Construction method and application of angel syndrome mouse model

Abstract

The invention discloses a construction method and application of an angel syndrome mouse model. The construction method comprises the following steps: preparing c.1435Agt carrying a maternal Ube3a gene on the basis of combination of a pilot editing technology and a tetraploid compensation technology; the invention relates to a non-human animal model of T nonsense mutation. The method comprises the following steps: co-delivering pegRNA (Ribonucleic Acid) and PEmax of a No.4 exon of a targeted Ube3a gene to a mouse embryonic stem cell, and introducing c.1435Agt at a target site; carrying out T nonsense mutation, and after tetraploid compensation technology treatment, transplanting the edited recombinant embryo to a pregnant female mouse to obtain an F0-generation mutant mouse; the accuracy of a mutation site is verified through combination of PCR amplification and gene sequencing, and a mutant strain with genetic stability is established through two generations of breeding and screening by using maternal genetic characteristics of the UBE3A gene. The invention further comprises a genotype identification method of the model animal, Ube3a gene mRNA expression quantity evaluation, behavioral evaluation and the like, and the Ube3a: c.1435 Agt is verified; the T mutant mouse model accords with the pathological characteristics of the angel syndrome, and can stably simulate the typical clinical manifestation and pathological characteristics of the angel syndrome.

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, and in particular relates to a method for constructing an Angelman syndrome mouse model and its application. Background Technology

[0002] Angelman syndrome (AS), a hereditary neurodevelopmental disorder, presents a complex and progressive pathogenesis. The core pathological mechanism of Angelman syndrome is the deletion or dysfunction of the maternal UBE3A gene—the UBE3A gene has "genomic imprinting" characteristics: in most human tissues, both maternal and paternal UBE3A genes are expressed, but in the brain (such as the amygdala, prefrontal cortex, hippocampus, and other key brain regions for emotion / cognition), the paternal UBE3A gene is "epigenetically silenced," and only the maternal UBE3A gene can be normally transcribed into mRNA and then translated into UBE3A protein (a ubiquitin ligase responsible for regulating the degradation and function of intracellular proteins). The main characteristics of this disease include severe intellectual disability, delayed language development, poor motor coordination, abnormal behaviors (such as frequent laughter and hyperactivity), and sleep disorders. These factors intertwine, ultimately leading to severe consequences such as complete dependence on others for daily living. Angelman syndrome exhibits significant genetic heterogeneity, with all its manifestations stemming from mutations in the UBE3A gene. The UBE3A gene, encoding ubiquitin ligase, plays a crucial role in the development and maintenance of the nervous system.

[0003] In the genetic distribution of Angelman's syndrome, approximately 70% of patients have maternal deletion or loss-of-function mutations in the UBE3A gene, with the root cause being abnormal expression of the UBE3A gene. Clinically, almost all patients with Angelman's syndrome exhibit intellectual disability and delayed motor development, though in most cases, the developmental delay is severe and easily noticeable to the naked eye. Simultaneously, some patients with Angelman's syndrome also experience sleep disturbances, and these abnormal behaviors gradually worsen with age, sometimes even impacting daily life. Regarding disease progression and prognosis, the condition of patients with Angelman's syndrome typically progresses relatively steadily, but it leads to lifelong neurodevelopmental disorders, severely affecting their quality of life.

[0004] In 1998, Y. Hui Jiang used gene editing technology to target and delete exon 5 of the mouse Ube3a gene, thus constructing the Ube3a gene. tm1Alb Mouse model. In 2015, S. Silva-santos constructed a conditional gene knockout Ube3a model by inserting a stop cassette with a loxP site at the 5' end of the mouse Ube3a gene.tm1Yelg Mouse model. In 2016, MCCC Judson used gene editing technology to insert loxP sites flanking exon 7 of the mouse Ube3a gene, constructing a conditional gene knockout Ube3a model. tm1.1Bdph Mouse model. In 2017, T. Wang used gene editing technology to introduce a premature stop codon into exon 5 of the mouse Ube3a gene, constructing the Ube3a mouse model. tm2Yelg Mouse model. In 2019, R. Avagliano Trezza used gene editing technology to knock out the first start codon (ATG) of the mouse Ube3a gene, thus constructing the Ube3a mouse model. em1Yelg Mouse models were also used. However, given the different mutation locations in these five models, the severity of the disease varied among the mice. Furthermore, since current gene editing technologies cannot effectively repair large genomic deletions, the process of in-situ repair of large deletions involving exons in these five models cannot be simulated using gene editors. Mouse models also cannot reflect the physiological and pathological changes after repair, making it difficult to assess the improvement in overall physiological function and disease phenotype in Angelman syndrome patients after repairing large gene defects.

[0005] Currently, there is no animal model that simulates the nonsense mutation at the UBE3A gene homologous site (c.1444 C>T) in human Angelman's syndrome patients. Therefore, constructing a mouse model of the Ube3a gene c.1435 A>T using leader editing technology combined with tetraploid compensation technology will be of great help in studying the mechanism of this gene in the occurrence and development of Angelman's syndrome. Summary of the Invention

[0006] The first objective of this invention is to provide a method for constructing a mouse model of Angelman syndrome. Based on the lead editing technology combined with tetraploid compensation technology, a model with the Ube3a gene c.1435 A>T mutation is constructed, which can more accurately simulate the pathological characteristics of Angelman syndrome and provide an effective tool for studying the pathogenesis of the disease, screening drugs, and verifying therapeutic targets.

[0007] The second objective of this invention is to provide an application of an Angelman syndrome mouse model.

[0008] The first objective of this invention is achieved by the following technical solution: A method for constructing a mouse model of Angelman syndrome involves replacing the base A at position c.1435 in exon 4 of the mouse Ube3a gene with the base T using leader editing technology; It includes the following steps: S1. Design a pegRNA (primeediting guide RNA) plasmid targeting the c.1435 A>T mutation in exon 4 of the murine Ube3a gene. The pegRNA sequence is 5'-TTCGCATGTACAGTGAAAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAGTGATTCTTCATTCACTGTACATG-3'. The sequence of exon 4 of the murine Ube3a gene is shown in SEQ ID NO.1. S2. Design an ngRNA (nicking guide RNA) plasmid that expresses the c.1435 A>T mutation in exon 4 of the mouse Ube3a gene. The ngRNA sequence is: 5'-GTGATTCTTCATTCACTGTA-3'. S3. Two diploid mouse 2-cell stage embryos were fused using electrofusion technology to form a tetraploid embryo carrying four sets of chromosomes. S4. A pegRNA plasmid containing the Puro resistance selection element and expressing the c.1435A>T mutation in exon 4 of the mouse Ube3a gene, a PEmax plasmid containing the BSD resistance selection element, an ngRNA plasmid without resistance selection elements and expressing the c.1435A>T mutation in exon 4 of the mouse Ube3a gene, and a hMLH1dn plasmid without resistance selection elements were co-electrochemically transfected into mouse embryonic stem cells. Double resistance selection was performed using a medium containing puromycin and bleomycin to obtain successfully transfected cells. Mouse embryonic stem cells; mouse embryonic stem cells that have been successfully transfected after resistance selection are injected into the inner cell mass region of the blastocyst of the tetraploid embryo in step S3 to form a recombinant embryo; the resistance selection element design of the plasmid in step S4 is based on the principle of "priority screening of core essential elements and co-transfection of auxiliary elements": only plasmids expressing PEmax and pegRNA plasmids carry two non-synergistic toxicity resistance genes, BSD and puro, while ngRNA and hMLH1dn plasmids have no resistance, which ensures the realization of the core function of the leader editing and reduces the drug toxicity pressure on mouse embryonic stem cells; S5. The recombinant embryo is transferred into the uterus of a surrogate mouse. The tetraploid embryonic cells differentiate into extraembryonic tissues such as the placenta, providing nutritional support for development. The embryonic stem cells differentiate into all somatic cells and germ cells of the fetus, enabling it to develop into an F0 generation mouse. S6. The correctly identified F0 generation mice were bred with wild-type mice, and after two generations of breeding, a stable genetic mutant line Ube3a:c.1435 A>T mice was established.

[0009] Preferably, the method further includes a step of identifying the mouse genotype using primers; the forward primer used for identification is 5'-GGCGTTGCCATTATTTTGCAAAGCTATG-3', and the reverse primer is 5'-CGATGTGGAAACAACGAAGAATGGTT-3'. The primer sequences used for identifying the mouse genotype must be able to specifically amplify the genomic fragment containing the c.1435 A>T mutation site, and the specific sequences are designed based on the corresponding region of the Ube3a gene.

[0010] Preferably, it also includes one or more of the following: a systematic evaluation of the expression level of Ube3a gene mRNA in brain tissue and a systematic evaluation of mouse behavioral indicators.

[0011] Preferably, the systematic evaluation of the expression level of Ube3a gene mRNA in brain tissue includes evaluation of Ube3a mRNA by real-time fluorescence quantitative PCR in mouse brain tissue.

[0012] Preferably, the systematic evaluation of mouse behavioral indicators includes at least one of the open field test, the elevated cruciate maze test, and the rotundus test.

[0013] The second objective of this invention is achieved by the following technical solution: The Ube3a:c.1435 A>T mice obtained by the above-mentioned Angelman syndrome mouse model construction method can be used as Angelman syndrome research model mice for studying maternal gene expression defect mechanisms, drug screening, or validation of therapeutic targets.

[0014] Beneficial Effects: This invention provides a method for constructing a mouse model of Angelman's syndrome. Based on lead editing technology combined with tetraploid compensation technology, a c.1435 A>T nonsense mutation is introduced at the target site of exon 4 of the mouse Ube3a gene to simulate the abnormal expression of the human maternal UBE3A gene. The constructed Ube3a:c.1435 A>T mutant mouse model experimentally verified that the model conforms to the pathological characteristics of Angelman's syndrome and can stably simulate the typical clinical manifestations (such as decreased exploratory ability, abnormal motor coordination, and other abnormal behaviors) and molecular pathological characteristics (such as decreased Ube3a mRNA expression) of human Angelman's syndrome. The established model accurately reproduces the disease phenotype caused by the nonsense mutation of the human maternal UBE3A gene, which helps to further elucidate the pathogenesis of Angelman's syndrome. It can serve as an important tool for basic research and translational medicine in Angelman's syndrome research, especially in the fields of elucidating the mechanism of maternal gene expression defects, drug screening, and validation of therapeutic targets. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 Schematic diagram of the strategy for constructing Ube3a gene c.1435 A>T mutant mice; Figure 2 The results show the PCR products and sequencing maps of the PCR products from F0 generation positive mice of the Ube3a gene c.1435 A>T mutant mice; where: (a) is the gel electrophoresis image of the PCR products of F0 generation positive mice, where lanes 1-8 and 11-18 from left to right are the PCR products of F0 generation positive mice, and lanes 9 and 10 are the marker molecular weight standards; (b) is the sequencing map of the PCR products of F0 generation positive mice. Figure 3 The results of RT-qPCR for Ube3a gene in brain and spleen tissues of wild-type and Ube3a:c.1435 A>T mice are shown. (a) is a gel electrophoresis diagram of total RNA, where lanes 1-12 correspond one-to-one with the brain and spleen of 6 Ube3a:c.1435 A>T mutant mice, and lanes 13 and 14 correspond to the brain and spleen of 1 wild-type mouse. (b) is the melting curve of the amplification products. (c) is the relative expression level of mRNA. Figure 4 Results of open field experiments for wild-type and Ube3a:c.1435 A>T mice; (a) shows the heat map and trace map of mouse movement trajectory; (b) shows the results of mouse behavioral indicators; Figure 5 Results of the elevated cruciate maze experiment for wild-type and Ube3a:c.1435 A>T mice; (a) shows the heat map and trace map of the mouse movement trajectory; (b) shows the results of the mouse behavioral indicators. Figure 6 Results of behavioral indicators in wild-type and Ube3a:c.1435 A>T mice during rotarod experiments. Detailed Implementation

[0017] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention. Throughout this specification, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. In case of any contradiction, this specification shall prevail.

[0018] Unless otherwise specified, all materials, reagents, instruments and equipment used in this invention can be obtained by purchasing them from the market or by existing methods.

[0019] The overall concept of this invention is as follows: Prime editing is a next-generation precision gene editing technology. Traditional prime editing uses PE1 and PE2 as its core versions, which are based on a fusion protein of nSpCas9 (H840A) nickase and wild-type M-MLV reverse transcriptase plus pegRNA. This lays the foundation for a precise "search-replace" architecture, but its overall efficiency is limited. The PEmax system is an optimized and enhanced version—its core is a fusion protein of engineered nSpCas9 nickase and engineered M-MLV reverse transcriptase. It also introduces NC protein to improve reverse transcription efficiency and uses optimized pegRNA to further enhance editing performance. The core mechanism is as follows: after the guide sequence of the pegRNA recognizes the target DNA containing NGG PAM, nSpCas9 cleaves the non-target strand near the PAM, forming a 3' free end. The 3' end of the pegRNA contains an optimized primer binding site (PBS) and a reverse transcription template (RT template). After the PBS hybridizes with the 3' free single-stranded DNA generated from the cleavage, the engineered M-MLV reverse transcriptase synthesizes a new DNA strand containing the target editing based on the RT template. Finally, precise editing is completed through the mismatch repair (MMR) mechanism. This process does not require the introduction of DNA double-strand breaks (DSB) or exogenous donor templates, which significantly reduces the risk of insertion / deletion mutations (indels) in traditional CRISPR / Cas9. Furthermore, the modification of the enzyme and pegRNA by PEmax improves the editing efficiency, while supporting all 12 base substitutions and small fragment insertions / deletions, covering most known pathogenic genetic variations. In terms of applications, lead editing has shown potential in disease treatment and basic research (such as constructing gene-edited cell lines and model animals). Compared to traditional gene editing technologies, lead editing, with its innovative "single-strand cutting-reverse transcription-precision repair" approach, drives a paradigm shift in gene editing from "destruction" to "repair," becoming a core tool in the precision medicine and biotechnology revolution.

[0020] Tetraploid compensation technology, as a highly efficient method for constructing animal models, operates on the core principle of polymerizing gene-edited embryonic stem cells (ES cells) with tetraploid embryos. After transplantation into pseudopregnant mice, the tetraploid embryos develop only into extraembryonic tissues such as the placenta, while fetal tissues develop entirely from the gene-edited ES cells. This directly yields F0 generation mutant mice derived from ES cells, eliminating the need for offspring breeding. The advantages of this technology include bypassing reproductive barriers caused by gene mutations, directly obtaining homozygous or double-mutant models; shortening the model construction cycle and avoiding offspring loss due to severe phenotypic differences in traditional breeding; and precisely preserving the genetic characteristics of gene editing, ensuring model stability and consistency. It provides crucial technical support for complex mutant models that cannot be obtained through conventional breeding.

[0021] This invention, based on leader editing technology combined with tetraploid compensation technology, involves co-delivering pegRNA (lead editing guide RNA) and PEmax targeting exon 4 of the Ube3a gene to mouse embryonic stem cells. The leader editing system directly introduces a c.1435 A>T nonsense mutation at the target site. After tetraploid compensation treatment, the edited recombinant embryos are transferred to surrogate mice to obtain F0 generation mutant mice. The accuracy of the mutation site is verified by PCR amplification and gene sequencing. Utilizing the maternal inheritance characteristics of the UBE3A gene, a genetically stable mutant strain is established through two generations of breeding and screening. Furthermore, functional validation of the mutant model is achieved through genotyping and behavioral evaluation, providing tools for disease mechanism research and drug development.

[0022] Example 1 - Construction of Ube3a:c.1435 A>T mice.

[0023] Using lead editing technology, a mouse model with the Ube3a gene c.1435 A>T mutation was constructed based on C57BL / 6N mice. The design scheme of the gene knock-in mouse model is as follows.

[0024] 1. Mutant gene information: The target gene for mutation is Ube3a (GenBank accession number: NM_001033962.2; Ensembl number: ENSMUSG00000025326), the corresponding transcript for the mutation scheme is Ube3a-201 (Ensembl number: ENSMUST00000107537.5), and the mutation site is: Substitution c.1435 A>T of Mouse Ube3a.

[0025] 2. Constructing the Ube3a:c.1435 A>T mouse strategy, such as... Figure 1As shown: A pegRNA plasmid with the c.1435 A>T mutation was designed targeting exon 4 of the mouse Ube3a gene (sequence shown in SEQ ID NO.1); the pegRNA sequence name is pegRNA-Ube3a-A1, and the pegRNA sequence is 5'-TTCGCATGTACAGTGAAAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAGTGATTCTTCATTCACTGTACATG-3' (SEQ ID NO.2). Design principle: A suitable pegRNA was designed near the pathogenic mutation site in exon 4 of the mouse Ube3a gene. The pegRNA contains a spacer sequence and a reverse transcription template sequence. The spacer is TTCGCATGTACAGTGAAAGA, and the reverse transcription template sequence carries the c.1435 A>T mutation information, which can guide PEmax to achieve precise base substitution at the target site, realizing the precise introduction of point mutation.

[0026] 3. By using electrofusion technology, two diploid mouse embryos in the 2-cell stage can be fused to construct tetraploid mouse embryos carrying 4 sets of chromosomes.

[0027] 4. Two core plasmids were constructed using expression vectors containing resistance selection element sequences: ① a pegRNA expression plasmid carrying the Ube3a gene c.1435A>T p.R479* point mutation guidance information, with the vector carrying the puro resistance gene; ② a PEmax expression plasmid carrying resistance selection element sequences (the plasmid used in this embodiment is pCMV-PEmax-P2A-BSD), with the vector carrying the BSD resistance gene. Simultaneously, two helper plasmids without resistance selection elements were constructed: ① an ngRNA plasmid for helper cleavage (ngRNA sequence name: ngRNA-Ube3a-A1, ngRNA sequence: 5'-GTGATTCTTCATTCACTGTA-3' (SEQ ID NO. 3)); ② an hMLH1dn plasmid (human MutL Homolog 1 dominant negative mutant protein) for interfering with normal mismatch repair function (in this embodiment, the plasmid used is pCMV-PEmax-P2A-hMLH1dn plasmid).

[0028] Design rationale: The core function of lead editing relies on PEmax (catalyzing reverse transcription) and pegRNA (targeting the target site and providing a template for mutation). The absence of either one will cause editing failure, so resistance screening is required; ngRNA (helper cleavage) and hMLH1dn (enhancing efficiency) only affect efficiency and can be introduced simultaneously through co-transfection, so no resistance is required.

[0029] p.R479* represents the molecular (nucleotide) and protein (amino acid) counterpart to c.1435A>T mutations. c.1435A>T: The 1435th base of the Ube3a gene changes from A to T (nucleotide mutation); p.R479*: This base mutation causes the corresponding codon to change to a stop codon, prematurely terminating amino acid synthesis. Arginine (R) at position 479 is replaced by a stop codon ("*" represents termination), forming a truncated protein (amino acid mutation). The p.R479* point mutation's guiding information is essentially the c.1435A>T nucleotide mutation's guiding information, which needs to be delivered to target cells via a pegRNA vector.

[0030] The construction methods of the above-mentioned pegRNA expression plasmids containing Puro resistance selection elements are as follows (1.1) to (1.5): (1.1) Preparation of target fragment: Based on the pegRNA sequence (SEQ ID NO.2), the sequence was chemically synthesized and a linker sequence matching the multiple cloning site of the pU6-pegRNA-GG-acceptor-puro plasmid (containing puromycin resistance) was added to both ends; (1.2) Vector digestion: The pU6-pegRNA-GG-acceptor-puro plasmid was double-digested with matching restriction endonucleases, and the linearized vector fragment was recovered by agarose gel electrophoresis. (1.3) Ligation reaction: The synthesized pegRNA fragment was ligated with the linearized pU6-pegRNA-GG-acceptor-puro vector at 16°C overnight using T4 DNA ligase to construct a recombinant pegRNA expression plasmid. (1.4) Transformation and screening: The ligation product was transformed into competent Escherichia coli, spread on LB solid medium containing puromycin, and cultured at 37°C for 12-16 h; single colonies were picked and cultured in LB liquid medium containing the same concentration of puromycin with shaking, and plasmids were extracted. (1.5) Identification: The size of the inserted fragment was verified by restriction endonuclease digestion, and the correctness of the pegRNA sequence and c.1435A>T mutation information was verified by Sanger sequencing to obtain the correct recombinant pegRNA expression plasmid.

[0031] The construction methods for the above ngRNA expression plasmids are shown in (2.1) to (2.5): (2.1) Preparation of target fragment: Based on the ngRNA sequence (SEQ ID NO.3), the sequence was chemically synthesized and restriction enzyme sites matching the multiple cloning site of the BPK1520 plasmid were added to both ends; (2.2) Vector digestion: The BPK1520 plasmid was double-digested with matching restriction endonucleases, and the linearized vector fragment was recovered by agarose gel electrophoresis. (2.3) Ligation reaction: The synthesized ngRNA fragment was ligated to the linearized BPK1520 vector overnight at 16°C using T4 DNA ligase; (2.4) Transformation and screening: The ligation product was transformed into competent Escherichia coli, plated on LB solid medium, and incubated at 37°C for 12-16 h; single colonies were picked and cultured on LB liquid medium with shaking, and plasmids were extracted. (2.5) Identification: The size of the inserted fragment was verified by restriction endonuclease digestion, and the correctness of the ngRNA sequence was confirmed by Sanger sequencing to obtain the recombinant ngRNA expression plasmid.

[0032] 5. Electrochemically transfect the above four plasmids into mouse embryonic stem cells (ESCs) at the following dosages: pegRNA expression plasmid containing Puro resistance selection element 100 ng / μL, 12 μL; PEmax expression plasmid containing BSD resistance selection element 320 ng / μL, 10 μL; ngRNA plasmid 50 ng / μL, 15 μL; hMLH1dn plasmid 200 ng / μL, 5.5 μL.

[0033] Twenty-four hours after transfection, the culture medium was replaced with ES cells containing 2 μg / mL puromycin (puro) and 8 μg / mL bleomycin (BSD), and screening was conducted for three consecutive days. Single clones were selected, and qualified ESCs were injected into the inner cell mass region of the blastocyst of tetraploid embryos to form recombinant embryos. The recombinant embryos were then transferred into the uterus of surrogate mice. The tetraploid embryonic cells differentiated into extraembryonic tissues such as the placenta, providing nutritional support for development. The ESCs differentiated into all somatic cells and germ cells of the fetus, ultimately developing into F0 generation mice.

[0034] 6. Establishment of a stable genetic line: After identifying the F0 generation mice, they were bred with wild-type mice to test the transmission of the lineage, the generation of female mice carrying the c.1435 A>T mutation in the F1 generation, and the generation of mice carrying the maternal c.1435 A>T mutation in the F2 generation. After two generations of breeding, a stable genetic line, Ube3a:c.1435 A>T mice, was established.

[0035] Example 2 - Genotyping of F0 generation mice.

[0036] 1. PCR amplification Specific primers were designed to amplify the genomic fragment containing the c.1435 A>T mutation site. Using F0 generation mouse toe genomic DNA as a template, PCR amplification was performed using forward primer F1 (5'-GGCGTTGCCATTATTTTGCAAAGCTATG-3', SEQ ID No. 4) and reverse primer R1 (5'-CGATGTGGAAACAACGAAGAATGGTT-3', SEQ ID No. 5). The PCR amplification reaction system (total 50 μL) is shown in Table 1, and the reaction procedure is shown in Table 2.

[0037] Table 1 PCR amplification reaction procedure

[0038] Table 2 PCR amplification reaction procedure

[0039] 2. DNA electrophoresis identification The PCR amplification product of the Ube3a gene was added to a 1.5% agarose gel and electrophoresed at a constant voltage of 120V for 30 min. The results were observed as follows. Figure 2 As shown in (a). After obtaining positive PCR products through electrophoresis, the genotype was further identified using direct sequencing (sequencing primers are shown in SEQ ID No. 4). The sequencing results are as follows. Figure 2 As shown in (b), it was finally confirmed that a mutation occurred at the 1435th base of the Exon4 of the Ube3a gene in the positive sample, that is, the base A was replaced by the base T.

[0040] Example 3 - Real-time quantitative PCR of Ube3a mRNA in brain tissue of c.1435 A>T mice.

[0041] 1. Total RNA extraction from samples (Trizol method) (1) Brain and spleen tissue samples from C57BL / 6N wild-type mice and Ube3a:c.1435 A>T mutant mice were added to liquid nitrogen and then ground into powder; (2) Transfer the ground sample to a 1.5 mL EP tube using 1 mL Trizol; (3) Add 200 μL of phenol chloride to a 1.5 mL EP tube, shake to mix, and let stand for 5 min; centrifuge at 14000 rpm for 15 min at 4℃, and carefully aspirate the supernatant into a new 1.5 mL EP tube; (4) Add 400 μL of isopropanol to the separated supernatant and mix thoroughly; centrifuge at 14000 rpm for 10 min at 4℃ and carefully discard the supernatant; (5) Add 750 μL of 75% ethanol, invert the container back and forth, and centrifuge at 14000 rpm for 5 min at 4℃; (6) Add 50 μL of DEPC water to dissolve the RNA precipitate; (7) Agarose gel electrophoresis was performed, and the results are as follows: Figure 3 As shown in (a) (lanes 1-12 correspond to the brains and spleens of 6 Ube3a:c.1435 A>T mutant mice, respectively, and lanes 13 and 14 correspond to the brain and spleen of 1 wild-type mouse): clear specific bands were observed in lanes 1-14, and the band positions (molecular weight) and brightness were relatively consistent, indicating that the extracted RNA samples were not significantly degraded, had good integrity, and were of good quality, which can be used for subsequent reverse transcription and gene expression analysis experiments.

[0042] 2. Total RNA quality testing (1) Preparation: Before measurement, zero the nucleic acid concentration meter with DEPC water for dissolving RNA, add the sample to the detection base of the nucleic acid concentration meter, and start the absorbance detection using the software on the computer; (2) Concentration determination: A reading of 1 at 260 nm indicates 40 ng RNA / μL; the formula for calculating the sample RNA concentration is: A260 × 40 ng / μL; the average concentration is 903 ng / μL; (3) Purity detection: The ratio of A260 / A280 of RNA solution is a method for detecting RNA purity. The ratio range of 1.8 to 2.1 is preferred. In this example, the average purity was measured to be 1.96.

[0043] 3. Reverse transcription to synthesize cDNA Reverse transcription was performed using Novizan's HiScript II Q RT SuperMix reverse transcription reagent for qPCR.

[0044] Prepare the first-strand cDNA synthesis reaction solution according to Table 3 and perform reverse transcription: mix the synthesis reaction solution well and place it in a 50℃ water bath for 15 min; then place it in an 85℃ water bath for 5 s and set aside for use.

[0045] Table 3 First-strand cDNA synthesis reaction solution system

[0046] 4. Quantitative Real-time PCR detection (1) Using the cDNA obtained from reverse transcription as a template, add it together with different primers to the Real-time PCR reaction system (total volume 10 μL) as shown in Table 4. After mixing, briefly incubate and place on a real-time PCR instrument. Perform the reaction according to the conditions in Table 5. The forward primer F2 sequence is 5'-GCTGTCACAAAGAATCTGGGA-3' (SEQ ID No. 6), and the reverse primer R2 sequence is 5'-AAAATTTCCTCCACAACCAACTG-3' (SEQ ID No. 7).

[0047] Table 4 Real-time PCR reaction system

[0048] Table 5 Real-time PCR reaction conditions

[0049] Melting curve analysis was performed on the cDNA obtained from reverse transcription followed by Real-time PCR to avoid non-specific amplification. The relative expression level was calculated based on the detected cycle threshold (Ct value) using the following formula: ,in , The target gene was Ube3a, and the internal reference was GapdH.

[0050] 5. Results Melting curve as shown Figure 3 As shown in (b), no impurity peaks were observed in the melting curves of the internal control and the target genome, indicating that the amplification products were single and specific, with no non-specific amplification; the internal control was of qualified quality and could be used as a standardized reference for subsequent analysis.

[0051] The Ct values ​​were read from the PCR amplification curves, and the mRNA expression level (relative expression level) of Ube3a was calculated. The experimental results were analyzed using GraphPad Prism 10.4 software. Figure 3As shown in (c), compared with wild-type mice (B6N), the expression level of Ube3a mRNA in Ube3a:c.1435 A>T mutant mice (A16-23#, A16-24#, D16-43#, D16-44#, G12-45#, G12-46#) did not change significantly in the spleen, but the expression level in the cerebral cortex decreased by 3 to 7 times. This indicates that the only "maternal gene" that can express Ube3a in the AS model mice is ineffective, which directly leads to the inhibition of Ube3a mRNA synthesis. This proves that the constructed AS mouse model is consistent with the pathology of the disease in terms of the "expression level of the core pathogenic gene" and is a reliable research model that can be applied to the study of Angelman syndrome pathogenesis, drug screening and therapeutic target verification.

[0052] Example 4 - Systematic evaluation of behavioral indicators in Ube3a:c.1435 A>T mice.

[0053] I. Ube3a:c.1435 A>T mouse open field test The experimental method is as follows: (1) Turn on the air conditioner and wait until the room temperature is consistent with that of the breeding room. Then turn on the experimental lights and place the experimental animals (experimental group: Ube3a:c.1435 A>T mutant mice; control group: C57BL / 6 B6N wild-type mice) in the experimental room for 1 hour to adapt. (2) Thoroughly clean the device with 75% alcohol and wipe it dry; (3) Experimental analysis was conducted using the TopScan integrated animal behavior analysis system. The software analysis conditions were set as follows: event: 1. Area: Mouse 1 Center In all 2. Area: Mouse 1 Center In out 3. Area: Mouse 1 Center In cen 4. Area: Mouse 1 Nose in wall 5. Area: Mouse 1 center in 1 6. Area: Mouse 1 Center In 2 7. Area: Mouse 1 center in 3 8. Area: Mouse 1 Center In 4 9. Area: Mouse 1 center in 5 10. Area: Mouse 1 center in 6 11. Area: Mouse 1 center in 7 12. Area: Mouse 1 Center In 8 13. Area: Mouse 1 Center In 9 14. Area: Mouse 1 Center In 10 15. Area: Mouse 1 Center In 11 16. Area: Mouse 1 Center In 12 17. Area: Mouse 1 Center In 13 18. Area: Mouse 1 Center In 14 19. Area: Mouse 1 Center In 15 20. Area: Mouse 1 Center In 16 Start rule: Area: Mouse 1 Center In all: cur-duration >= 2.0s Termination rule: After Analyzing Duration > 600.0s; (4) Grab the animal by its tail and place it in the center of the open box to begin the experiment. The total duration of the experiment is 10 minutes. (5) The software automatically records the movement distance, the time spent in the central area and the number of times it appears, the time spent in the corner, the time spent standing and the number of times it stands, the trajectory map, the heat map and other data; (6) After the experiment, remove the animals, thoroughly clean the apparatus with 75% alcohol, dry it, and then conduct the experiment on the next group of animals.

[0054] Experimental results are as follows Figure 4 As shown, compared with the control group, the experimental group exhibited significantly reduced movement distance, number of visits to the central area, number of times they stood up, and duration of standing, while significantly increased time spent in corner areas. This indicates that the experimental group animals exhibited low activity levels (weak motor ability) and low exploratory attitude towards new environments.

[0055] II. Ube3a:c.1435 A>T mouse elevated cruciate maze test The experimental method is as follows: (1) Turn on the air conditioner and wait until the room temperature is consistent with that of the breeding room. Then turn on the experimental lights and place the experimental animals (experimental group: Ube3a:c.1435 A>T mutant mice; control group: C57BL / 6 B6N wild-type mice) in the experimental room for 1 hour to adapt. (2) Thoroughly clean the device with 75% alcohol and wipe it dry; (3) Experimental analysis was conducted using the TopScan integrated animal behavior analysis system. The software analysis conditions were set as follows: event: 1. Area: Mouse 1 Center In EPM 2. Area: Mouse 1 Center In OPEN 3. Area: Mouse 1 Center In CLOSE 4. Area: Mouse 1 Center ln CENTER Start rule: Area: Mouse 1, Center in EPM: cur-duration >= 2.0 s Termination rule: After Analyzing Duration > 600.0s; (4) Grab the animal from the tail, place it with its head facing the open arm in the center of the maze, and begin the experiment. The experiment lasts for 10 minutes. (5) The software automatically records the movement distance, open arm dwell time and number of occurrences, closed arm dwell time, central area dwell time, trajectory map, heat map and other data; (6) After the experiment, remove the animals, thoroughly clean the apparatus with 75% alcohol, dry it, and then conduct the experiment on the next group of animals.

[0056] Experimental results are as follows Figure 5 As shown, compared with the control group mice, the experimental group mice spent significantly more time in the open arms of the elevated cross maze and entered the open arms more frequently. The experimental group mice exhibited reduced fear of open environments, indicating a weakened motivation for threat perception, assessment, or avoidance.

[0057] III. Ube3a:c.1435 A>T mouse rotarod test The experimental method is as follows: (1) Environmental adaptation: The experimental animals (experimental group: Ube3a:c.1435 A>T mutant mice; control group: C57BL / 6B6N wild-type mice) were transferred to the experimental room in advance to adapt to the environment for at least 12 hours of light (50~100 lux), temperature (22~25℃), and humidity (40~60%). They were fasted for 2 hours (to avoid the effect of fullness on movement) and allowed free access to water. (2) The initial speed is 4 rpm / min, the maximum speed is 40 rpm / min, and the acceleration is 7.2 rpm / min. 2 The maximum test time is 5 minutes; (3) Start the equipment to its initial speed; (4) Gently place the mouse on the rotating bar and ensure it stands stably for ≥2 seconds before clicking “Run” to start timing; (5) Record the time, speed and distance of the animal’s fall, and also record whether it was passively suspended or running in the opposite direction.

[0058] The experimental results were analyzed using GraphPad Prism 10.4 software, such as... Figure 6 As shown, compared with the control group mice, the experimental group mice had significantly reduced fall time, fall speed, and movement distance, indicating that the experimental group mice had poorer motor coordination ability.

[0059] In summary, the systematic review of mouse behavioral indicators (open field test, elevated cruciate maze test, rotarod test) shows that Ube3a:c.1435 A>T mice have abnormalities in motor regulation, emotional processing, and spatial exploration-related neurological functions. Specifically, they exhibit impaired motor coordination, reduced motivation to explore new environments, and decreased fear perception and risk assessment ability in threatening environments. This further verifies that the constructed AS mouse model exhibits the pathological characteristics of Angelman syndrome and can be used as a research model mouse for Angelman syndrome.

[0060] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A method for constructing a mouse model of Angelman syndrome, characterized in that, Using leader editing technology, the base A at position c.1435 in exon 4 of the mouse Ube3a gene was replaced with the base T; It includes the following steps: S1. Design a pegRNA plasmid to express the c.1435 A>T mutation in exon 4 of the murine Ube3a gene. The pegRNA sequence is 5'-TTCGCATGTACAGTGAAAGAGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCAGTGATTCTTCATTCACTGTACATG-3'. The sequence of exon 4 of the murine Ube3a gene is shown in SEQ ID NO.

1. S2. Design an ngRNA plasmid that expresses the c.1435 A>T mutation in exon 4 of the mouse Ube3a gene. The ngRNA sequence is: 5'-GTGATTCTTCATTCACTGTA-3'. S3. Two diploid mouse 2-cell stage embryos were fused using electrofusion technology to form a tetraploid embryo carrying four sets of chromosomes. S4. A pegRNA plasmid containing the Puro resistance selection element and expressing the c.1435A>T mutation in exon 4 of the mouse Ube3a gene, a plasmid containing the BSD resistance selection element and expressing PEmax, an ngRNA plasmid without resistance selection element and expressing the c.1435A>T mutation in exon 4 of the mouse Ube3a gene, and a plasmid without resistance selection element and expressing hMLH1dn are co-electrochemically transfected into mouse embryonic stem cells; double resistance selection is performed using a medium containing puromycin and bleomycin to obtain successfully transfected mouse embryonic stem cells; the successfully transfected mouse embryonic stem cells are injected into the inner cell mass region of the blastocyst of the tetraploid embryo in S3 to form a recombinant embryo; S5. The recombinant embryo is transferred into the uterus of a surrogate mouse. The tetraploid embryonic cells differentiate into extraembryonic tissues such as the placenta, providing nutritional support for development. The embryonic stem cells differentiate into all somatic cells and germ cells of the fetus, enabling it to develop into an F0 generation mouse. S6. The correctly identified F0 generation mice were bred with wild-type mice, and after two generations of breeding, a stable genetic mutant line Ube3a:c.1435 A>T mice was established.

2. The method for constructing an Angelman syndrome mouse model according to claim 1, characterized in that, It also includes the step of identifying mouse genotypes using primers; the forward primer used for identification is 5'-GGCGTTGCCATTATTTTGCAAAGCTATG-3', and the reverse primer is 5'-CGATGTGGAAACAACGAAGAATGGTT-3'.

3. A method for constructing an Angelman syndrome mouse model according to claim 1 or 2, characterized in that, It also includes one or more of the following: a systematic review of the expression level of Ube3a gene mRNA in brain tissue of mouse models and a systematic review of mouse behavioral indicators.

4. The method for constructing a mouse model of Angelman syndrome according to claim 3, characterized in that, The systematic evaluation of Ube3a gene mRNA expression levels in brain tissues included real-time quantitative PCR evaluation of Ube3a mRNA in mouse brain tissues.

5. The method for constructing an Angelman syndrome mouse model according to claim 3, characterized in that, The systematic review of mouse behavioral indicators includes at least one of the open field test, elevated cruciate maze test, and rotarod test.

6. The use of Ube3a:c.1435A>T mice obtained by the method for constructing an Angelman syndrome mouse model according to claim 1 as a research model mouse for Angelman syndrome.

Images