Kif26b gene molecular marker primer associated with chicken connected trait and application thereof

Abstract

The present application relates to a kind of KIF26B gene molecular marker primer associated with chicken laying performance and its application, belong to the field of biotechnology.The KIF26B gene molecular marker of the present application is located at the 34213811 base of the chromosome No.3 of chicken reference genome GRCg7b version, and the base mutation is A or G, and the genotype is A / A, A / G and G / G.The total laying length of G / G genotype chicken is higher than that of A / G and A / A genotype individuals, and the total laying length of A / G genotype chicken is higher than that of A / A genotype individuals.The present application amplifies the fragment containing the above-mentioned molecular marker site using forward and reverse primers, and the amplified product is subjected to Sanger sequencing, so that the genotype of individual can be quickly and accurately identified.The molecular marker can be used as a genetic marker for chicken breeding, and can efficiently and accurately detect chicken laying performance, improve the total number of eggs of chicken population, and has important value for chicken breeding and production.

Description

TECHNICAL FIELD

[0001] The present application relates to a KIF26B gene molecular marker primer related to chicken continuous laying traits and its application, and belongs to the technical field of biotechnology. BACKGROUND

[0002] Continuous laying traits are that hens lay eggs for 2 days or more, and the number of days of continuous laying is called "continuous laying length" (i.e. the number of continuous laying eggs), and the number of days of stop laying is called "laying interval" (i.e. the number of days of stop laying). These two indicators provide additional information for the laying pattern: multiple continuous laying lengths will appear in the entire laying period, and if the continuous laying length is continuously lengthened and the continuous laying interval is continuously shortened, the laying performance tends to be stable, and the nest inclination is also reduced. The total continuous laying length is the sum of the number of times of continuous laying of hens, and is one of the important indicators of poultry reproductive performance, which is affected by multiple factors such as genetics, endocrine, and neural regulation. The total continuous laying length represents the ability of hens to continuously lay eggs before and after the peak laying period, and can directly reflect the early laying persistence and nest inhibition level. It indicates the laying stability and total laying potential in the entire subsequent laying period. At present, there is a lack of gene molecular markers that can accurately identify the chicken total continuous laying length trait, and they are used in breeding selection to quickly identify the corresponding traits for early screening. SUMMARY

[0003] The purpose of the present application is to overcome the defects in the prior art, and to provide a KIF26B gene molecular marker primer related to chicken continuous laying traits and its application, which can quickly detect and screen the continuous laying traits of chickens.

[0004] The present application records the sum of the number of times of continuous laying of the recessive white Lohmann chicken from the onset of laying to 36 weeks of age, calculates the total continuous laying length, uses whole genome resequencing technology for SNP genotyping, and selects KIF26B gene molecular markers significantly related to chicken continuous laying traits through whole genome association analysis, thereby providing new genes and molecular marker resources for the selection of chicken continuous laying traits.

[0005] The protein encoded by the KIF26B gene is an intracellular motor protein, and its overexpression is closely related to the shorter overall survival of ovarian cancer patients, and may exacerbate disease progression by promoting cell migration and immune escape. As a member of the kinesin family, KIF26B is a downstream target of nuclear zinc finger proteins, and regulates the adhesion of embryonic kidney mesenchymal cells by interacting with non-muscle myosin, which is essential for maintaining glial cell-derived neurotrophic factor expression and ureteric bud attraction, and its absence will lead to renal agenesis or absence. Studies have shown that high expression of KIF26B is associated with ovarian cancer, and combined with its regulation of cell adhesion / migration, it can be inferred that elevated KIF26B levels may affect the total continuous laying length by interfering with ovarian or uterine homeostasis.

[0006] The application provides a primer of a KIF26B gene molecular marker related to a chicken continuous laying trait, the molecular marker is located at a base at 34213811 of a chicken chromosome 3, the base is mutated to A or G, a base at 213 in a sequence shown as SEQ ID NO: 3 or SEQ ID NO: 4, and nucleotide sequences of a chicken DNA specific primer pair required for molecular marker detection are shown as SEQ ID NO: 1 and SEQ ID NO: 2.

[0007] The application further provides application of the specific primer, and the application includes detection of a SNP genotype related to a recessive white leghorn chicken continuous laying trait.

[0008] A first step is to provide a chicken DNA sample to be detected, and the chicken DNA sample to be detected contains a SNP molecular marker at a base at 34213811 of a chicken chromosome 3, and the chicken DNA sample to be detected is subjected to PCR amplification by using a DNA specific primer pair to obtain an amplification product.

[0009] A second step is to perform Sanger sequencing on the PCR product.

[0010] A third step is to determine a SNP molecular marker genotype at a base at 34213811 of a chicken chromosome 3 according to a sequencing result of the second step.

[0011] The deoxyribonucleotide sequence of the chicken DNA specific primer pair in the first step is as follows:

[0012] An upstream primer: 5'-TGTCACCGAATTCCTCCACA-3' (SEQ ID NO: 1)

[0013] A downstream primer: 5'-TCGTGACTGGTAGCTAGCTG-3' (SEQ ID NO: 2)

[0014] The amplification product in the first step has a length of 478 bp and contains a base at 34213811 of a chicken chromosome 3.

[0015] A reaction system final volume (25 μl) is as follows:

[0016] Chicken DNA to be detected: 50 ng

[0017] 2 x Accurate Taq Master Mix: 12.5 μl

[0018] Upstream primer: 1 μl

[0019] Downstream primer: 1 μl

[0020] Sterilized water is supplemented to 25 μl,

[0021] The reaction conditions of the PCR amplification are as follows: pre-denaturation at 94℃ for 5 min, denaturation at 94℃ for 30 sec, annealing at 60℃ for 30 sec, extension at 72℃ for 60 sec, for a total of 27 cycles, extension at 72℃ for 5 min, and storage at 4℃.

[0022] The nucleotide sequence of the amplification product is shown in SEQ ID NO: 3 or SEQ ID NO: 4.

[0023] In the third step, the judgment standard is that the total length of the total laying of the chicken with the G / G genotype is higher than that of the individuals with the A / G and A / A genotypes, and the total length of the total laying of the chicken with the A / G genotype is higher than that of the individual with the A / A genotype.

[0024] The present application detects the genotype of the chicken laying traits through the KIF26B gene molecular marker, finds that the total length of the total laying of the chicken with the G / G genotype is higher than that of the individuals with the A / G and A / A genotypes, and the total length of the total laying of the chicken with the A / G genotype is higher than that of the individual with the A / A genotype. Through taking the genomic DNA of the chicken to be tested as a template, the specific primer is used for PCR amplification, and then the PCR amplification product is subjected to Sanger sequencing and SNP molecular marker genotyping, and the genotype of the SNP molecular marker can realize the selection of the chicken laying traits. In breeding, according to the breeding target, the individuals with the A / A and A / G genotypes are eliminated, and the individuals with the G / G genotype are retained, and the beneficial effects are that the molecular marker can be used as a genetic marker for chicken breeding, can efficiently and quickly identify the total length of the total laying of the chicken, and can improve the total number of eggs laid by the chicken population, provides a scientific basis for early selection, and has important value for chicken breeding. In addition, the detection method disclosed by the present application is simple and easy to operate, and can be carried out in a laboratory. BRIEF DESCRIPTION OF DRAWINGS

[0025] Figure 1 is a Manhattan plot of total length of total laying whole genome association analysis.

[0026] Figure 2 is the Sanger sequencing result of the PCR amplification product of the three genotypes. DETAILED DESCRIPTION

[0027] The following examples are suitable for the breeding of chickens.

[0028] Example 1

[0029] In this example, the total length of the total laying of the 36-week-old recessive white Loke hen is counted, the second-generation sequencing technology is used for whole genome SNP genotyping, the KIF26B gene molecular marker significantly related to the laying traits is screened through whole genome association analysis, and the result is shown in Figure 1 .

[0030] The present embodiment identifies and applies the KIF26B gene molecular marker related to chicken consecutive laying traits through the following experiments.

[0031] 1. Phenotype determination and genotype detection

[0032] (1) Experimental materials and phenotype determination

[0033] 2476 recessive white Loke hens were selected as experimental animals and were raised under the same feeding conditions. Free feeding was used throughout the process, and the egg laying time of each hen was recorded continuously from the first egg laying. The total consecutive laying length was calculated as the phenotype data.

[0034] (2) Extraction of genomic DNA

[0035] The individual to be tested was blooded under the wing vein, lysed after anticoagulation, digested with proteinase K, extracted with saturated sodium chloride method, dissolved in TE, and stored at -20°C.

[0036] (3) PCR amplification

[0037] The above extracted genomic DNA was used as a template to amplify the fragment containing the 34213811th base on chromosome 3.

[0038] Upstream primer: 5'-TGTCACCGAATTCCTCCACA-3' (SEQ ID NO: 1)

[0039] Downstream primer: 5'-TCGTGACTGGTAGCTAGCTG-3' (SEQ ID NO: 2)

[0040] The final volume (25 μl) of the reaction system is:

[0041] DNA to be tested 50 ng

[0042] 2x Accurate Taq Master Mix 12.5 μl

[0043] Upstream primer 1 μl

[0044] Downstream primer 1 μl

[0045] Sterilized water supplemented to 25 μl,

[0046] The reaction conditions of PCR amplification are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 60 sec, for 27 cycles; 72℃ extension for 5 min; 4℃ preservation; 10 μl is taken for agarose detection; the length of the single target band of the amplification product is 478 bp, and the SNP molecular marker at the base site of 34213811 of chicken chromosome 3 is obtained, and the product sequence is as follows:

[0047] SEQ ID NO: 3

[0048] TGTCACCGAATTCCTCCACATGAAAAAACTGCACCCACTGACATTCATCAATACTTGCTGAATGTCAATGCAGACCAAACAGTGGCTGTGAGCACAGTGAGGCAGTGGGTAGTGCATTTCAGCAGTGGTGACAGTGATGTGAAAGACAAGCATTATGAAATGAAGAGTGTCTCAATCAGTTCATCCACACAGATGAATCATCTGTGGGTTACAACCAGGTAACTGTGTACAGAGCTGAATATTGGCTCCATTGTGGTGGAAACAATGGTGGCAACATCAGAATATCACAAAGTTTGCACGAGGTGGGTCCCACAGGTGTTTACGCAGGGACAGAAAGAACACAGCTTGCAAGTACATCAGGACCTATTGAACCAACATGAGGATAGGTACACTCCTTGCTGGGTGAAGAACTGCAAGGAAGGCCAGGCCCAGACAGTGATGGTGAATGGAGCTGAGTCCAGCTAGCTACCAGTCACGA

[0049] SEQ ID NO: 4

[0050] TGTCACCGAATTCCTCCACATGAAAAAACTGCACCCACTGACATTCATCAATACTTGCTGAATGTCAATGCAGACCAAACAGTGGCTGTGAGCACAGTGAGGCAGTGGGTAGTGCATTTCAGCAGTGGTGACAGTGATGTGAAAGACAAGCATTATGAAATGAAGAGTGTCTCAATCAGTTCATCCACACAGATGAATCATCTGTGGGTTACGACCAGGTAACTGTGTACAGAGCTGAATATTGGCTCCATTGTGGTGGAAACAATGGTGGCAACATCAGAATATCACAAAGTTTGCACGAGGTGGGTCCCACAGGTGTTTACGCAGGGACAGAAAGAACACAGCTTGCAAGTACATCAGGACCTATTGAACCAACATGAGGATAGGTACACTCCTTGCTGGGTGAAGAACTGCAAGGAAGGCCAGGCCCAGACAGTGATGGTGAATGGAGCTGAGTCCAGCTAGCTACCAGTCACGA

[0051] (4) Sanger sequencing and genotyping

[0052] The PCR products of each sample were subjected to Sanger sequencing, respectively, and the sequencing peak graphs of different genotypes were as shown in Figure 2

[0053] 2. Correlation analysis

[0054] Two thousand four hundred and seventy-six recessive white Lohmann hen individuals with clear phenotype records were selected for correlation analysis. The ANOVA test function of R4.2 statistical plotting software was used for statistical test, and the average value comparison mode between each other was selected for statistical test of the genotypes and total laying length of the test chicken population, P < 0.05 indicating significant difference. The results are shown in Table 1, and the three genotypes are significantly different (P < 0.05). The average total laying length of G / G genotype individuals is 62.03 days, which is higher than that of A / G genotype individuals (58.10 days, P < 0.05) and A / A genotype individuals (53.70 days, P < 0.05). The total laying length of A / G genotype individuals is higher than that of A / A genotype individuals (P < 0.05). The results show that the chicken KIF26B gene molecular marker is significantly related to the total laying length phenotype, and G / G genotype individuals can be selected for breeding total laying length larger chickens to improve the overall total laying length and uniformity, and improve the breeding efficiency according to the actual breeding goal. ​

[0055] Table 1 Association analysis of KIF26B gene molecular markers and continuous yield traits

[0056] Note: Data with the same subtitle in the same column indicate no significant difference, while data with different subtitles indicate significant difference (P<0.05).

[0057] Example 2

[0058] Genotype frequency of different varieties

[0059] 1. Blood sample collection

[0060] Blood samples were collected from eight breeds of chickens, including Camellia Chicken, Big Bone Chicken, Fujian Hetian Chicken, Gushi Chicken, Guangxi Ma Chicken, Daweishan Miniature Chicken, Silkie Chicken, and Recessive White Locker, using the subwing vein blood collection method. The samples were stored at -20℃ for later use.

[0061] 2. Extraction of genomic DNA

[0062] Take the tissue sample obtained in the first step and extract genomic DNA using Omega's tissue genomic DNA extraction kit, following the standard operating procedure provided by Omega.

[0063] 3. Genotyping

[0064] Using the genomic DNA obtained in the second step as a template, PCR amplification and Sanger sequencing were performed using primer pairs consisting of the F nucleotide sequence (SEQ ID NO: 1) and the R nucleotide sequence (SEQ ID NO: 2) to obtain the individual's G / G genotype, A / G genotype, and A / A genotype.

[0065] 4. Results Analysis

[0066] Camellia chicken, Dagu chicken, Fujian Hetian chicken, Guangxi Ma chicken, Daweishan miniature chicken, and Silkie chicken are local Chinese chicken breeds that have not undergone long-term selective breeding and are often used as breeding stock in yellow-feathered broiler breeding lines. Gushi chicken is a dual-purpose breed (meat and egg), characterized by rapid growth and good reproductive performance. Recessive White Rock chicken is often used as a specialized strain in yellow-feathered broiler breeding lines, with the main breeding objective being to improve growth rate and feed efficiency. Identification revealed that the KIF26B gene molecular marker exhibits genetic polymorphism across multiple breeds, with a higher frequency of the G allele in Chinese breeds and a lower frequency in recessive White Rock chickens. This SNP locus can be used as a molecular marker for total consecutive laying length in chickens to help improve the egg production performance of the flock. See Table 2.

[0067] Table 2. Allelic frequency distribution of KIF26B gene molecular marker in different varieties

[0068] Besides the above-mentioned embodiments, the present application can have other embodiments. Any technical solutions formed by equivalent replacement or equivalent transformation shall fall within the protection scope of the present application.

Claims

1. The application of a molecular marker primer for the KIF26B gene associated with the continuous laying trait in chickens, characterized in that: The nucleotide sequences of the molecular marker primers are shown in SEQ ID NO:1 and SEQ ID NO:

2. The molecular marker site is located at position 34213811 of chromosome 3 in the chicken reference genome GRCg7b version, with bases of A or G, and genotypes of A / A, A / G, and G / G. The molecular marker primers are used for detecting continuous laying traits in chickens. The detection method includes the following steps. Step 1: The chicken DNA sample to be tested was subjected to PCR amplification using the molecular marker primers shown in SEQ ID NO:1-2 to obtain the amplification product. The amplification product was 478 bp in length and contained the 34213811th base of chromosome 3 of the chicken reference genome GRCg7b version. The second step is to perform Sanger sequencing on the PCR products. The third step is to determine the SNP molecular marker genotype at position 34213811 on chromosome 3 of the chicken reference genome GRCg7b version based on the sequencing results of the second step. The criteria for determination are that the total continuous laying length of chickens with the G / G genotype is longer than that of individuals with the A / G and A / A genotypes, and the total continuous laying length of chickens with the A / G genotype is longer than that of individuals with the A / A genotype.

2. The application of the KIF26B gene molecular marker primers related to chicken continuous laying traits as described in claim 1, characterized in that: The PCR reaction system is in 25 μl increments, and the system is as follows: Chicken DNA 50ng to be tested 2x Accurate Taq Master Mix 12.5μl 1 μl of upstream primer 1 μl of downstream primer Add sterile water to a final volume of 25 μl; The PCR amplification reaction conditions are as follows: 94℃ pre-denaturation for 5 min; 94℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 60 sec, for a total of 27 cycles; 72℃ extension for 5 min; storage at 4℃; the nucleotide sequence of the amplification product is shown in SEQ ID NO:3 or SEQ ID NO:4.

Images