Double identification fluorescence rt-pcr detection kit for foot-and-mouth disease virus type a and type o

Abstract

This application relates to the field of virus detection technology, specifically disclosing a dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus (FMD) types A and O. The kit includes a specific primer set, specific fluorescent probes, a fluorescent RT-PCR reaction solution, a positive control, and a negative control. The primer set contains primer pairs targeting the type A VP1 gene and the type O 3D gene, and includes degenerate bases to improve the detection coverage of variant strains. The fluorescent probe sequences are labeled with FAM and HEX reporter groups, respectively. Recombinant cold shock protein and recombinant human serum albumin are added to the reaction solution to optimize reaction performance. The kit also includes an internal standard system to monitor for false negatives. This kit solves the problems of insufficient broad-spectrum detection, multiple detection interference, and lack of quality control in existing technologies, and has the advantages of high specificity, high sensitivity, high reliability, and high throughput, making it suitable for rapid typing and monitoring of FMD virus.

Description

Technical Field

[0001] This application relates to the field of virus detection technology, and more specifically, to a dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus types A and O. Background Technology

[0002] Foot-and-mouth disease (FMD) is a highly contagious disease caused by the foot-and-mouth disease virus (FMDV), primarily affecting cloven-hoofed animals such as pigs, cattle, and sheep. The disease spreads extremely rapidly and has a high morbidity rate, posing a serious threat to global livestock production, animal product trade, and socio-economic stability. It is listed as a notifiable animal disease by the World Organisation for Animal Health (WOAH). FMDV belongs to the Picornaviridae family and is characterized by polymorphism and high variability. Currently, seven serotypes have been identified, including O, A, and Asia1. There is no cross-immunity between serotypes, and numerous topotypes and genetic lineages exist within the same serotype. Serotypes O and A are the two most prevalent, widely distributed, and important serotypes globally, exhibiting endemic characteristics in my country and surrounding regions, making prevention and control a serious challenge.

[0003] Rapid and accurate identification of viral serotypes is a core component of foot-and-mouth disease (FMD) outbreak monitoring, tracing, prevention, and international trade quarantine. Traditional identification methods mainly include virus isolation and culture, complement fixation test (CFT), and enzyme-linked immunosorbent assay (ELISA). However, these methods rely on successful virus isolation or specific antibodies, and have inherent limitations such as cumbersome operation, long cycle (requiring several days to weeks), high requirements for viral titer in samples, and difficulty in achieving rapid screening of large-scale samples. With the development of molecular biology techniques, reverse transcription-polymerase chain reaction (RT-PCR) and its derivative technologies have become the mainstream methods for pathogen detection. In particular, quantitative real-time RT-PCR (qRT-PCR) technology is widely used for FMDV detection due to its advantages such as high sensitivity, high specificity, quantification, and closed-tube operation to reduce contamination.

[0004] Currently, although qRT-PCR methods for general detection or partial serotyping of FMDV have been reported, they still face many challenges in practical applications. First, the high variability of the viral genome means that primers and probes designed for a specific target (such as the VP1 gene) may experience decreased detection sensitivity or even false negatives due to sequence variations in circulating strains, indicating insufficient "broad-spectrum" or "inclusiveness" of the detection methods. Second, existing serotyping detection methods mostly employ single-reaction approaches, meaning each reaction can only detect one serotype. This results in low throughput, high cost, and is time-consuming and labor-intensive when dealing with mixed infections or requiring multi-serotype screening. Although some studies have attempted to establish multiplex fluorescent RT-PCR methods, ensuring that two sets of primers and probes targeting types O and A work efficiently and specifically without interference, avoiding sensitivity imbalances and cross-reactions due to competing reactions, remains a technical challenge. Furthermore, existing methods lack an effective internal standard control system, making it impossible to effectively distinguish between true negative results and false negatives caused by failed nucleic acid extraction or the presence of inhibitors in the reaction system, thus affecting the reliability of the detection results.

[0005] Based on the above statements, this application proposes a fluorescent RT-PCR detection kit for dual identification of foot-and-mouth disease virus types A and O, based on RT-PCR technology. Summary of the Invention

[0006] To address the problems in existing technologies, such as insufficient broad-spectrum detection methods due to viral mutations, efficiency mismatch and cross-interference between primers and probes of different serotypes in multiplex RT-PCR detection, and the inability to effectively identify false negative results due to the lack of internal quality control throughout the process, this application provides a dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus types A and O.

[0007] Firstly, this application provides a dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus (FMDV) types A and O, comprising a specific primer set, a specific fluorescent probe, a fluorescent RT-PCR reaction solution, a positive control sample, and a negative control sample; the specific primer set comprises a specific primer pair targeting the FMDV type A VP1 gene and a specific primer pair targeting the FMDV type O 3D gene, the nucleotide sequences of which are as follows:

[0008] Foot-and-mouth disease virus type A VP1 gene-specific primer pair:

[0009] Upstream primer FMDV-A-VP1-F: GACACCGGCYTRCAGCTCTC (SEQ ID NO.1);

[0010] Downstream primer FMDV-A-VP1-R: ACTTGGTTCGCCAGGTCTTG (SEQ ID NO.2);

[0011] Foot-and-mouth disease virus type O 3D gene-specific primer pair:

[0012] Upstream primer FMDV-O-3D-F: GACAAGGGTTYGGTTGCAGG (SEQ ID NO.3);

[0013] Downstream primer FMDV-O-3D-R: CAGGTGCCTGCCTCTGATCT (SEQ ID NO.4).

[0014] Preferably, the total amount of the specific primer combination is 4 μL, comprising the following components: 1 μL of 20 μmol / L FMDV-A-VP1-F, 1 μL of 20 μmol / L FMDV-A-VP1-R, 1 μL of 20 μmol / L FMDV-O-3D-F, and 1 μL of 20 μmol / L FMDV-O-3D-R.

[0015] Preferably, the nucleotide sequences of the specific fluorescent probe are as follows:

[0016] Foot-and-mouth disease virus type A VP1 gene-specific probe FMDV-A-VP1-Probe: FAM-CCACCTCCAGGTCACCAYGCC-BHQ1 (SEQ ID NO.5);

[0017] Foot-and-mouth disease virus type O 3D gene-specific probe FMDV-O-3D-Probe: HEX-TGACACCGCCGTGGACACAGT-BHQ1 (SEQ ID NO.6);

[0018] The specific fluorescent probes are labeled with mutually distinguishable fluorescent reporter groups at their 5' ends and with fluorescent quencher groups at their 3' ends; wherein, the fluorescent reporter group of the type A specific probe is FAM, and the fluorescent reporter group of the type O specific probe is HEX; the fluorescent quencher group is selected from one of BHQ1, BHQ2, BHQ3, and TAMRA.

[0019] Preferably, the total amount of the specific fluorescent probe is 2 μL, comprising the following components: 1 μL of 50 μmol / L FMDV-A-VP1-Probe and 1 μL of 50 μmol / L FMDV-O-3D-Probe.

[0020] Preferably, the sequences of the specific primer combination and the specific fluorescent probe contain degenerate bases to improve the detection coverage of different genotypes of foot-and-mouth disease virus (FMDV) A and O.

[0021] Preferably, the fluorescent RT-PCR reaction solution comprises the following components: 2×One Step RT-PCR Buffer, MgSO4, recombinant cold shock protein (CSP) and recombinant human serum albumin (rHSA).

[0022] Preferably, the total volume of the fluorescent RT-PCR reaction solution is 14 μL, comprising the following components: 10 μL of 2×One Step RT-PCR Mix, 2 μL of 25 mmol / L MgSO4, 1 μL of 0.02 mmol / L recombinant cold shock protein, and 1 μL of 10 mg / mL recombinant human serum albumin.

[0023] Preferably, the positive control samples are foot-and-mouth disease virus type A recombinant plasmid and foot-and-mouth disease virus type O recombinant plasmid, both with a concentration of 1×10⁻⁶. 4 The recombinant plasmid of foot-and-mouth disease virus type A contains the target sequence of the primers shown in SEQ ID NO.1-2, and the recombinant plasmid of foot-and-mouth disease virus type O contains the target sequence of the primers shown in SEQ ID NO.3-4.

[0024] Preferably, the negative control sample is nuclease-free water.

[0025] Preferably, the kit further includes an internal standard primer pair and an internal standard probe for monitoring sample extraction and reaction processes, the nucleotide sequences of which are as follows:

[0026] Upstream internal standard primer IC-F: GGACTTAGACGTGCGAGCG (SEQ ID NO.7);

[0027] Downstream internal standard primer IC-R: TAGCGCAGCTGCCTCCGCGAGA (SEQ ID NO.8);

[0028] Internal standard probe IC-Probe: CCAGCACGTGTAGGCACTGCTAT (SEQ ID NO.9);

[0029] The internal standard probe is labeled with a CY5 or ROX reporter fluorescent group at its 5' end and with a BHQ2 or BHQ3 quencher fluorescent group at its 3' end.

[0030] Secondly, this application provides a non-diagnostic detection method for a dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus types A and O, specifically including the following steps:

[0031] S1. Sample processing: Collect the sample to be tested and extract total RNA from the sample;

[0032] S2. Prepare the fluorescent RT-PCR reaction system: Mix the extracted RNA with the fluorescent RT-PCR reaction solution, specific primer combination, and specific fluorescent probe, and set up a positive control reaction system and a negative control reaction system;

[0033] S3. Sample amplification: Place the prepared reaction system in a real-time quantitative PCR instrument and run the amplification program;

[0034] S4. Result determination: Based on the Ct value of each fluorescence channel and the morphology of the amplification curve, determine the infection status of foot-and-mouth disease virus type A and / or type O nucleic acid in the sample.

[0035] Preferably, in step S1, the sample to be tested is a tissue sample, serum, or oral / nasal swab from an even-toed ungulate such as a pig, cow, or sheep.

[0036] Preferably, in step S2, the positive control group includes fluorescent RT-PCR reaction solution, foot-and-mouth disease virus type A recombinant plasmid and foot-and-mouth disease virus type O recombinant plasmid, specific primer combination and specific fluorescent probe; the negative control group includes fluorescent RT-PCR reaction solution, nuclease-free water, specific primer combination and specific fluorescent probe.

[0037] Preferably, in step S2, the total volume of the reaction system is 25 μL. The positive control group includes 14 μL of fluorescent RT-PCR reaction solution, 5 μL of foot-and-mouth disease virus type A recombinant plasmid and foot-and-mouth disease virus type O recombinant plasmid, 4 μL of specific primer combination, and 2 μL of specific fluorescent probe; the negative control group includes 14 μL of fluorescent RT-PCR reaction solution, 5 μL of nuclease-free water, 4 μL of specific primer combination, and 2 μL of specific fluorescent probe.

[0038] Preferably, in step S3, the amplification program is as follows: reverse transcription stage: 45-50℃ reaction for 10-15 min; pre-denaturation stage: 90-100℃ reaction for 25-35 s; PCR cycling reaction stage: 90-100℃ denaturation for 4-6 s, 55-65℃ annealing / extension for 30-34 s, for a total of 40-45 cycles, with fluorescence signals collected during the annealing / extension stage.

[0039] Preferably, in step S3, the amplification program is as follows: reverse transcription stage: 50℃ reaction for 15 min; pre-denaturation stage: 95℃ reaction for 30 s; PCR cycling reaction stage: 95℃ denaturation for 5 s, 60℃ annealing / extension for 34 s, for a total of 40 cycles, and fluorescence signal is collected during the annealing / extension stage.

[0040] Preferably, in step S4, the criteria for determining infection are:

[0041] If the Ct value of the FAM channel is ≤35 and a typical amplification curve appears, while there is no amplification in the HEX channel, then the patient is determined to be positive for foot-and-mouth disease virus type A.

[0042] If the Ct value of the HEX channel is ≤35 and a typical amplification curve appears, while there is no amplification in the FAM channel, then the patient is determined to be positive for foot-and-mouth disease virus type O.

[0043] If the Ct values ​​of both the FAM and HEX channels are ≤35 and both show typical amplification curves, then it is determined to be a mixed infection of type A and type O.

[0044] If no amplification curve is observed in the FAM and HEX channels, but a typical amplification curve is observed in the internal standard (ROX) channel, the sample is considered negative for foot-and-mouth disease virus.

[0045] If no amplification is found in any of the channels (FAM, HEX, ROX), the detection is deemed invalid and needs to be repeated.

[0046] In summary, this application has the following beneficial effects:

[0047] 1. Excellent broad-spectrum detection and coverage, effectively preventing missed detections: This application introduces degenerate bases (Y / R) in the primer and probe sequences (e.g., SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5). This design specifically targets high-frequency mutation sites in the A and O types of foot-and-mouth disease virus genomes, enabling a single primer and probe kit to efficiently detect multiple circulating strains with different genetic lineages within the same serotype. This significantly overcomes the problem of decreased detection sensitivity or missed detections caused by viral mutations, and improves the kit's inclusiveness and adaptability to detecting circulating strains in different regions and at different times.

[0048] 2. High specificity and no cross-interference ensure accurate identification: Carefully designed primer and probe sequences targeting the conserved regions of the A-type VP1 gene and the O-type 3D gene, and rigorously validated for specificity, ensure no cross-reaction between the two detection systems. Simultaneously, optimized reaction systems and components (such as the addition of recombinant cold shock protein) further guarantee the high efficiency and specificity of the dual RT-PCR reaction, enabling clear and accurate identification when simultaneously detecting two serotypes in a single reaction tube, effectively avoiding misdiagnosis.

[0049] 3. Precise reaction system and excellent detection performance: This application provides a precisely optimized premixed reaction solution and reaction system, and adds two unique components: recombinant cold shock protein (CSP) and recombinant human serum albumin (rHSA). CSP effectively eliminates RNA secondary structure and promotes reverse transcription; rHSA stabilizes enzyme activity and reduces adsorption to the tube wall. The synergistic effect of these components significantly improves reverse transcription and amplification efficiency, giving the kit higher sensitivity (lower detection limit) and more stable reproducibility.

[0050] 4. Comprehensive internal quality control to monitor false negatives: This application introduces a comprehensive monitoring system centered on the internal standard gene (porcine RNaseP, SEQ ID NO.7-9). This internal standard participates in the entire process from the sample nucleic acid extraction stage, effectively distinguishing between truly negative samples (normal internal standard amplification) and false negative results (no internal standard amplification) caused by sampling, extraction failure, or reaction inhibition. This design greatly improves the reliability and credibility of the test results, providing crucial internal quality control evidence for result interpretation.

[0051] 5. High efficiency, speed, and high throughput, suitable for large-scale applications: This application employs a one-step dual-fluorescent RT-PCR technology, integrating reverse transcription, PCR amplification, and detection into a single sealed reaction tube. Results are obtained in approximately 1.5 hours, reducing operational steps and contamination risks, and doubling the throughput of traditional genotyping detection. Coupled with clear and quantifiable judgment criteria, it enables rapid, high-throughput screening and identification of large numbers of samples, making it highly suitable for applications such as port quarantine, epidemic monitoring, and epidemiological investigations. Attached Figure Description

[0052] Figure 1 The image shows the amplification results of the three primer sets in Example 1. Detailed Implementation

[0053] The present application will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are only for explaining the present application and are not intended to limit the scope of the present application.

[0054] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0055] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available products.

[0056] Example 1: Design and Screening of Specific Primer Combinations

[0057] Based on the genomic sequences of representative strains of foot-and-mouth disease virus (FMDV) type A (e.g., A / WH / 09) and type O (e.g., O / Mya98), and considering highly conserved regions of their VP1 gene (type A) and 3D gene (type O), as well as sites with single nucleotide polymorphisms (SNPs), three sets of candidate specific primer combinations suitable for identifying FMDV types A and O using dual fluorescent RT-PCR detection method were designed by adjusting key parameters such as Tm value, GC content, free energy, and amplicon length. The nucleotide sequences of each candidate primer are shown in Table 1.

[0058] Table 1. Nucleotide sequences of candidate specific primers for each group

[0059]

[0060] The three designed candidate primer combinations were used with known concentrations (1×10⁻⁶). 4 5 μL of type A and type O viral RNA standards (copies / μL) were used for dual fluorescent RT-PCR screening and evaluation according to the following reaction system: candidate specific primer combination (4 primers, each with a concentration of 20 μmol / L, 1 μL of each primer), specific fluorescent probe (2 probes, each with a concentration of 50 μmol / L, 1 μL of each probe), 10 μL of 2×One Step RT-PCR Mix, 2 μL of 25 mmol / L MgSO4, 1 μL of 0.02 mmol / L recombinant cold shock protein, and 1 μL of 10 mg / mL recombinant human serum albumin.

[0061] The reaction procedure was as follows: reverse transcription at 50℃ for 15 min; pre-denaturation at 95℃ for 30 s; denaturation at 95℃ for 5 s; annealing / extension at 60℃ for 34 s (during which FAM and HEX channel fluorescence signals were collected), for a total of 40 cycles.

[0062] After the reaction, preliminary screening was conducted by comparing the inflection point characteristics of the amplification curves and the fluorescence signal intensity (ΔRn value) of each candidate group. For example... Figure 1 The detection results showed that, compared with primer sets 2 and 3, primer set 1 had the clearest and most typical amplification curve inflection point and the highest fluorescence signal intensity (ΔRn). Therefore, this application determined that candidate primer set 1 was the optimal primer combination for detecting foot-and-mouth disease virus types A and O in subsequent embodiments.

[0063] Example 2: Detection of Foot-and-Mouth Disease Virus using the prepared dual-identity fluorescent RT-PCR detection kit for Foot-and-Mouth Disease Virus types A and O.

[0064] Kit components:

[0065] ① Specific primer combination: 4 μL, containing primers shown in SEQ ID NO:1-4, each primer concentration is 20 μmol / L, and each primer volume is 1 μL;

[0066] ② Specific fluorescent probes: 2 μL, containing the probes shown in SEQ ID NO:5-6, with a concentration of 50 μmol / L for each probe and a volume of 1 μL for each probe;

[0067] ③Fluorescent RT-PCR reaction solution: 14 μL, 2×One Step RT-PCR Mix 10 μL, 25 mmol / L MgSO4 2 μL, 0.02 mmol / L recombinant cold shock protein 1 μL, 10 mg / mL recombinant human serum albumin 1 μL;

[0068] ④ Positive control: containing 1×10 4 copies / μL of foot-and-mouth disease virus type A recombinant plasmid and 1×10 4 A mixture of 2.5 μL each of the foot-and-mouth disease virus type O recombinant plasmid (copies / μL);

[0069] ⑤ Negative control: 5 μL of nuclease-free water.

[0070] ⑥ Internal control system (optional): A mixture containing 1 μL each of the internal standard primers and probes shown in SEQ ID NO:7-9, with a primer concentration of 20 μmol / L and a probe concentration of 50 μmol / L.

[0071] Sample testing:

[0072] S1. Sample processing: Collect serum samples from clinically infected pigs with foot-and-mouth disease and extract a total of 5 μL of RNA using a commercially available viral RNA extraction kit;

[0073] S2. Preparation of the fluorescent RT-PCR reaction system: ① Sample tube to be tested: Mix 5 μL of extracted RNA with 14 μL of fluorescent RT-PCR reaction solution, 4 μL of specific primer combination and 2 μL of specific fluorescent probe; ② Positive control tube: Mix 5 μL of foot-and-mouth disease virus type A recombinant plasmid and foot-and-mouth disease virus type O recombinant plasmid with 14 μL of fluorescent RT-PCR reaction solution, 4 μL of specific primer combination and 2 μL of specific fluorescent probe; ③ Negative control tube: Mix 5 μL of nuclease-free water with 14 μL of fluorescent RT-PCR reaction solution, 4 μL of specific primer combination and 2 μL of specific fluorescent probe.

[0074] S3. Sample amplification: Place each tube in a real-time quantitative PCR instrument and set the reaction program: 50℃ reverse transcription for 15 min; 95℃ pre-denaturation for 30 s; 95℃ denaturation for 5 s; 60℃ annealing / extension for 34 s, for a total of 40 cycles.

[0075] S4. Result determination: FAM, HEX and ROX channel fluorescence signals are collected at 60℃ to determine the infection status of foot-and-mouth disease virus type A and / or type O nucleic acid in the sample.

[0076] The criteria for judging the test results of the reagent kit in this application are as follows:

[0077] If the Ct value of the FAM channel is ≤35 and a typical amplification curve appears, while there is no amplification in the HEX channel, then the patient is determined to be positive for foot-and-mouth disease virus type A.

[0078] If the Ct value of the HEX channel is ≤35 and a typical amplification curve appears, while there is no amplification in the FAM channel, then the patient is determined to be positive for foot-and-mouth disease virus type O.

[0079] If the Ct values ​​of both the FAM and HEX channels are ≤35 and both show typical amplification curves, then it is determined to be a mixed infection of type A and type O.

[0080] If no amplification curve is observed in the FAM and HEX channels, but a typical amplification curve is observed in the internal standard (ROX) channel, the sample is considered negative for foot-and-mouth disease virus.

[0081] If no amplification is found in any of the channels (FAM, HEX, ROX), the detection is deemed invalid and needs to be repeated.

[0082] Example 3: Specificity detection of foot-and-mouth disease virus type A and type O dual-identification fluorescent RT-PCR detection kit

[0083] To verify the specificity of the foot-and-mouth disease virus (FMD) type A and O dual-identification fluorescent RT-PCR detection kit provided in this application, and to evaluate whether it has cross-reactivity with other FMD virus serotypes and other common swine, bovine, and ovine pathogens, the following nucleic acid samples were tested using the optimal primer combination (SEQ ID NO. 1-4) screened in Example 1 of this application and the reaction system optimized in Example 2:

[0084] Target pathogens: FMDV type A nucleic acid (standard) and FMDV type O nucleic acid (standard);

[0085] Non-target FMDV serotypes: FMDV Asia1 nucleic acid (standard) and FMDV C nucleic acid (standard);

[0086] Other common pathogens include: classical swine fever virus (CSFV) nucleic acid, porcine reproductive and respiratory syndrome virus (PRRSV) nucleic acid, porcine epidemic diarrhea virus (PEDV) nucleic acid, porcine pseudorabies virus (PRV) nucleic acid, bovine viral diarrhea virus (BVDV) nucleic acid, and orf virus (Orf Virus) nucleic acid.

[0087] Negative control: Nuclease-free water.

[0088] The specificity was detected according to the method described in Example 2, and the results are shown in Table 2.

[0089] Table 2. Specificity detection results of the dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus types A and O.

[0090]

[0091] Experimental Results: As shown in Table 2, the dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus (FMDV) types A and O provided in this application only specifically amplifies the nucleic acids of FMDV types A and O; there is no cross-reaction with other serotypes of FMDV (Asia1 and C); and no cross-reaction with other common pathogens in pigs, cattle, and sheep (CSFV, PRRSV, PEDV, PRV, BVDV, and OrfVirus); the negative control showed no amplification, indicating that the reaction system was uncontaminated. In summary, this kit has extremely high specificity and can accurately identify FMDV types A and O, and can be used for precise detection in complex clinical settings.

[0092] Example 4 Sensitivity detection of the dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus types A and O

[0093] To determine the detection sensitivity of the FMDV type A and type O dual-identification fluorescent RT-PCR detection kit provided in this application, specifically to determine its limit of detection (LOD) for FMDV type A and type O RNA templates, in vitro transcribed RNA (ivt-RNA) standards of known copy numbers of FMDV type A (strain number: A / WH / 09) and type O (strain number: O / Mya98) were serially diluted 10-fold with nuclease-free water to prepare a concentration of 1×10⁻⁶. 0 1×10 1 1×10 2 1×10 3 1×10 4 1×10 5 1×10 6The gradient dilution buffer was prepared in copies / μL. Using the optimal primer combination (SEQ ID NO. 1-4) determined in Example 1 of this application and the reaction system optimized in Example 2, the A and O type ivt-RNA standards at each concentration gradient were detected, with each concentration tested 5 times.

[0094] Sensitivity testing was performed according to the method described in Example 2. After the experiment, the Ct value of each replicate reaction was recorded. Reactions producing a typical S-type amplification curve with a Ct value < 35 were considered positive. The lowest template concentration with a 95% positive rate in replicate tests was taken as the limit of detection (LOD) of this kit. The detection results are shown in Tables 3 and 4.

[0095] Table 3. FMDV Type A Sensitivity Detection Results

[0096]

[0097] Table 4. FMDV O-type sensitivity test results

[0098]

[0099] Experimental results: The limit of detection (LOD) for FMDV type A ivt-RNA using the dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus types A and O provided in this application is 10 copies / μL, and the detection limit is within 1.0 × 10⁻⁶. 6 -1.0×10 1 It exhibits a good linear relationship within the concentration range of copies / μL.

[0100] The limit of detection (LOD) for FMDV type O ivt-RNA is also 10 copies / μL, at 1.0×10⁻⁶. 6 -1.0×10 1 It also exhibits a good linear relationship within the concentration range of copies / μL.

[0101] Even at the lowest detection concentration (10 copies / μL), the repeatability of detection for both types A and O remained good, with the standard deviation of Ct values ​​less than 1.5, indicating that the kit has extremely high sensitivity and excellent repeatability, and can meet the detection requirements for samples with extremely low viral load.

[0102] Example 5: Concordance rate detection of the dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus types A and O with other methods.

[0103] To assess the accuracy and reliability of the foot-and-mouth disease virus type A and type O dual-identification fluorescent RT-PCR detection kit (hereinafter referred to as "this kit") provided in this application, 50 clinical samples were randomly collected from different regions and farms. The sample types included 20 swabs from pigs, 15 bovine serum samples, and 15 sheep tissue homogenates. This sample set pre-included known positive and negative samples that had been pre-screened.

[0104] Detection method: The foot-and-mouth disease virus type A and type O dual identification fluorescent RT-PCR detection kit described in this application was used in strict accordance with the procedure described in Example 2.

[0105] Reference Method: The virus isolation combined with antigen capture ELISA (Ag-ELISA) typing method recommended by the World Organisation for Animal Health (WOAH) was adopted. The specific procedure is as follows: the sample is inoculated into a sensitive cell line for virus isolation. After the typical cytopathic effect (CPE) is observed, the virus fluid is harvested, and serotype identification is performed using a WOAH-certified specific monoclonal antibody via an Ag-ELISA kit.

[0106] The results are shown in Table 5.

[0107] Table 5 Comparison of the test results of this kit and the reference method.

[0108]

[0109] Experimental Results: Using the results of virus isolation combined with Ag-ELISA typing as the reference standard, the detection results of this kit showed that the concordance rate for detecting foot-and-mouth disease virus type A was 100%, the concordance rate for detecting type O was 94.4%, the overall concordance rate was 98%, and the Kappa value was 0.97 (>0.75). One sample showing discrepancies (positive for type O in the reference method, negative in this kit) was retested and verified by a third party using RT-PCR sequencing, confirming that the viral nucleic acid in this sample had degraded, and the detection results of this kit were accurate.

[0110] In summary, the foot-and-mouth disease virus (FMD) virus type A and type O dual-identification fluorescent RT-PCR detection kit described in this application exhibits high consistency with the reference method (virus isolation + Ag-ELISA) (overall concordance rate 98%, Kappa value 0.97). It possesses high specificity, accurately identifying type A and type O infections; and high sensitivity, directly detecting viral nucleic acid, overcoming the limitations of long viral isolation cycles and high dependence on the amount of live virus in the sample. This kit is suitable for rapid typing and identification of FMD virus in clinical samples, providing a reliable technical tool for epidemic monitoring, epidemiological investigation, and import / export quarantine.

[0111] Example 6: Synergistic effect of recombinant cold shock protein (CSP) and recombinant human serum albumin (rHSA) on RT-PCR reaction

[0112] To verify the effects of recombinant cold shock protein (CSP) and recombinant human serum albumin (rHSA) added to the fluorescent RT-PCR reaction solution of this kit on improving the efficiency of reverse transcription and PCR amplification, especially their synergistic effect.

[0113] Experimental group (complete system): as described in Example 2, containing 2×One Step RT-PCR Mix, 25 mmol / L MgSO4, 0.02 mmol / L recombinant cold shock protein (CSP) and 10 mg / mL recombinant human serum albumin (rHSA).

[0114] Control group A (protein-free group): contains only 2×One Step RT-PCR Mix and 25mmol / L MgSO4;

[0115] Control group B (CSP group only): contains 2×One Step RT-PCR Mix, 25 mmol / L MgSO4 and 0.02 mmol / L recombinant cold shock protein (CSP);

[0116] Control group C (rHSA group only): contains 2×One Step RT-PCR Mix, 25 mmol / L MgSO4 and 10 mg / mL recombinant human serum albumin (rHSA).

[0117] Note: The total volume of all groups was adjusted to be consistent using nuclease-free water.

[0118] Template: Using the positive control (a mixture containing type A and type O recombinant plasmids) provided in Example 2, and performing 10-fold serial dilutions, a concentration of 1×10⁻⁶ was prepared. 1 1×10 2 1×10 3 1×10 4 Gradient dilutions of copies / μL.

[0119] Primers and probes: Same as in Example 2.

[0120] Prepare the reaction system according to the above groupings, with three replicates for each template concentration in each group. Add 5 μL of template solution of different concentrations to the corresponding reaction tubes. Place each tube in a real-time quantitative PCR instrument, and perform the reaction program as in Example 2, acquiring fluorescence signals from the FAM (detection of type A virus) and HEX (detection of type O virus) channels at 60℃. The results are shown in Tables 6 and 7.

[0121] Table 6 Comparison of detection efficiency for Foot-and-Mouth Disease Virus Type A (FAM channel)

[0122]

[0123] Table 7 Comparison of detection efficiency for foot-and-mouth disease virus type O (HEX channel)

[0124]

[0125] As shown in Tables 6 and 7, recombinant cold shock protein (CSP) and recombinant human serum albumin (rHSA) exhibited a significant synergistic effect in RT-PCR. When detecting foot-and-mouth disease virus type A (FAM channel) and type O (HEX channel), the complete system (containing both CSP and rHSA) showed the lowest Ct values ​​and optimal amplification efficiency at all template concentrations, with relatively small standard deviations in repeated experiments, indicating good reproducibility. While adding rHSA or CSP alone improved the reaction efficiency to some extent (Ct values ​​were lower than the protein-free group), the effect was far less than that of using both in combination. Particularly important was the effect at low template concentrations (1×10⁻⁶). 1 At (copies / μL), the Ct value of the complete system was about 5 cycles earlier (type A) and 4 cycles earlier (type O) than the protein-free group, which significantly improved the detection sensitivity. This directly proves that the synergistic effect of CSP and rHSA greatly enhances the reverse transcription and amplification efficiency, especially the detection capability for low-load samples.

[0126] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. A dual-identification fluorescent RT-PCR detection kit for foot-and-mouth disease virus types A and O, characterized in that, The kit includes a specific primer set, a specific fluorescent probe, a fluorescent RT-PCR reaction solution, a positive control sample, and a negative control sample. The specific primer set includes a specific primer pair targeting the foot-and-mouth disease virus type A VP1 gene and a specific primer pair targeting the foot-and-mouth disease virus type O 3D gene, with the following nucleotide sequences: Foot-and-mouth disease virus type A VP1 gene-specific primer pair: Upstream primer FMDV-A-VP1-F: GACACCGGCYTRCAGCTCTC (SEQ ID NO.1); Downstream primer FMDV-A-VP1-R: ACTTGGTTCGCCAGGTCTTG (SEQ ID NO.2); Foot-and-mouth disease virus type O 3D gene-specific primer pair: Upstream primer FMDV-O-3D-F: GACAAGGGTTYGGTTGCAGG (SEQ ID NO.3); Downstream primer FMDV-O-3D-R: CAGGTGCCTGCCTCTGATCT (SEQ ID NO.4); The fluorescent RT-PCR reaction solution comprises the following components: 2×One Step RT-PCR Buffer, MgSO4, recombinant cold shock protein, and recombinant human serum albumin.

2. The foot-and-mouth disease virus type A and type O dual-identification fluorescent RT-PCR detection kit according to claim 1, characterized in that, The nucleotide sequences of the specific fluorescent probes are as follows: Foot-and-mouth disease virus type A VP1 gene-specific probe FMDV-A-VP1-Probe: CCACCTCCAGGTCACCAYGCC (SEQ ID NO.5); Foot-and-mouth disease virus type O 3D gene-specific probe FMDV-O-3D-Probe: TGACACCGCCGTGGACACAGT (SEQ ID NO. 6); The specific fluorescent probes are labeled with mutually distinguishable fluorescent reporter groups at their 5' ends and with fluorescent quencher groups at their 3' ends; wherein, the fluorescent reporter group of the type A specific probe is FAM, and the fluorescent reporter group of the type O specific probe is HEX; the fluorescent quencher group is selected from one of BHQ1, BHQ2, BHQ3, and TAMRA.

3. The foot-and-mouth disease virus type A and type O dual-identification fluorescent RT-PCR detection kit according to claim 1, characterized in that, The positive control samples were foot-and-mouth disease virus type A recombinant plasmid and foot-and-mouth disease virus type O recombinant plasmid.

4. The foot-and-mouth disease virus type A and type O dual-identification fluorescent RT-PCR detection kit according to claim 1, characterized in that, The negative control sample was nuclease-free water.

5. The foot-and-mouth disease virus type A and type O dual-identification fluorescent RT-PCR detection kit according to claim 1, characterized in that, The kit also includes an internal standard primer pair and an internal standard probe for monitoring sample extraction and the reaction process, the nucleotide sequences of which are as follows: Upstream internal standard primer IC-F: GGACTTAGACGTGCGAGCG (SEQ ID NO.7); Downstream internal standard primer IC-R: TAGCGCAGCTGCCTCCGCGAGA (SEQ ID NO.8); Internal standard probe IC-Probe: CCAGCACGTGTAGGCACTGCTAT (SEQ ID NO.9); The internal standard probe is labeled with a CY5 or ROX reporter fluorescent group at its 5' end and with a BHQ2 or BHQ3 quencher fluorescent group at its 3' end.

6. A non-diagnostic detection method for the foot-and-mouth disease virus type A and type O dual-identification fluorescent RT-PCR detection kit according to any one of claims 1-5, characterized in that, Specifically, the steps include the following: S1. Sample processing: Collect the sample to be tested and extract total RNA from the sample; S2. Prepare the fluorescent RT-PCR reaction system: Mix the extracted RNA with the fluorescent RT-PCR reaction solution, specific primer combination, and specific fluorescent probe, and set up a positive control reaction system and a negative control reaction system; S3. Sample amplification: Place the prepared reaction system in a real-time quantitative PCR instrument and run the amplification program; S4. Result determination: Based on the Ct value of each fluorescence channel and the morphology of the amplification curve, determine the infection status of foot-and-mouth disease virus type A and / or type O nucleic acid in the sample.

7. The non-diagnostic detection method of the foot-and-mouth disease virus type A and type O dual-identification fluorescent RT-PCR detection kit according to claim 6, characterized in that, In step S1, the sample to be tested is a tissue sample, serum, or oral / nasal swab from an even-toed ungulate such as a pig, cow, or sheep.

8. The non-diagnostic detection method of the foot-and-mouth disease virus type A and type O dual-identification fluorescent RT-PCR detection kit according to claim 6, characterized in that, In step S3, the amplification program is as follows: reverse transcription stage: 45-50℃ reaction for 10-15 min; pre-denaturation stage: 90-100℃ reaction for 25-35 s; PCR cycling reaction stage: 90-100℃ denaturation for 4-6 s, 55-65℃ annealing / extension for 30-34 s, for a total of 40-45 cycles, and fluorescence signals are collected during the annealing / extension stage.

Images