Fluorescent RT-PCR (reverse transcription-polymerase chain reaction) detection kit for identifying classical swine fever virus vaccine strain and wild strain

Abstract

The invention relates to the technical field of virus detection, and particularly discloses a fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) detection kit for identifying a classical swine fever virus vaccine strain and a wild strain. The kit comprises a specific primer combination, a specific fluorescent probe, a fluorescent RT-PCR (Reverse Transcription-Polymerase Chain Reaction) reaction solution, a positive control and a negative control, the primer combination comprises a vaccine strain and wild strain specific primer pair targeting a virus 5 '-UTR region and an E2 gene; the fluorescent probes comprise probes corresponding to the targets respectively and are marked with fluorophores; verification is carried out through double gene targets, missing detection caused by single site mutation is effectively avoided, and the method has the advantages of high specificity, high sensitivity and high accuracy; the invention further provides a non-diagnostic purpose detection method of the kit, detection can be completed within 2 h, and the kit is suitable for rapid identification, epidemic situation monitoring and purification effect evaluation of classical swine fever virus vaccine strains and wild strains in clinical samples.

Description

Technical Field

[0001] This application relates to the field of virus detection technology, and more specifically, to a fluorescent RT-PCR detection kit for differentiating between classical swine fever virus vaccine strains and wild-type strains. Background Technology

[0002] Classical Swine Fever (CSF) is a highly contagious disease caused by the classical swine fever virus (CSFV), belonging to the genus CSFV of the family Flaviviridae. Characterized by high fever, widespread hemorrhage, and high mortality, it is listed as a notifiable animal disease by the World Organisation for Animal Health (WOAH) and poses a persistent threat to the pig farming industry in my country and globally, causing enormous economic losses.

[0003] Vaccination is a key means of controlling this disease, with C-strain rabbit-attenuated live vaccines being widely used globally due to their good safety and immunogenicity. However, while vaccination provides effective protection, it also presents a serious challenge: it cannot distinguish between immunized animals (those that develop antibodies after vaccination) and naturally infected animals (those that develop antibodies after infection with wild-type strains) using conventional serological antibody detection methods (such as ELISA). This lack of diagnostic capability severely hinders the implementation of swine fever eradication programs, affects the accuracy of epidemic monitoring, and impacts the assessment of eradication effectiveness, because it prevents the timely detection and eradication of asymptomatic wild-type infected individuals.

[0004] While virus isolation and identification is currently considered the "gold standard," the process is time-consuming, complex, and requires high-level biosafety laboratories, making it unsuitable for large-scale rapid detection. Conventional RT-PCR methods, though faster, rely on gel electrophoresis for result interpretation, which can lead to amplification product contamination, and their sensitivity and quantification capabilities are insufficient. Although some studies have attempted to differentiate vaccine strains from wild-type strains based on single nucleotide polymorphisms (SNPs) in gene regions such as ERNS, E2, or UTR, these methods may have limitations such as limited identification sites, missed detection of variant wild-type strains, low specificity, low sensitivity, or poor reagent stability.

[0005] Based on the above statements, this application proposes a fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains, based on RT-PCR technology. Summary of the Invention

[0006] To address the problem that existing technologies cannot quickly and accurately distinguish between classical swine fever virus vaccine strains (such as attenuated C-strain vaccines) and wild-type strains (including classic virulent strains and variant wild-type strains), leading to misjudgments of immunization efficacy, difficulties in tracing the source of the epidemic, and high biosafety risks, this application provides a fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains.

[0007] Firstly, this application provides a fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains, comprising a specific primer set, a specific fluorescent probe, a fluorescent RT-PCR reaction solution, a positive control sample, and a negative control sample; the specific primer set comprises a vaccine strain-specific primer pair and a wild-type strain-specific primer pair targeting the 5'-UTR region of classical swine fever virus, as well as a vaccine strain-specific primer pair and a wild-type strain-specific primer pair targeting the E2 gene of classical swine fever virus, the nucleotide sequences of which are as follows: Vaccine strain 5'-UTR specific primer pair: Upstream primer Vac-UTR-F: CAGTCAATGCCATGTGGAGC (SEQ ID NO.1); Downstream primer Vac-UTR-R: GACGAACTCCGTAACAGCT (SEQ ID NO.2); Wild-type strain 5'-UTR specific primer pair: Upstream primer Wt-UTR-F: GAGTCAATGCCATGTGGATG (SEQ ID NO.3); Downstream primer Wt-UTR-R: GACGAGACTCGATAACAGCC (SEQ ID NO.4); Vaccine strain E2 gene-specific primer pair: Upstream primer Vac-E2-F: GGCTGGATCTGGTTGTTCTT (SEQ ID NO.5); Downstream primer Vac-E2-R: CCTCGTAACAGCTCCATCCA (SEQ ID NO.6); Wild-type strain E2 gene-specific primer pair: Upstream primer Wt-E2-F: CCATGGATCTGGTTGTTGAG (SEQ ID NO.7); Downstream primer Wt-E2-R: CCTCGAAGTAACAGCCACCA (SEQ ID NO.8).

[0008] Preferably, the total amount of the specific primer combination is 4 μL, comprising the following components: 0.5 μL of 20 μmol / L Vac-UTR-F, 0.5 μL of 20 μmol / L Vac-UTR-R, 0.5 μL of 20 μmol / L Wt-UTR-F, 0.5 μL of 20 μmol / L Wt-UTR-R, 0.5 μL of 20 μmol / L Vac-E2-F, 0.5 μL of 20 μmol / L Vac-E2-R, 0.5 μL of 20 μmol / L Wt-E2-F, and 0.5 μL of 20 μmol / L Wt-E2-R.

[0009] Preferably, the nucleotide sequences of the specific fluorescent probe are as follows: Vac-UTR-Probe, a 5'-UTR-specific probe for the vaccine strain: FAM-AGCCTGTTACGG-BHQ1 (SEQ ID NO. 9); Wild-type strain 5'-UTR specific probe Wt-UTR-Probe: HEX-GGCTGTTATCGA-BHQ1 (SEQ ID NO.10); Vac-E2-Probe, a vaccine strain E2-specific probe: FAM-AGCTGGTTACGG-BHQ1 (SEQ ID NO.11); Wild-type strain E2-specific probe Wt-E2-Probe: HEX-GGCTGGTTACTTC-BHQ1 (SEQ ID NO.12); The fluorescent reporter group of the specific fluorescent probe is selected from one of FAM, HEX, and VIC, and the fluorescent quencher group is selected from one of BHQ1, BHQ2, and BHQ3.

[0010] Preferably, the total amount of the specific fluorescent probe is 2 μL, comprising the following components: 0.5 μL of 50 μmol / L Vac-UTR-Probe, 0.5 μL of 50 μmol / L Wt-UTR-Probe, 0.5 μL of 50 μmol / L Vac-E2-Probe, and 0.5 μL of 50 μmol / L Wt-E2-Probe.

[0011] Preferably, the fluorescent RT-PCR reaction solution comprises the following components: 2×One Step RT-PCR Mix, MgSO4, betaine, and melatonin.

[0012] Preferably, the total volume of the fluorescent RT-PCR reaction solution is 14 μL, comprising the following components: 10 μL of 2×One Step RT-PCR Mix, 3 μL of 25 mmol / L MgSO4, 0.5 μL of 5 mol / L betaine, and 0.5 μL of 10 mmol / L melatonin.

[0013] Preferably, the positive control samples are recombinant plasmids of classical swine fever virus vaccine strain and recombinant plasmids of wild-type virus strain, both with a concentration of 1×10⁻⁶. 4 The recombinant plasmid of the classical swine fever virus vaccine strain contains the target sequences of the primers shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.5, and SEQ ID NO.6, while the recombinant plasmid of the wild-type virus strain contains the target sequences of the primers shown in SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.7, and SEQ ID NO.8.

[0014] Preferably, the negative control sample is nuclease-free water.

[0015] Preferably, the kit further includes an internal control primer pair and an internal control probe. The fluorescent reporter group of the internal control probe is ROX, and the fluorescent quencher group is BHQ2. The nucleotide sequences are as follows: Upstream primer RNase P-F: AGATTGGACCTGCGAGCG (SEQ ID NO.13); Downstream primer RNaseP-R: GAGCGGCTGTCTCCACAAGT (SEQ ID NO.14); Internal control probe: ROX-TTCTGACCTGAAGGCTCTGCGCG-BHQ2 (SEQ ID NO.15).

[0016] Secondly, this application provides a non-diagnostic detection method for a fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains, specifically including the following steps: S1. Sample processing: Collect tissue samples and extract total RNA from the samples; S2. Prepare the fluorescent RT-PCR reaction system: Mix the extracted RNA with the fluorescent RT-PCR reaction solution, specific primer combination, and specific fluorescent probe, and set up a positive control group and a negative control group; S3. Sample amplification: Place the fluorescent RT-PCR reaction system in a real-time quantitative PCR instrument and set the amplification program for amplification; S4. Result determination: Detect the fluorescence signal of each channel to determine whether there is a classical swine fever virus vaccine strain, wild-type strain, or a mixed infection of both in the sample.

[0017] Preferably, in step S1, the sample is porcine serum, tonsil, or spleen tissue.

[0018] Preferably, in step S2, the positive control group includes fluorescent RT-PCR reaction solution, recombinant plasmids of classical swine fever virus vaccine strain and wild-type strain, specific primer combination, and specific fluorescent probe; the negative control group includes fluorescent RT-PCR reaction solution, nuclease-free water, specific primer combination, and specific fluorescent probe.

[0019] Preferably, in step S2, the total volume of the reaction system is 25 μL. The positive control group includes 14 μL of fluorescent RT-PCR reaction solution, 5 μL of recombinant plasmid of classical swine fever virus vaccine strain and recombinant plasmid of wild-type virus strain, 4 μL of specific primer combination, and 2 μL of specific fluorescent probe; the negative control group includes 14 μL of fluorescent RT-PCR reaction solution, 5 μL of nuclease-free water, 4 μL of specific primer combination, and 2 μL of specific fluorescent probe.

[0020] Preferably, in step S3, the amplification program is as follows: reverse transcription stage: 45-55℃ for 10-20 min; pre-denaturation stage: 90-100℃ for 2-4 min; PCR cycling stage: 90-100℃ for 4-6 s and 55-65℃ for 25-35 s for 30-50 cycles.

[0021] Preferably, in step S3, the amplification program is as follows: reverse transcription stage: 50℃ for 15 min; pre-denaturation stage: 95℃ for 3 min; PCR cycling stage: 40 cycles of 95℃ for 5 s and 60℃ for 30 s.

[0022] Preferably, in step S4, the criteria for determining infection are: If the Ct value of the FAM channel is ≤35 and a typical amplification curve appears, while there is no amplification in the HEX channel, then it is determined to be a positive result for the classical swine fever virus vaccine strain. If the Ct value of the HEX channel is ≤35 and a typical amplification curve appears, while there is no amplification in the FAM channel, then it is determined to be a positive wild-type strain of classical swine fever virus. If the Ct values ​​of both the FAM and HEX channels are ≤35 and both show typical amplification curves, it is determined to be a mixed infection of vaccine strain and wild-type strain; If neither the FAM nor HEX channels show an amplification curve, but the internal control (ROX) channel shows a typical amplification curve, then the sample is considered negative for classical swine fever virus. If no amplification is observed in any of the channels, the test is deemed invalid and must be repeated.

[0023] In summary, this application has the following beneficial effects: 1. This application innovatively designs and combines a multiple primer and probe system targeting two highly conserved and highly specific gene regions of classical swine fever virus (CSFV): the 5'-UTR and E2. This system enables precise identification of CSFV vaccine strains (such as strain C) and wild-type strains (including classic virulent strains and variants). The system includes specific UTR primer pairs and probes for both vaccine and wild-type strains, as well as specific E2 primer pairs and probes for both strains. Through dual gene target verification, it significantly reduces the risk of missed detections or misjudgments caused by mutations at a single viral gene site. The detection results are highly specific and reliable, effectively solving the core problem of inaccurate identification in existing technologies.

[0024] 2. The fluorescent RT-PCR method used in this application has extremely high detection sensitivity, enabling effective detection of samples with very low viral loads. The optimized reaction system in the kit, such as the addition of enhancing components like betaine and melatonin, effectively improves amplification efficiency and lowers the detection limit. This method is simple to operate, completing the entire process from nucleic acid amplification to result analysis within 2 hours. Compared to traditional virus isolation and identification or ordinary PCR followed by enzyme digestion identification methods, the detection speed is increased by orders of magnitude, meeting the urgent needs for rapid on-site detection and large-scale sample screening.

[0025] 3. This application incorporates a rigorous control system. The positive control uses a recombinant plasmid containing target sequences from both the vaccine strain and the wild-type virus, ensuring the accuracy of result interpretation. The internal control system (porcine RNase P gene) monitors the quality of sample nucleic acid extraction and whether the PCR process is inhibited throughout, effectively avoiding false negative results. The negative control ensures the entire detection system is free from contamination. The multi-channel (FAM, HEX, ROX) fluorescence detection mode enables simultaneous identification of the vaccine strain, wild-type virus, and sample quality in a single tube, providing clear and objective interpretation criteria and significantly reducing subjective judgment errors. Attached Figure Description

[0026] Figure 1 The image shows the amplification results of the three primer sets in Example 1. Detailed Implementation

[0027] The present application will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are only for explaining the present application and are not intended to limit the scope of the present application.

[0028] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0029] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available products.

[0030] Example 1: Design and Screening of Specific Primer Combinations Based on the genomic sequences of the classical swine fever virus vaccine strain (C strain) and the representative wild-type strain (Shimen strain), three sets of candidate specific primer combinations suitable for detecting classical swine fever virus vaccine strain and wild-type strain by fluorescent RT-PCR were designed using online biological software (http: / / www.neb.cn / ) by adjusting parameters such as Tm value, GC content, dG critical value, amplification length, and fragment region. The nucleotide sequences of each primer are shown in Table 1.

[0031] Table 1. Nucleotide sequences of candidate specific primers for each group The designed candidate primer pairs and probe combinations were screened by fluorescent RT-PCR using known concentrations of vaccine strain and wild-type virus RNA standards, according to the following reaction system: candidate specific primer combinations (8 primers, each with a concentration of 20 μmol / L, 0.5 μL of each primer), specific fluorescent probes (4 probes, each with a concentration of 50 μmol / L, 0.5 μL of each probe), 10 μL of 2×One Step RT-PCR Mix, 3 μL of 25 mmol / L MgSO4, 0.5 μL of 5 mol / L betaine, and 0.5 μL of 10 mmol / L melatonin.

[0032] Reaction procedure: reverse transcription at 50℃ for 15 min; pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 5 s; annealing / extension at 60℃ for 30 s, for a total of 40 cycles. Fluorescence signals of FAM and HEX channels were acquired at the 60℃ stage.

[0033] After the reaction was complete, the change in turbidity of the reaction system before and after the reaction was directly measured using a turbidimeter. The test results are as follows: Figure 1 As shown, compared with primer sets 2 and 3, the turbidity change of primer set 1 before and after the reaction is the most obvious, and the time required for the turbidity change is also the shortest. Therefore, primer set 1 has the best amplification effect. This application has determined that primer set 1 is the best primer set for detecting the classical swine fever virus vaccine strain and wild-type strain in the following examples.

[0034] Example 2: Detection of classical swine fever virus using a fluorescent RT-PCR detection kit to differentiate between the prepared classical swine fever virus vaccine strain and the wild-type strain. Kit components: ① Specific primer combination: 4 μL, containing primers shown in SEQ ID NO:1-8, each primer concentration is 20 μmol / L, and each primer volume is 0.5 μL; ② Specific fluorescent probes: 2 μL, containing the probes shown in SEQ ID NO:9-12, with a concentration of 50 μmol / L for each probe and a volume of 0.5 μL for each probe; ③ Fluorescent RT-PCR reaction solution: 14 μL, containing 10 μL of 2×One Step RT-PCR Mix, 3 μL of 25 mmol / L MgSO4, 0.5 μL of 5 mol / L betaine, and 0.5 μL of 10 mmol / L melatonin; ④ Positive control: containing 1×10 4 copies / μL of vaccine strain recombinant plasmid and 1×10 4 2.5 μL each of the wild-type virus recombinant plasmid (copies / μL); ⑤ Negative control: 5 μL of nuclease-free water.

[0035] ⑥ Internal control system (optional): A mixture containing 1 μL each of the internal control primers and probes shown in SEQ ID NO:13-15 (reporter group ROX), with a primer concentration of 20 μmol / L and a probe concentration of 50 μmol / L.

[0036] Sample testing: S1. Sample processing: Collect serum samples from clinically infected swine fever pigs and extract a total of 5 μL of RNA using a commercially available viral RNA extraction kit; S2. Preparation of the fluorescent RT-PCR reaction system: ① Sample tube to be tested: Mix 5 μL of extracted RNA with 14 μL of fluorescent RT-PCR reaction solution, 4 μL of specific primer combination and 2 μL of specific fluorescent probe; ② Positive control tube: Mix 5 μL of recombinant plasmid of classical swine fever virus vaccine strain and wild-type strain with 14 μL of fluorescent RT-PCR reaction solution, 4 μL of specific primer combination and 2 μL of specific fluorescent probe; ③ Negative control tube: Mix 5 μL of nuclease-free water with 14 μL of fluorescent RT-PCR reaction solution, 4 μL of specific primer combination and 2 μL of specific fluorescent probe. S3. Sample amplification: Place each tube in a real-time quantitative PCR instrument and set the reaction program: 50℃ reverse transcription for 15 min; 95℃ pre-denaturation for 3 min; 95℃ denaturation for 5 s; 60℃ annealing / extension for 30 s, for a total of 40 cycles. S4. Result determination: At the 60℃ stage, the fluorescence signals of the FAM, HEX and ROX channels are collected to determine whether there is a classical swine fever virus vaccine strain, wild-type strain or a mixed infection of the two in the sample.

[0037] The criteria for judging the test results of the reagent kit in this application are as follows: If the Ct value of the FAM channel is ≤35 and a typical amplification curve appears, while there is no amplification in the HEX channel, then it is determined to be a positive result for the classical swine fever virus vaccine strain. If the Ct value of the HEX channel is ≤35 and a typical amplification curve appears, while there is no amplification in the FAM channel, then it is determined to be a positive wild-type strain of classical swine fever virus. If the Ct values ​​of both the FAM and HEX channels are ≤35 and both show typical amplification curves, it is determined to be a mixed infection of vaccine strain and wild-type strain; If neither the FAM nor HEX channels show an amplification curve, but the internal control (ROX) channel shows a typical amplification curve, then the sample is considered negative for classical swine fever virus. If no amplification is observed in any of the channels, the test is deemed invalid and must be repeated.

[0038] Example 3: Specificity detection of classical swine fever virus vaccine strains and wild-type strains using a fluorescent RT-PCR detection kit. To verify the specificity of this kit, the methods and reaction systems described in Example 2 were used to detect the nucleic acids of classical swine fever virus vaccine strain (C strain), wild-type classical swine fever virus strain (Shimen strain), and other common porcine pathogens, including: porcine reproductive and respiratory syndrome virus (PRRSV), porcine pseudorabies virus (PRV), porcine circovirus type 2 (PCV2), porcine epidemic diarrhea virus (PEDV), porcine transmissible gastroenteritis virus (TGEV), porcine rotavirus (PoRV), and RNA extracted from healthy pig tissue. The experimental results are shown in the table below.

[0039] Table 2. Specificity detection results of the fluorescent RT-PCR kit for differentiating classical swine fever virus vaccine strains from wild-type strains. Experimental Results: As shown in Table 2, the FAM channel detected specific amplification only in the nucleic acid of the classical swine fever virus vaccine strain, and the HEX channel detected specific amplification only in the nucleic acid of the wild-type classical swine fever virus strain. The kit effectively detected both high and low concentrations of the target virus. Except for one PEDV sample where a very late, weak, non-specific signal was detected in the HEX channel, all other non-target pathogens and healthy pig tissue samples showed negative results in both channels. The Ct values ​​of all qualified samples in the internal control channel were less than 23, and the data from three replicate experiments were stable, indicating good specificity of the detection system and no cross-reactivity with common porcine pathogens.

[0040] Example 4: Sensitivity detection of the fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains. The recombinant plasmid of the classical swine fever virus vaccine strain with known copy number was serially diluted 10-fold, to a concentration of 1×10⁻⁶. 1 plasmid, 1×10 2plasmid, 1×10 3 plasmid, 1×10 4 plasmid, 1×10 5 plasmid, 1×10 6 Plasmid; the recombinant plasmid of the wild-type classical swine fever virus strain with known copy number was serially diluted 10-fold, to a concentration of 1×10⁻⁶. 1 plasmid, 1×10 2 plasmid, 1×10 3 plasmid, 1×10 4 plasmid, 1×10 5 plasmid, 1×10 6 Plasmids. The plasmids at each dilution were tested using the method and reaction system described in Example 2, with each gradient repeated 5 times.

[0041] Experimental results: The detection sensitivity of the kit applied for in this application for both classical swine fever virus vaccine strains and wild-type virus plasmids can reach 1×10⁻⁶. 1 copies / μL (i.e., 10 copies / reaction), and all replicate results were consistent. At 1×10 1 At a concentration of copies / μL, the Ct values ​​of both the FAM and HEX channels were <35, and the amplification curves were typical. This indicates that the kit in this application has extremely high detection sensitivity.

[0042] Example 5: Concordance rate detection of the fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains with other methods. To assess the accuracy and reliability of this kit, 50 clinical samples were randomly collected from different regions and farms. The sample types included 30 samples of swine serum, 10 samples of tonsil tissue homogenate, and 10 samples of spleen tissue homogenate. This sample set pre-included known positive, negative, and suspected samples.

[0043] Test method: The fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains described in this application was used. All operations were strictly performed according to the procedure described in Example 2.

[0044] Reference Method: Sequencing-based identification was used as the "gold standard." The specific procedure was as follows: First, RT-PCR amplification was performed using universal primers targeting highly conserved regions of the classical swine fever virus. The PCR products were then purified and sent to a sequencing company for bidirectional sequencing. The obtained sequences were BLAST-aligned in the NCBI database, and the vaccine strain (C strain) was clearly distinguished from the wild-type strain by analyzing characteristic single nucleotide polymorphisms (SNPs) on the 5'-UTR and E2 genes.

[0045] The results are shown in Table 3.

[0046] Table 3 Comparison of concordance rates between the reagent kit and sequencing method detection results Experimental Results: Using sequencing results as the gold standard, the detection results of the kit in this application showed that the concordance rate for detecting the classical swine fever virus vaccine strain was 100% (25 / 25), the concordance rate for detecting the wild-type strain was 95.7% (22 / 23), the overall concordance rate was 98% (49 / 50), and the Kappa value was 0.97 (>0.75). Samples showing discrepancies were replicated and verified by a third party, confirming the accuracy of the kit's results.

[0047] In summary, the fluorescent RT-PCR detection kit described in this application exhibits a high degree of consistency with the gold standard sequencing method (overall concordance rate 98%, Kappa value 0.97). It demonstrates high specificity, accurately distinguishing between vaccine strains and wild-type strains; and high sensitivity. This kit is suitable for typing and identifying classical swine fever virus in clinical samples, providing a reliable technical tool for epidemic monitoring, immunization efficacy evaluation, and eradication efforts.

[0048] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. A fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains, characterized in that, The kit includes a specific primer set, a specific fluorescent probe, a fluorescent RT-PCR reaction solution, a positive control sample, and a negative control sample. The specific primer set includes vaccine strain-specific primer pairs and wild-type strain-specific primer pairs targeting the 5'-UTR region of classical swine fever virus (CSFV), as well as vaccine strain-specific primer pairs and wild-type strain-specific primer pairs targeting the CSFV E2 gene. Their nucleotide sequences are as follows: Vaccine strain 5'-UTR specific primer pair: Upstream primer Vac-UTR-F: CAGTCAATGCCATGTGGAGC (SEQ ID NO.1); Downstream primer Vac-UTR-R: GACGAACTCCGTAACAGCT (SEQ ID NO.2); Wild-type strain 5'-UTR specific primer pair: Upstream primer Wt-UTR-F: GAGTCAATGCCATGTGGATG (SEQ ID NO.3); Downstream primer Wt-UTR-R: GACGAGACTCGATAACAGCC (SEQ ID NO.4); Vaccine strain E2 gene-specific primer pair: Upstream primer Vac-E2-F: GGCTGGATCTGGTTGTTCTT (SEQ ID NO.5); Downstream primer Vac-E2-R: CCTCGTAACAGCTCCATCCA (SEQ ID NO.6); Wild-type strain E2 gene-specific primer pair: Upstream primer Wt-E2-F: CCATGGATCTGGTTGTTGAG (SEQ ID NO.7); Downstream primer Wt-E2-R: CCTCGAAGTAACAGCCACCA (SEQ ID NO.8).

2. The fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains according to claim 1, characterized in that, The nucleotide sequences of the specific fluorescent probes are as follows: Vac-UTR-Probe, a 5'-UTR-specific probe for the vaccine strain: AGCCTGTTACGG (SEQ ID NO.9); Wild-type 5'-UTR specific probe Wt-UTR-Probe: GGCTGTTATCGA (SEQ ID NO.10); Vac-E2-Probe, a vaccine strain E2-specific probe: AGCTGGTTACGG (SEQ ID NO.11); Wild-type strain E2 specific probe Wt-E2-Probe: GGCTGGTTACTTC (SEQ ID NO.12); The fluorescent reporter group of the specific fluorescent probe is selected from one of FAM, HEX, and VIC, and the fluorescent quencher group is selected from one of BHQ1, BHQ2, and BHQ3.

3. The fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains according to claim 1, characterized in that, The fluorescent RT-PCR reaction solution comprises the following components: 2×One Step RT-PCR Mix, MgSO4, betaine, and melatonin.

4. The fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains according to claim 1, characterized in that, The positive control samples were recombinant plasmids of classical swine fever virus vaccine strain and recombinant plasmids of wild-type virus strain.

5. The fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains according to claim 1, characterized in that, The negative control sample was nuclease-free water.

6. The fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains according to claim 1, characterized in that, The kit also includes an internal control primer pair and an internal control probe. The fluorescent reporter group of the internal control probe is ROX, and the fluorescent quencher group is BHQ2. The nucleotide sequences are as follows: Upstream primer RNase P-F: AGATTTGGACCTGCGAGCG (SEQ ID NO.13); Downstream primer RNaseP-R: GAGCGGCTGTCTCCACAAGT (SEQ ID NO.14); Internal control probe: TTCTGACCTGAAGGCTCTGCGCG (SEQ ID NO.15).

7. A non-diagnostic detection method for a fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains as described in any one of claims 1-6, characterized in that, Specifically, the steps include the following: S1. Sample processing: Collect tissue samples and extract total RNA from the samples; S2. Prepare the fluorescent RT-PCR reaction system: Mix the extracted RNA with the fluorescent RT-PCR reaction solution, specific primer combination, and specific fluorescent probe, and set up a positive control group and a negative control group; S3. Sample amplification: Place the fluorescent RT-PCR reaction system in a real-time quantitative PCR instrument and set the amplification program for amplification; S4. Result determination: Detect the fluorescence signal of each channel to determine whether there is a classical swine fever virus vaccine strain, wild-type strain, or a mixed infection of both in the sample.

8. The non-diagnostic detection method of the fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains according to claim 7, characterized in that, In step S1, the sample is pig serum, tonsil or spleen tissue.

9. The non-diagnostic detection method of the fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains according to claim 7, characterized in that, In step S2, the positive control group includes fluorescent RT-PCR reaction solution, recombinant plasmids of classical swine fever virus vaccine strain and wild-type virus strain, specific primer combination, and specific fluorescent probe; the negative control group includes fluorescent RT-PCR reaction solution, nuclease-free water, specific primer combination, and specific fluorescent probe.

10. The non-diagnostic detection method of the fluorescent RT-PCR detection kit for differentiating classical swine fever virus vaccine strains from wild-type strains according to claim 7, characterized in that, In step S3, the amplification program is as follows: reverse transcription stage: reaction at 45-55℃ for 10-20 min; Pre-denaturation stage: react at 90-100℃ for 2-4 minutes; PCR cycling phase: 90-100℃, 4-6s and 55-65℃, 25-35s for 30-50 cycles.

Images