Molecular marker related to sheep tail fat deposition and application of molecular marker in breeding

Abstract

The invention provides a molecular marker related to sheep tail fat deposition and application of the molecular marker in breeding. According to the molecular marker, a primer is designed for an LPL gene sequence, DNA is extracted from sheep blood, PCR amplification, DNA sequencing and sequence analysis are carried out, and it is found that a T / C polymorphic site exists at the 174th site of an amplified fragment shown in SEQ ID NO.1; a KASPar primer is further used for detecting polymorphic sites of 752 sheep and establishing a least square model, correlation analysis is carried out on genotypes and tail fat deposition characters, it is determined that Y at the 174bp position shown in SEQ ID NO.1 is the polymorphic site of T or C, and the polymorphic site can be used as a molecular marker related to sheep tail fat deposition. The molecular marker disclosed by the invention can be used for screening low-tail fat type sheep varieties, can be used for screening assisted breeding and cultivating grain-saving sheep, and is beneficial to increase of economic benefits.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker screening and application technology, specifically relating to a molecular marker related to sheep tail fat deposition and its application in breeding. Background Technology

[0002] In recent years, with the continuous development of the social economy, people's requirements for meat have become increasingly higher, with a growing trend towards higher quality and safety. Lamb has a unique flavor, is rich in nutrients, low in cholesterol and fat, and is easily digested and absorbed; therefore, the market demand for lamb is increasing. The Hu sheep is a world-renowned dual-purpose breed for both meat and lambskin, and the "National Meat Sheep Genetic Improvement Plan (2015-2025)" explicitly lists it as a breeding ewe. Fat plays a crucial role in maintaining the balance of homeostatic metabolism in livestock. In lamb, fat mainly exists in the form of triglycerides, primarily distributed in subcutaneous fat, visceral fat, tail fat, and intramuscular fat. Adipose tissue is an important organ for energy metabolism; excessive fat deposition can cause obesity and a series of metabolic syndromes. During the breeding process, fat deposition requires higher feeding costs, as the energy required to form fat, especially tail fat, is 3-5 times that required to form muscle. Lean-tailed sheep convert more nutrients into edible muscle rather than energy-storing tail fat. Therefore, the fat deposition characteristics of sheep are an important indicator of production performance. Excessive fat deposition will directly affect the quality of mutton and the economic benefits of sheep farms. Therefore, reducing fat deposition, especially tail fat, can improve the economic value of carcasses, increase feed efficiency, and save costs.

[0003] Lipoprotein lipase (LPL) is a rate-limiting enzyme that hydrolyzes triglycerides from circulating triglyceride-rich lipoproteins (TRLs). LPL is a dimer-secreted lipase that clears triglyceride-rich lipoprotein particles from circulation. LPL expression can be detected in the early stages of adipocyte differentiation, thus it is considered an important molecular marker of adipocyte lineage differentiation. Studies have shown a significant positive correlation between LPL expression levels and intracellular triglyceride (TG) accumulation. As the core rate-limiting enzyme catalyzing the hydrolysis of circulating triglycerides, LPL plays a crucial role in maintaining lipid metabolic homeostasis. Specifically, LPL hydrolyzes triglycerides in chylomicrons and low-density lipoproteins to generate free fatty acids and glycerol monomers, which are then transported to various tissues throughout the body via transport proteins for energy metabolism. The transport rate of triglycerides and fatty acids is a significant factor affecting the body's ability to deposit fat. LPL, with its unique physiological function of establishing connections between lipoproteins and cell surface-specific receptors, has become an indispensable and crucial player in lipid transport and deposition. Studies on LPL (Leg Fat Phenomenon) are relatively numerous in sheep, especially in the study of tail fat traits. Researchers have used selection signal analysis (such as FST and XP-EHH) to screen for genes like LPL and ADIPOQ, which show strong positive selection in fat-tailed sheep. These genes may promote tail fat accumulation by improving fatty acid transport efficiency. Studies have also found that the heritability of the fat tail trait (h²≈0.35) is significantly higher than other economic traits, suggesting its potential for genetic improvement. However, the specific loci of these genes and their specific relationship with tail fat deposition are unclear and have not been reported. This invention, through sequencing and analysis of the LPL gene, explores the correlation between different genotypes and tail fat deposition in sheep, aiming to provide a reference for sheep breeding and offer genetic engineering methods for cultivating superior sheep breeds. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker related to fat deposition in sheep tails and its application in breeding.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A molecular marker associated with fat deposition in sheep tails, the nucleotide sequence of which is shown in SEQ ID NO.1, wherein the Y at position 174bp represents T or C, and this mutation leads to T / C polymorphism of the molecular marker.

[0007] As mentioned above, the application of molecular markers in sheep breeding has shown that sheep carrying the CC and / or TC genotypes have significantly lower tail width, tail fat weight, relative tail fat weight, and tail circumference than sheep carrying the TT genotype.

[0008] The application of primer pairs for detecting molecular markers associated with sheep tail fat deposition as described above in sheep breeding, preferably, the primer pairs include primer LF and primer LR, the nucleotide sequence of primer LF being shown in SEQ ID NO. 2, and the nucleotide sequence of primer LR being shown in SEQ ID NO. 3.

[0009] The application of KASPar primer pairs for detecting molecular markers associated with sheep tail fat deposition as described above in sheep breeding, preferably, the KASPar primer pairs include a forward primer 1 for detecting AlleleT, a forward primer 2 for detecting AlleleC, and a universal reverse primer. The nucleotide sequence of the forward primer 1 for detecting AlleleT is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer 2 for detecting AlleleC is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.6.

[0010] The application of a detection kit for detecting molecular markers associated with tail fat deposition in sheep as described above in sheep breeding, preferably, the detection kit comprises primer pairs or KASPar primer pairs; the primer pairs include primer pairs with nucleotide sequences as shown in SEQ ID NO. 2 and SEQ ID NO. 3; the KASPar primer pairs include primer pairs with nucleotide sequences as shown in SEQ ID NO. 4, SEQ ID NO. 5 and SEQ ID NO. 6;

[0011] An application of a method for detecting molecular markers associated with tail fat deposition in sheep as described above in sheep breeding, comprising the following steps:

[0012] S1. Amplify sheep genomic DNA using primer pairs with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3 or KASPar primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, or using a kit containing the aforementioned PCR primer set or KASPar primer set;

[0013] S2. The polymorphic site Y at the 174bp of the amplified product obtained in step S1, as shown in SEQ ID NO.1, is identified by typing. Among them, the tail width, tail fat weight, relative tail fat weight, and tail circumference of sheep carrying the CC and / or TC genotypes are significantly lower than those of sheep carrying the TT genotype.

[0014] In the application described above, preferably, the typing identification method in step S2 is sequencing, fluorescent probe, gene chip, or high-resolution melting curve method.

[0015] The application described above is characterized by using KASPar primer pairs for PCR amplification, and then determining the genotyping result by detecting the fluorescence signal after amplification.

[0016] As described above, the breeding objective of this application is to select sheep with low-fat tails.

[0017] The application of molecular markers associated with sheep tail fat deposition, or primer pairs or KASPar primer pairs used to detect sheep tail fat deposition, or methods for detecting molecular markers associated with sheep tail fat deposition in screening for low tail finger traits, involves amplifying and detecting sheep genomic DNA using the aforementioned primer pairs or kits to determine the genotype of the molecular markers in the sheep to be tested. This allows for the selection of sheep breeds with low tail fat deposition. Sheep carrying the CC or TC genotypes should be screened, as their tail width, tail fat weight, relative tail fat weight, and tail circumference are significantly lower than those of sheep with the TT genotype.

[0018] The beneficial effects of this invention are as follows:

[0019] This invention, through PCR amplification and sequencing of the sheep LPL gene, discovered a T / C polymorphism site at position 174 of the amplified fragment shown in SEQ ID NO.1. By detecting the polymorphism in 752 Hu sheep and establishing a least-squares model, a molecular marker associated with tail fat deposition in sheep was identified. The nucleotide sequence of this molecular marker is shown in SEQ ID NO.1, where the Y at position 174 bp is either T or C, leading to the T / C polymorphism. Sheep individuals with the TC or CC genotype at the polymorphic site exhibit significantly lower tail width, tail fat weight, relative tail fat weight, and tail circumference compared to sheep with the TT genotype. In breeding, homozygous CC sheep are selected as breeding stock to cultivate low-tail-fat-deposition sheep. Low-tail-fat-deposition sheep have higher feed conversion rates, saving feed costs, shorter slaughter time, and higher slaughter and carcass yields, thus contributing to improved economic efficiency in sheep farming.

[0020] The molecular markers and T / C polymorphic sites associated with tail fat deposition in sheep provided by this invention can effectively identify whether a sheep has low tail fat deposition by detecting the genotype of the polymorphic site, thus providing an effective detection method for the breeding of feed-saving sheep. Attached Figure Description

[0021] Figure 1 This is a gel electrophoresis image of the sheep LPL gene fragment used as a molecular marker in the invention.

[0022] Figure 2 The sequencing results are for the LPL gene mutation site in sheep during the invention.

[0023] Figure 3 The result of KASParSNP typing of the 174th base mutation site in the sheep LPL gene sequence SEQ ID NO.1 in this invention. Detailed Implementation

[0024] This invention amplifies and sequences the DNA sequence of the sheep LPL gene, screens for polymorphic sites in the LPL gene, and verifies the relationship between single nucleotide polymorphisms (SNPs) in the sheep LPL gene and tail fat traits. This allows for the establishment of a detection method for molecular markers related to sheep tail fat deposition, and the application of these molecular markers in the breeding of new low-fat, high-quality meat sheep breeds. In this invention, tail fat refers to the fat deposits in the tail.

[0025] The following embodiments are used to further illustrate the present invention, but should not be construed as limiting the present invention. Any modifications or substitutions made to the present invention without departing from its spirit and essence are within the scope of the present invention.

[0026] Unless otherwise specified, the technical means used in the embodiments are conventional means well known to those skilled in the art, and unless otherwise specified, all reagents used in the embodiments are analytical grade or higher.

[0027] Example 1

[0028] 1) Primer design

[0029] Using sheep LPL gene DNA (GenBank accession number: NC_056055.1) as a template, a primer pair was designed using Oligo 7.0 software. The primer pair, LF and LR, has the following sequences:

[0030] LF(SEQ ID NO.2):5'-TGGCAATTATACCTATGATGTGGTT-3'

[0031] LR (SEQ ID NO.3): 5′-TTCTTTTGGCTCTGACCTTGTTG-3′

[0032] 2) Amplification and sequencing of the LPL gene

[0033] Genomic DNA was extracted from the blood of nine sheep as templates. The total volume of the PCR reaction was 35 μL, which included: 1.3 μL DNA template, 17.5 μL 2×PCR Master Mix, 1.1 μL upstream primer, 1.1 μL downstream primer, and 14 μL ddH2O.

[0034] The PCR amplification program was as follows: 94℃ pre-denaturation for 3 min, 94℃ denaturation for 30 s, 57℃ annealing for 30 s, 72℃ extension for 60 s, for 35 cycles, followed by a final extension at 72℃ for 10 min. The PCR products were detected by 1.5% agarose gel electrophoresis, and the results are as follows: Figure 1 As shown, lane M represents a marker with a molecular weight of 2000, and lanes 1-9 represent the amplification results of genomic DNA from 9 sheep. The amplified PCR fragments were sequenced, and the sequencing results were analyzed using Chromas software. The results showed that the specific nucleotide sequence of the amplified fragment is as shown in SEQ ID NO.1, where the Y at 174bp of this fragment is either T or C, indicating a polymorphic site. Specifically, the amplified LPL gene fragment exhibits T / C polymorphism at the 174bp position. Figure 2 ).

[0035] Among them, SEQ ID NO.1: TGGCAATTATACCTATGATGTGGTTTCTAGG.

[0036] DNA sequence homology retrieval and identification:

[0037] The DNA sequence obtained after sequencing was compared with known physiologically functional genes published in the GenBank database using the BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain functional information of the DNA sequence. The search results showed that the sequence obtained had 98.89% homology with a partial sequence of the sheep LPL gene DNA (GenBank accession number: NC_056055.1).

[0038] Example 2: Establishment of a Genotyping Detection Method

[0039] 1. Primer sequence design

[0040] KASPar primer pairs were designed targeting the C / T polymorphic site shown in SEQ ID NO.1 of the amplified fragment in Example 1 for the specific detection of this polymorphic site. The nucleotide sequence of the optimized KASPar primer pairs includes:

[0041] The forward primer A1 used to detect AlleleC is shown in SEQ ID NO.4: GAAGGTGACCAAGTTCATGCTCATACTCACAAATATAAGACAGCAGA AGT;

[0042] The forward primer A2 used to detect AlleleT is shown in SEQ ID NO.5: GAAGGTCGGAGTCAACGGATTCATACTCACAAATATAAGACAGCAGA AGC;

[0043] The universal reverse primer C is shown in SEQ ID NO.6: GTTGCCAATTTTATCAGGAACTTTAGA.

[0044] The primers were synthesized by Beijing Sangon Biotech Co., Ltd. Each primer pair in the above KASPar primer pairs was diluted to 10 μmol / L and mixed with the primers in a volume ratio of 12:12:30 (forward primer A1:forward primer A2:universal reverse primer C) to prepare a primer mixture.

[0045] 2. Extracted genomic DNA and subjected to quality control.

[0046] Genomic DNA was extracted from sheep blood using a DNA extraction kit. The quality of the extracted genomic DNA was assessed using 1% agarose gel electrophoresis and Nanodrop 2100. Acceptable DNA samples met the following criteria: agarose gel electrophoresis showed a single, non-diffuse DNA band; Nanodrop 2100 showed an A260 / 280 ratio between 1.8 and 2.0, indicating no protein contamination; an A260 / 230 ratio between 1.8 and 2.0, indicating low salt ion concentration; and no significant light absorption at 270 nm, indicating no phenol contamination. Based on the KASP detection technology from LGC (UK) and the calculated genome size, the required DNA volume was 10–20 ng / sample. The extracted genomic DNA was diluted to a concentration of 10–20 ng / μL for use as a DNA template.

[0047] 3. Perform genotyping

[0048] First, using a K-pette dispensing workstation, 1.5 μL of diluted DNA template (10–20 ng / μL) and a blank control (no template control, NTC with water as the control) were added to separate 384-well reaction plates. The plates were then dried at 60°C for 30 min (using an LGC drying oven) until the DNA became a dry powder. Next, using a Meridian dispensing workstation under the Kraken operating system, 1×Master mix (part no. KBS-1016-011 for 1536-well microplates) and primer mixture were added to each well. Immediately after mixing, the microplates were sealed using a Kube heat sealer and a Fusion laser sealer. High-throughput water bath PCR amplification was then performed using a Hydrocycler. The PCR reaction was carried out in the Hydrocycler high-throughput water bath system, with the following procedure:

[0049] Pre-denaturation at 94℃ for 15 minutes;

[0050] 94℃, 20 seconds (denaturation) — 61℃-55℃, 1 minute (annealing & extension), amplify in touch-down order for 10 cycles, decreasing the temperature by 0.6℃ per cycle;

[0051] 94℃, 20 seconds (denaturation) — 55℃, 60 seconds, continue amplification for 26 cycles.

[0052] After amplification, fluorescence signals were detected and genotyping was performed using a BMG PHERAstar instrument. Specific results are as follows: Figure 3As shown in the figure, each dot represents a sample to be tested. The green dot near the left indicates that the locus is homozygous genotype "TT"; the blue dot near the right indicates that the locus is homozygous genotype "CC"; the red dot near the middle indicates that the locus is heterozygous genotype "CT" or "TC"; and the black dot indicates NTC, i.e., water is used as a control.

[0053] 4. Application of the molecular markers of the present invention in the association analysis of fat deposition traits in sheep tails

[0054] The experiment detected the polymorphism at the 174bp site shown in SEQ ID NO.1 in 752 Hu sheep, determined their genotypes, and established the least squares model as described below to conduct association analysis between genotype and tail fat deposition trait.

[0055] Y ijkl =μ+Genotype i +P j +F k +M l +ε ijkl

[0056] Among them, Y ijkl Here are the observed trait values, μ is the population mean, and Genotype. i For genotype effect, P j Due to the batch effect, F k Due to the paternal effect, M l Maternal effect, ε ijkl Assuming random error, let ε ijkl They are mutually independent and follow N(0, σ). 2 )distributed.

[0057] Genotyping results showed that among 752 individuals, there were 162 individuals with the TT genotype, 260 individuals with the TC genotype, and 330 individuals with the CC genotype. The mean ± standard deviation of tail length, tail width, tail fat weight, relative tail fat weight, and tail circumference for each genotype are shown in Table 1 below. The relative tail fat weight was calculated using the following formulas: Relative tail fat weight (pre-slaughter live weight) (%) = Tail fat weight / Pre-slaughter live weight × 100%; Relative tail fat weight (carcass weight) (%) = Tail fat weight / Post-slaughter carcass weight × 100%.

[0058] Table 1. Association analysis between LPL gene polymorphism and tail fat deposition in sheep.

[0059]

[0060] Note: Different lowercase superscripts in the same row indicate significant differences (P<0.05), while no superscript or the same superscript indicates no significant differences (P>0.05).

[0061] The results showed that the LPL g.48334191T>C mutation site, i.e., the T / C mutation site at position 174bp shown in SEQ ID NO.1, was significantly associated with tail fat deposition in Hu sheep (P<0.05). Sheep carrying the CC genotype had significantly lower tail width, tail fat weight, relative tail fat weight (live weight before slaughter), relative tail fat weight (carcass weight), and tail circumference than individuals with the TT genotype. Selecting the CC genotype for breeding can reduce tail fat deposition during sheep growth, resulting in a superior flock with less tail fat deposition, i.e., low-tail-fat sheep. Sheep with less tail fat accumulation have higher feed conversion efficiency because the energy required to form fat (especially tail fat) is 3-5 times that required to form muscle. Low-tail-fat sheep convert more nutrients into edible muscle rather than energy-storage tail fat. To achieve the same weight gain, low-tail-fat sheep consume less feed, thus effectively saving feed costs. With the same feed input, low-fat tail sheep reach their target slaughter weight faster, thus shortening their time to market. The heavy tail is discarded at slaughter, reducing the dressing percentage of fat-tailed sheep; therefore, low-fat tail sheep typically have a higher dressing percentage. The carcass of low-fat tail sheep consists of a higher proportion of muscle tissue and a lower proportion of bone and waste fat, resulting in higher economic value. Therefore, selecting sheep with significantly reduced tail fat deposition can greatly improve the economic benefits of sheep farming.

Claims

1. A molecular marker associated with fat deposition in sheep tails, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at 174bp represents T or C, and this mutation results in T / C polymorphism of the molecular marker.

2. The application of a molecular marker associated with sheep tail fat deposition in sheep breeding, characterized in that, The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The Y at position 174bp represents T or C. This mutation leads to the T / C polymorphism of the molecular marker. Among them, sheep carrying the CC and / or TC genotypes have significantly lower tail width, tail fat weight, relative tail fat weight, and tail circumference than sheep carrying the TT genotype.

3. The application of primer pairs for detecting molecular markers associated with tail fat deposition in sheep breeding, characterized in that, The primer pair includes primer LF and primer LR. The nucleotide sequence of primer LF is shown in SEQ ID NO.2, and the nucleotide sequence of primer LR is shown in SEQ ID NO.

3. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at position 174bp represents T or C. This mutation leads to T / C polymorphism of the molecular marker. Sheep carrying the CC and / or TC genotypes have significantly lower tail width, tail fat weight, relative tail fat weight, and tail circumference than sheep carrying the TT genotype.

4. The application of KASPar primer pairs for detecting molecular markers associated with tail fat deposition in sheep breeding, characterized in that, The KASPar primer pair includes a forward primer 1 for detecting AlleleT, a forward primer 2 for detecting AlleleC, and a universal reverse primer. The nucleotide sequence of the forward primer 1 for detecting AlleleT is shown in SEQ ID NO.4, the nucleotide sequence of the forward primer 2 for detecting AlleleC is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.

6. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, where Y at position 174bp represents T or C. This mutation leads to T / C polymorphism of the molecular marker. In this case, sheep with the CC and / or TC genotypes have significantly lower tail width, tail fat weight, relative tail fat weight, and tail circumference than sheep with the TT genotype.

5. An application of a detection kit for detecting molecular markers associated with tail fat deposition in sheep breeding, characterized in that, The detection kit contains primer pairs or KASPar primer pairs; the primer pairs include primer LF and primer LR with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3; the KASPar primer pairs include primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.

6. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The Y at position 174bp represents T or C. This mutation leads to the T / C polymorphism of the molecular marker. Among them, sheep with CC and / or TC genotypes have significantly lower tail width, tail fat weight, relative tail fat weight, and tail circumference than sheep with TT genotypes.

6. An application of a method for detecting molecular markers associated with tail fat deposition in sheep breeding, comprising the following steps: S1. Amplify sheep genomic DNA using PCR primer pairs with nucleotide sequences as shown in SEQ ID NO.2 and SEQ ID NO.3 or KASPar primer pairs with nucleotide sequences as shown in SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6, or using a kit containing the aforementioned PCR primer set or KASPar primer set; S2. The polymorphic site at position 174 bp, representing T or C, of ​​the amplified product obtained in step S1 as shown in SEQ ID NO.1 is genotyped and identified; wherein, Sheep with the CC and / or TC genotypes have significantly lower tail width, tail fat weight, relative tail fat weight, and tail circumference than sheep with the TT genotype.

7. The application according to claim 6, characterized in that, The typing identification method in step S2 is sequencing, fluorescent probe, gene chip or high-resolution melting curve.

8. The application according to claim 6, characterized in that, PCR amplification was performed using KASPar primer pairs. After amplification, the genotyping results were determined by detecting the fluorescence signal.

9. The application according to any one of claims 2-8, characterized in that, The purpose of their breeding is to select low-fat-type Hu sheep.

10. The application of molecular markers associated with sheep tail fat deposition, or primer pairs used to detect sheep tail fat deposition, or KASPar primer pairs used to detect sheep tail fat deposition, or methods for detecting molecular markers associated with sheep tail fat deposition, in screening for low-tail-fat sheep, characterized in that... The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The Y at position 174bp represents T or C. This mutation leads to the T / C polymorphism of the molecular marker. Among them, sheep carrying the CC and / or TC genotypes have significantly lower tail width, tail fat weight, relative tail fat weight, and tail circumference than sheep carrying the TT genotype.

Images