTAGTAATTAGTAAG (Seq ID No. 19)

[0096] Following the above design, three sequences, T3, T6, and T7, were synthesized in this example as DNA templates for the in vitro transcription of linear RNA precursors, used for the preparation of circular RNA. These three sequences were synthesized by GenScript.

[0097] II. Circular RNA Synthesis

[0098] This example uses an integrated and highly efficient IVTC process, which simplifies the process while improving production capacity, cyclization efficiency, and stability.

[0099] The IVTC process integrates IVT and cyclization into a single-step unit operation, consisting of IVT at 37°C for 1.5 hours and cyclization at 55°C for 15 minutes. Specifically, it includes: MgCl2 40mM, nucleotides 7.5mM, T7 RNA Polymerase 10U / μL, Pyrophosphatase 0.2U / mL, RNase Inhibitor 2U / μL, and DNA template 50ng / μL. After reacting at 37°C for 1.5 hours, 2mM GTP is added, and the temperature is raised to 55°C for another 15 minutes to obtain the circular RNA product.

[0100] In this example, circular RNA was prepared using T6 and T7 methods as described above, and circularization was continued at 55℃ for 1 hour. Samples were taken at 15 minutes, 30 minutes, 45 minutes, and 60 minutes to test the circularization efficiency. The results are as follows: Figure 3 As shown.

[0101] The product from the 15-60 minute cyclization in this example was tested for productivity. The RNA concentration was detected using NanoDrop and the purity of the circular RNA was analyzed by electrophoresis, which is the cyclization efficiency.

[0102] Figure 3 The results showed that this one-step process achieved a high production capacity of 6-7 mg / mL and a high cyclization efficiency of 80-90% within 105 minutes. Regarding stability, cyclization continued at 55℃ for 1 hour, and at all the sampling points mentioned above, the cyclization efficiency slowly increased without decreasing, indicating that the formed circular mRNA was very stable.

[0103] III. Purification

[0104] This example employs two widely used separation techniques for the isolation of circular RNA and linear RNA precursors. The two methods are detailed below:

[0105] a) Novel polyA tail affinity chromatography

[0106] Based on the affinity adsorption of polyA and Oligo DT column, two polyA addition and purification processes were designed:

[0107] i.ACE-PolyA

[0108] After circularization, PA30 was added to the linear RNA precursor via ACE-PA30. When the sample was loaded onto an Oligo DT column, the T7 circular mRNA flowed through and was collected as the product peak. The precursor, due to the addition of PA30, was adsorbed onto the column and could be eluted. T6, containing the PA sequence, saw both the circular sequence and the precursor adsorbed. However, the adsorption of the circular RNA was weaker, while the adsorption of the precursor-ACE-PA30 was stronger. The two could be separated by a linear elution gradient, and the first peak was taken as the circular product peak.

[0109] The sequence of ACE-PA30 in this example is:

[0110] CUUCCGAUUAGUUGUAAGUCAUCUAUUGUUAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA(Seq IDNo.20)

[0111] The Oligo DT column was supplied by Thermo-Fisher, with the Oligo DT having a length of 25.

[0112] The reaction system used pure water, with an mRNA concentration of 5 mg / mL and an ACE-PA30 to mRNA molar ratio of 1:4. The initial reaction temperature was 75℃, maintained for 3 min; subsequently, the temperature was decreased by 0.1℃ every 10 s, ending at 30℃. After the reaction, circular and linear mRNAs were separated using an Oligo DT column. When the sample was loaded onto the Oligo DT column, the T7 circular mRNA flowed through and was collected as the product peak. The precursor, due to the addition of PA30, was adsorbed onto the column and eluted. The T6 column, containing the PA sequence, adsorbed both the circular sequence and the precursor. However, the adsorption of circular RNA was weaker, while the adsorption of the precursor-ACE-PA30 was stronger. A linear elution gradient separated the two, and the first peak was taken as the circular product peak.

[0113] The ACE-polyA-OligoDT concept in this example can be extended to a broad range of ACE-XY ligands. As long as there are affinity ligands for XY, corresponding ACE-X ligands can be designed for any DNA / RNA sequence. The resulting NA-ACE-X complex can be affinity-adsorbed by immobilized Y ligands, thus allowing for the purification or analysis of any NA. Its mechanism and procedure are as follows: Figure 5 As shown.

[0114] ii. Internal polyA

[0115] Adding PA30 to the DNA template can also achieve separation similar to ACE-PA30. After IVTC circularization, the binding of circular RNA is weak, while the binding of precursor RNA containing PA30 is strong, allowing for elution separation using a gradient of decreasing salt concentration.

[0116] In this example, PA30 was added to the T6 and T7 sequences, respectively, and the circularization efficiency of linear RNA precursors with and without PA30 was tested. The test results are as follows: Figure 4 As shown. Figure 4 In the sequence, P6U and P7U use the T6 and T7 templates respectively, and neither of them has PA30 added. P6UP and P7UP have PA30 added to the end of the 3' sequence.

[0117] Figure 4The results showed that the internal addition of PA30 affected IVT efficiency and mRNA product uniformity, as well as the binding of the two intron fragments in the cyclization reaction, thus affecting splicing activity and cyclization efficiency. Figure 4 As shown, the circularization efficiency decreased by approximately 2% after the addition of PA30. Analysis suggests this may be because the added PolyA could not guarantee uniformity in the plasmid template and mRNA synthesis.

[0118] b) High-resolution membrane separation based on temperature- and urea-induced changes in RNA spatial structure

[0119] This example utilizes differences in molecular structure for membrane separation. Circular RNA forms a circular structure due to its two ends being connected. Linear RNA molecules are longer than circular RNA molecules, but their cross-sections at both ends are extremely small. By using an appropriate permeate flow rate (flux), one end of the linear RNA can be induced to enter the membrane pore, thus allowing the entire linear molecule to pass through. Circular RNA, lacking open ends, has difficulty entering the membrane pore, thereby achieving the separation of circular and linear RNA.

[0120] This example, by optimizing various process parameters, further expands the distinction between cyclic and linear molecular spatial structures, thereby achieving better separation results and higher recovery rates.

[0121] This example uses the purification of circular RNA prepared with T6 as an example to test the purification effect of a 30kD hollow fiber membrane, 80mL / min, and TMP in the range of 0-25psi. The purity test results of circular RNA obtained with different TMPs are as follows. Figure 6 As shown, the purity of circular RNA obtained under different conditions was tested using RNA electrophoresis.

[0122] Figure 6 The results showed that over 90% purity of circular RNA was achieved under TMP conditions of 15-20 psi. Compared with the process described in the reference Guillen-Cuevas, Karen, et al., “Purifying circular RNA by ultrafiltration.” bioRxiv (2024): 2024-12, our process utilizes easily scalable equipment and significantly increases the loading concentration, thus overcoming the scale-up bottleneck of the reference process and establishing a low-cost, large-scale production process. The stirring cups and plate membranes used in the reference are only suitable for small-scale laboratory studies, while our hollow fiber column can be used for both laboratory and ultra-large-scale production. Increasing the loading concentration from 0.05 μg / mL to 1 μg / mL increased the processing capacity per unit volume by 20 times. Based on this, we achieved a maximum purity of 94% and a recovery rate of 81%, or 92% purity and a recovery rate of 90%, which is a significant improvement over the 86% purity and 50% recovery rate of the reference.

[0123] Furthermore, we achieved better separation by adjusting the secondary structure of RNA, such as... Figure 7 As shown. Specifically, in the TFF tangential flow filtration process, maintain 60°C or add 7M urea to the sample and buffer system.

[0124] Then, following the optimized injection flow rate and TMP, the purity of the circular RNA obtained before and after secondary structure adjustment was compared. The test results are as follows: Figure 8 As shown.

[0125] Figure 8 In this context, RT represents room temperature, 60℃ represents temperature induction, and 7M urea represents 7M urea induction.

[0126] Adding high concentrations of urea or heating during membrane separation opens up the secondary structure of RNA, allowing circular RNA to gain a larger hydraulic radius and be more trapped. Linear RNA, after its secondary structure is reduced, becomes more linear and smooth, which facilitates its passage through membrane pores. This results in better separation. Therefore, Figure 8 The results showed that the average purity increased from 78% at room temperature to 80% after heating treatment, and 84% after treatment with 7M urea.

[0127] The above description, in conjunction with specific embodiments, provides a further detailed explanation of this application and should not be construed as limiting the specific implementation of this application to these descriptions. Those skilled in the art to which this application pertains can make several simple deductions or substitutions without departing from the concept of this application.

Claims

1. A linear RNA precursor, characterized in that: From the 5' end to the 3' end, the sequence includes the 5' outer homologous arm, the 3' intron, the 3' exon, the 5' inner homologous arm, the 5' spacer, the IRES sequence, the inserted exogenous sequence GOI, the 3' spacer, the 3' inner homologous arm, the 5' exon, the 5' intron, and the 3' outer homologous arm. The linear RNA precursor has a phosphorylation modification at the 5' end and a hydroxyl modification at the 3' end; The DNA sequence of the 5' outer homologous arm is shown in Seq ID No. 1, the DNA sequence of the 3' outer homologous arm is shown in Seq ID No. 2, the DNA sequence of the 5' spacer is shown in Seq ID No. 3, the DNA sequence of the 3' spacer is shown in Seq ID No. 4, the DNA sequence of the 5' inner homologous arm is shown in Seq ID No. 5, and the DNA sequence of the 3' inner homologous arm is shown in Seq ID No.

6.

2. A recombinant plasmid or its linearized template, characterized in that: It contains a sequence that generates the linear RNA precursor of claim 1.

3. A circular RNA, characterized in that: The linear RNA precursor described in claim 1 is formed by intron-exon cleavage and circularization, or the recombinant plasmid or its linearized template described in claim 2 is formed by in vitro transcription and intron-exon cleavage and circularization.

4. A host cell, characterized in that: It contains the linear RNA precursor of claim 1, the recombinant plasmid of claim 2 or its linearized template, or the circular RNA of claim 3.

5. The use of the linear RNA precursor of claim 1, the recombinant plasmid of claim 2 or its linearized template, the circular RNA of claim 3, or the host cell of claim 4 in the preparation of nucleic acid drugs or in cells that highly express target genes.

6. The method for preparing circular RNA according to claim 3, characterized in that: The method includes using the recombinant plasmid or its linearized template as a template, employing an integrated IVTC process to generate the circular RNA as described in claim 3, and then subjecting the reaction product to affinity chromatography purification and / or membrane separation purification to obtain high-purity circular RNA.

7. The preparation method according to claim 6, characterized in that: The IVTC integrated process is an integrated process that combines the three steps of in vitro transcription, TFF purification, and cyclization into a single step. Preferably, the IVTC integrated process includes in vitro transcription using the recombinant plasmid or its linearized template as described in claim 2, followed by intron-exon cleavage and circularization to generate the circular RNA as described in claim 3, without TFF purification.

8. The preparation method according to claim 6, characterized in that: The affinity chromatography purification involves using the affinity ligands XY, modifying ligand Y on the adsorption column, adding ACE-X to the reaction product, and using the affinity adsorption of XY to separate the circular RNA and linear RNA precursors to obtain high-purity circular RNA; wherein, ACE is a DNA oligonucleotide-attached chimeric element designed based on RNA sequence, used to pair with the corresponding RNA sequence. Preferably, ACE-X is ACE-PolyA; Preferably, the length of the PolyA is 10A-100A.

9. The preparation method according to any one of claims 6-8, characterized in that: The membrane separation and purification includes direct membrane separation and purification and / or space structure-induced membrane separation and purification; The direct membrane separation and purification includes directly separating the reaction products into circular RNA and linear RNA precursors using a separation membrane at room temperature to obtain high-purity circular RNA. The spatial structure-induced membrane separation and purification includes inducing the spatial structure of the reaction product, and using a separation membrane to separate the circular RNA and linear RNA precursors under spatial structure-induced conditions to obtain high-purity circular RNA.

10. The preparation method according to claim 9, characterized in that: The spatial structure-induced membrane separation and purification is performed using at least one of the following methods; 1) Under temperature-induced conditions, circular RNA and linear RNA precursors are separated using a separation membrane; the temperature-induced conditions are 25-90℃. 2) After chemical induction, the circular RNA and linear RNA precursors are separated using a separation membrane; preferably, the chemical induction reagent used is urea; preferably, the concentration of urea is 2-10 mol / L; 3) Combining 1) and 2), under the condition of simultaneous chemical reagent induction and temperature induction, a separation membrane is used to separate circular RNA and linear RNA precursors.

Images