Composite bone cement
By using the bridging microsphere design of composite bone cement, the core phase change material absorbs the heat of polymerization, while the outer shell provides bioactivity, thus solving the problems of thermal damage and modulus mismatch in polymethyl methacrylate bone cement, achieving a reduction in fracture risk and active repair of bone tissue.
Patent Information
- Application Number
- CN202511206813.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-27
- Publication Date
- 2025-12-16
AI Technical Summary
Existing polymethyl methacrylate (PMMA) bone cement can cause thermal damage to bone tissue during polymerization, and its elastic modulus is much greater than that of vertebral bone tissue, increasing the risk of adjacent vertebral fractures and creating stress shielding on surrounding bone tissue, leading to reinforcement failure.
The composite bone cement used includes polymethyl methacrylate, calcium phosphate bone cement, and bridging microspheres. The bridging microspheres have a core-shell structure, with the core being a phase change material hydrogel microsphere and the shell being a porous bioglass layer. A highly interconnected mesoporous-macroporous dual network is formed through low-temperature preparation technology. The core undergoes a phase change during polymerization, absorbing heat, while the shell provides bioactivity.
It effectively avoids thermal damage, reduces elastic modulus, improves biocompatibility and osteogenic activity, dynamically adapts to the vertebral mechanical environment, significantly reduces the risk of adjacent vertebral fractures, and achieves a technological leap from passive filling to active repair and regeneration.
Smart Images

Figure BDA0005567963490000081
Abstract
Description
Technical Field
[0001] This invention belongs to the field of medical materials technology, and in particular relates to a composite bone cement. Background Technology
[0002] Osteoporotic vertebral compression fracture (OVCF) is the main type of osteoporotic fracture (also known as fragility fracture), exceeding the total number of hip, shoulder, and wrist fractures. It is the most common cause of acute and chronic low back pain in the elderly. Both symptomatic and asymptomatic OVCF can lead to severe spinal deformities, functional limitations, lung damage, and decreased quality of life.
[0003] Treatment options for OVCF include non-surgical and surgical methods. Surgical treatment, except for a few cases with vertebral instability, severe kyphosis, or neurological impairment requiring open surgery, mostly involves percutaneous vertebroplasty (PVP) or percutaneous kyphoplasty (PKP). Polymethyl methacrylate (PMMA) was the earliest and most widely used filler in PVP due to its short curing time, high adhesion, strong support, and low price, meeting the clinical requirements of immediate pain relief and early ambulation. However, long-term follow-up studies with numerous cases across multiple centers have revealed several insurmountable drawbacks of PMMA. PMMA's elastic modulus is much greater than that of vertebral bone tissue, increasing the probability of fractures in the reinforced vertebra and adjacent vertebrae. Furthermore, it can create stress shielding in surrounding bone tissue, inducing bone resorption and ultimately leading to reinforcement failure. Literature reports a vertebral refracture incidence of 10%-65.7% after PKP, with advanced age, low bone mineral density, and altered local biomechanical environment being the main risk factors. PMMA polymerizes at an average temperature of 74°C within the vertebral body. However, related studies have shown that bone tissue will undergo necrosis after being exposed to 50°C for more than 30 seconds. Therefore, PMMA can cause thermal damage to surrounding tissues, damaging surrounding osteocytes and microvascular structures. PMMA can also promote osteoclast activity and osteoblast apoptosis. Therefore, it is very important to explore new PVP fillers. Summary of the Invention
[0004] In view of this, the purpose of the present invention is to provide a composite bone cement that can avoid heat damage to bone tissue during the polymerization of polymethyl methacrylate, improve the elastic modulus, and reduce the risk of adjacent vertebral fractures.
[0005] The present invention solves the above-mentioned technical problems through the following technical means:
[0006] This invention discloses a composite bone cement comprising polymethyl methacrylate, calcium phosphate bone cement, and bridging microspheres. The total mass percentage of polymethyl methacrylate is 40-60%, the total mass percentage of bridging microspheres is 5-15%, and the remainder is calcium phosphate bone cement. The bridging microspheres have a core-shell structure, wherein the core is a phase change material hydrogel microsphere and the shell is a porous bioglass layer.
[0007] Furthermore, the phase change material hydrogel microspheres use gelatin-sodium alginate hydrogel as the matrix and encapsulate tridecanool as the phase change material.
[0008] Furthermore, the porous bioglass layer of the bridging microspheres is mesoporous bioglass.
[0009] Furthermore, the method for preparing the mesoporous bioglass includes the following steps:
[0010] A1. Dissolve Pronic F-127 and hexadecyltrimethylammonium bromide in pre-cooled dilute nitric acid aqueous solution and stir until completely dissolved to form a clear template solution;
[0011] A2. While stirring continuously at 2-8℃, add tetraethyl orthosilicate dropwise to the template solution and hydrolyze for 20-30 minutes; then add triethyl phosphate and calcium nitrate in sequence, and stir for 80-120 minutes to obtain a sol.
[0012] A3. Inject the sol into the pre-cooled mold, and then immediately transfer it to an environment of -20℃ to -80℃ for rapid freezing; during this process, the aqueous phase forms ice crystals, and Pluronic F-127 / hexadecyltrimethylammonium bromide / sol is squeezed into the gaps between the ice crystals, completing phase separation and morphology solidification.
[0013] A4. Place the frozen product into a freeze dryer. During the main drying stage, sublime water is used to remove ice crystals and most of the moisture. Then, soak the dried product in an acidic ethanol solution (ethanol containing 1% HCl) and gently stir at 30℃-40℃ for 5-7 hours.
[0014] A5. Wash repeatedly with deionized water and ethanol to remove residual acid and salt, and finally freeze-dry or supercritical CO2 drying to obtain mesoporous bioglass with a hierarchical porous structure.
[0015] In this technical solution, the use of dual template agents unexpectedly generated a highly interconnected mesoporous-macroporous dual network. The ultra-small mesopores (less than 3 nm) generated by hexadecyltrimethylammonium bromide provide a huge specific surface area for drug loading; the macropores (less than 100 μm) generated by Pranic F-127 and the ice crystal template greatly promote cell infiltration and tissue vascularization, which is impossible with a single template. The processing conditions, maintained below 60°C throughout, perfectly preserved the silanol (-SiOH) active sites on the glass surface, resulting in superior in vitro bioactivity (hydroxyapatite deposition rate) compared to high-temperature calcined mesoporous bioglass. Simultaneously, this process enables in-situ loading of thermosensitive biomolecules (such as proteins and growth factors). Furthermore, by changing the mold and freezing method, various product forms, such as mesoporous bioglass microspheres, porous scaffolds, and films, can be directly prepared in one step, eliminating subsequent processing steps such as crushing and granulation, facilitating large-scale production.
[0016] Furthermore, in step A2, when adding triethyl phosphate and calcium nitrate, 0.5-1.5 mol / L silver nitrate is also added, at a mass of 10%-30% of the mass of Prönnick F-127. This technical solution avoids the high-temperature step, and the added Ag... + Ions can be almost 100% retained in the glass network and exist in a highly dispersed form, achieving uniform, efficient and controllable release of antibacterial, osteogenic and other functions.
[0017] Furthermore, the mass ratio of Pronic F-127, hexadecyltrimethylammonium bromide, tetraethyl orthosilicate, triethyl phosphate and calcium nitrate is (3-5):(2-4):(2-3):(1-3):(1-2).
[0018] Furthermore, the preparation method of the phase change material hydrogel microspheres includes the following steps:
[0019] B1. Dissolve 5-10 parts by weight of Pranic F-127 and 1-2 parts by weight of sodium alginate in deionized water cooled in an ice-water bath, stirring until completely clear to obtain an aqueous phase. Melt 4-10 parts by weight of tridecanoic alcohol at 38-42°C. Under high-speed shearing (10,000-15,000 rpm), slowly drip the molten tridecanoic alcohol into the ice-water-cooled aqueous phase, continuing the shearing for 5-10 minutes to form a stable O / W primary emulsion. Low temperature is crucial, ensuring that the F127 molecular chains extend and accumulate at the oil-water interface.
[0020] B2. Transfer the primary emulsion to a water bath at 37-39℃ and gently stir and keep warm for 4-6 minutes to obtain an emulsion gel. At this point, a key transformation occurs: the PPO segments of F127 become hydrophobic, and their molecules spontaneously rearrange and anchor at the interface of the tridecanoyl alcohol emulsion droplets to form a dense, micellized, temperature-sensitive gel layer, completing the "primary encapsulation" of the tridecanoyl alcohol droplets.
[0021] B3. Quickly pour the emulsion gel into the mold and transfer it to -20°C to -80°C for rapid freezing. Immerse the frozen product in a pre-cooled mixed crosslinking agent solution at a temperature of <10°C.
[0022] This process causes water to form ice crystals, squeezing the emulsion droplets and polymers into the gaps between the ice crystals, physically pre-concentrating the gel network; the Ca of calcium acetate in this process... 2+ Ions diffuse into the concentrated sodium alginate region, undergoing ionic cross-linking. Sodium citrate, acting as a mild proton source and ionic strength modifier, gradually lowers the local pH at low temperatures, promoting polyelectrolyte complexation between positively charged chitosan and negatively charged alginate, forming a second physical cross-linked network. The low temperature significantly slows down the cross-linking rate, allowing cross-linked ions and protons to diffuse uniformly, avoiding the "eggshell" effect caused by excessive surface cross-linking, and resulting in a robust and uniform gel.
[0023] B4. Remove the cross-linked hydrogel, rinse with deionized water to remove excess ions, and then dry using supercritical CO2 or freeze-dry to obtain phase change material hydrogel microspheres. This method perfectly preserves the porous structure of the hydrogel and prevents the migration and leakage of tridecanoic acid during the drying process.
[0024] Furthermore, in step B3, the mixed crosslinking agent solution is an ethanol / water mixture containing 2-5 wt% calcium acetate and 1-3 wt% sodium citrate.
[0025] Furthermore, the method for preparing the bridging microspheres includes the following steps:
[0026] C1. Add the phase change material hydrogel microspheres to the sol prepared by mesoporous bioglass, stir evenly, place in a sealed container, and treat with ethanol vapor at 50-60℃ for 1-2 hours to obtain encapsulated sol microspheres; the ethanol vapor environment induces hexadecyltrimethylammonium bromide micelles to oriented and align on the surface of the microspheres.
[0027] C2. Transfer the coated sol microspheres into a vacuum dryer, place an ethanol solution containing 0.5-1 mol / L HCl at the bottom, evacuate to 0.1-0.2 MPa, maintain at 30-40℃ for 3-4 hours to obtain dried microspheres; acid-catalyzed hydrolysis and condensation of siloxane, and ethanol extraction to remove the hexadecyltrimethylammonium bromide template;
[0028] C3. Soak the dried microspheres in 0.1-0.2 mg / mL BMP-2 solution (Chinese name: bone morphogenetic protein-2, pH=7.4), shake and load at 2-4℃ for 18-30 hours, and then dry and fix using supercritical CO2.
[0029] In this technical solution, the unexpected ethanol vapor environment causes the mesoporous bioglass shell to form a radial pore structure, which greatly improves the nutrient diffusion efficiency; the low-temperature acid treatment removes the template agent and generates silanol quantum dots in the shell, which significantly enhances osteogenic activity; the elastic modulus of the hydrogel core and the mesoporous bioglass shell form a gradient transition, which increases the compressive strength of the microspheres and exceeds clinical requirements.
[0030] Furthermore, the mass ratio of the phase change material hydrogel microspheres to the mesoporous bioglass is 1:(1-2).
[0031] In summary, this application has the following beneficial effects:
[0032] 1. The bone cement in this invention uses polymethyl methacrylate (PMMA), calcium phosphate bone cement, and bridging microspheres. The outer shell of the bridging microspheres dissolves in body fluids to form a hydroxyapatite layer, which forms a strong chemical bond with bone tissue, significantly enhancing the long-term stability of the bone cement. The porous structure itself introduces a large number of micropores, effectively reducing the overall elastic modulus of the composite material, making it closer to cancellous bone. Furthermore, the porous structure can load and slowly release osteogenic factors (such as BMP-2) or antibiotics, giving it therapeutic functions. The phase transition temperature of tridecanoyl alcohol is approximately 31-33°C, very close to human body temperature. When PMMA polymerizes and releases a large amount of heat, the tridecanoyl alcohol in the core of the microspheres undergoes a solid-liquid phase transition, actively absorbing and storing a large amount of polymerization heat, firmly controlling the peak temperature inside the bone cement below 40°C, completely avoiding thermal necrosis. In subsequent processes, the phase transition material slowly solidifies and releases heat, which can promote peripheral blood circulation and tissue repair, a positive secondary effect. Furthermore, the hydrogel core becomes liquid after the phase transition, providing excellent energy absorption and damping characteristics, further optimizing mechanical properties. This active thermal regulation, rather than passive insulation, contrasts with traditional methods (such as adding sodium chloride or increasing apparent porosity), which merely passively slow down temperature rise or disperse heat with limited effectiveness and at the expense of mechanical properties. The bridging microspheres actively dissipate heat through phase transition absorption, exhibiting extremely high efficiency and a positive impact on mechanical properties, including a reduction in modulus.
[0033] 2. The bridging microspheres of the present invention are not only fillers, but their bioglass shells continuously induce osteogenic formation, transforming traditional "space-occupying" bone cement into an active scaffold with osteoconduction and even osteoinduction capabilities, thus achieving a functional leap.
[0034] 3. The bridging microspheres in the bone cement of this invention not only statically reduce the initial elastic modulus, but their hydrogel core can also deform and dissipate energy when subjected to force, providing a "shock absorber" effect, dynamically adapting to the mechanical environment of the vertebral body, and further reducing the risk of adjacent vertebral fractures.
[0035] 4. The bridging microsphere design of this invention ingeniously solves three core problems simultaneously—thermal damage, elastic modulus mismatch, and bioinertness—through a core-shell structure. Its combination of active thermal management based on phase change materials and bioactivity based on bioglass produces a significant synergistic effect greater than the sum of its parts (1+1>2), achieving a technological leap from "passive filling" to "active repair and regeneration," and yielding unexpected technical results. Detailed Implementation
[0036] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative effort are within the scope of protection of the present invention.
[0037] Example 1
[0038] This embodiment describes a method for preparing mesoporous bioglass, comprising the following steps:
[0039] A1. Dissolve 3 kg of Pronnic F-127 and 2 kg of hexadecyltrimethylammonium bromide in a 35% dilute nitric acid aqueous solution pre-cooled to 3°C, and stir until completely dissolved to form a clear template solution;
[0040] A2. While stirring continuously at 2℃, add 2kg of tetraethyl orthosilicate dropwise to the template solution and hydrolyze for 20 minutes; then add 1kg of triethyl phosphate and 1kg of calcium nitrate in sequence, and also add 0.5mol / L silver nitrate, the mass of which is 10% of the mass of Prönnik F-127. Stir for 80 minutes to obtain a sol.
[0041] A3. Inject the sol into a mold pre-cooled at 3°C, and then immediately transfer it to an environment of -20°C for rapid freezing; during this process, the aqueous phase forms ice crystals, and Pluronic F-127 / hexadecyltrimethylammonium bromide / sol is squeezed into the gaps between the ice crystals, completing phase separation and morphology solidification;
[0042] A4. Place the frozen product into a freeze dryer, and sublimate to remove ice crystals and most of the moisture during the main drying stage; then, soak the dried product in an acidic ethanol solution (ethanol containing 1% HCl) and gently stir at 30°C for 5 hours.
[0043] A5. Wash repeatedly with deionized water and ethanol to remove residual acid and salt, and finally freeze-dry or supercritical CO2 drying to obtain mesoporous bioglass with a hierarchical porous structure.
[0044] Example 2
[0045] This embodiment is a second method for preparing mesoporous bioglass, including the following steps:
[0046] A1. Dissolve 4 kg of Pronnic F-127 and 3 kg of hexadecyltrimethylammonium bromide in a 35% dilute nitric acid aqueous solution pre-cooled to 4°C, and stir until completely dissolved to form a clear template solution;
[0047] A2. While stirring continuously at 5℃, add 2.5kg of tetraethyl orthosilicate dropwise to the template solution and hydrolyze for 25 minutes; then add 2kg of triethyl phosphate and 1.5kg of calcium nitrate in sequence, and also add 0.1mol / L silver nitrate, the mass of which is 20% of the mass of Prönnick F-127. Stir for 100 minutes to obtain a sol.
[0048] A3. Inject the sol into a mold pre-cooled at 4°C, and then immediately transfer it to an environment of -50°C for rapid freezing; during this process, the aqueous phase forms ice crystals, and Pluronic F-127 / hexadecyltrimethylammonium bromide / sol is squeezed into the gaps between the ice crystals, completing phase separation and morphology solidification.
[0049] A4. Place the frozen product into a freeze dryer, and sublimate to remove ice crystals and most of the moisture during the main drying stage; then, soak the dried product in an acidic ethanol solution (ethanol containing 1% HCl) and gently stir at 35°C for 6 hours.
[0050] A5. Wash repeatedly with deionized water and ethanol to remove residual acid and salt, and finally freeze-dry or supercritical CO2 drying to obtain mesoporous bioglass with a hierarchical porous structure.
[0051] Example 3
[0052] This embodiment describes a third method for preparing mesoporous bioglass, comprising the following steps:
[0053] A1. Dissolve 5 kg of Pronnic F-127 and 4 kg of hexadecyltrimethylammonium bromide in a 35% dilute nitric acid aqueous solution pre-cooled to 5°C, and stir until completely dissolved to form a clear template solution.
[0054] A2. While stirring continuously at 8℃, add 3kg of tetraethyl orthosilicate dropwise to the template solution and hydrolyze for 30 minutes; then add 3kg of triethyl phosphate and 2kg of calcium nitrate in sequence, and also add 1.5mol / L silver nitrate, the mass of which is 30% of the mass of Prönnik F-127. Stir for 120 minutes to obtain a sol.
[0055] A3. Inject the sol into a mold pre-cooled at 5°C, and then immediately transfer it to an environment of -80°C for rapid freezing; during this process, the aqueous phase forms ice crystals, and Pluronic F-127 / hexadecyltrimethylammonium bromide / sol is squeezed into the gaps between the ice crystals, completing phase separation and morphology solidification;
[0056] A4. Place the frozen product into a freeze dryer, and sublimate to remove ice crystals and most of the water during the main drying stage; then, soak the dried product in an acidic ethanol solution (ethanol containing 1% HCl) and gently stir at 40°C for 7 hours.
[0057] A5. Wash repeatedly with deionized water and ethanol to remove residual acid and salt, and finally freeze-dry or supercritical CO2 drying to obtain mesoporous bioglass with a hierarchical porous structure.
[0058] Example 4
[0059] This embodiment describes a method for preparing phase change material hydrogel microspheres, which includes the following steps:
[0060] B1. Dissolve 5 kg of Pronnic F-127 and 1 kg of sodium alginate together in deionized water cooled in an ice-water bath and stir until completely clear to obtain an aqueous phase; melt 4 kg of tridecaneol into a liquid state at 38°C; under high-speed shear (10,000 rpm), slowly drip the molten tridecaneol into the aqueous phase cooled in an ice-water bath and continue shearing for 5 minutes to form a stable O / W primary emulsion.
[0061] B2. Transfer the initial emulsion to a 37°C water bath, gently stir and keep warm for 4 minutes to obtain an emulsion gel.
[0062] B3. Quickly pour the emulsion gel into the mold and transfer it to -20°C for rapid freezing. Immerse the frozen product in a pre-cooled 9°C mixed crosslinking agent solution, which is an ethanol / water mixture containing 2wt% calcium acetate and 1wt% sodium citrate.
[0063] B4. Take out the cross-linked hydrogel, rinse it with deionized water to remove excess ions, and then use supercritical CO2 drying or freeze drying to obtain phase change material hydrogel microspheres.
[0064] Example 5
[0065] This embodiment describes a second method for preparing phase change material hydrogel microspheres, which includes the following steps:
[0066] B1. Dissolve 7.5 kg of Pronnic F-127 and 1.5 kg of sodium alginate together in deionized water cooled in an ice-water bath and stir until completely clear to obtain an aqueous phase; melt 7 kg of tridecaneol into a liquid state at 40 °C; under high-speed shear (12500 rpm), slowly drip the molten tridecaneol into the aqueous phase cooled in an ice-water bath and continue shearing for 7.5 minutes to form a stable O / W primary emulsion.
[0067] B2. Transfer the initial emulsion to a 38°C water bath, gently stir and keep warm for 5 minutes to obtain an emulsion gel.
[0068] B3. Quickly pour the emulsion gel into the mold and transfer it to -50°C for rapid freezing. Immerse the frozen product in a pre-cooled 5°C mixed crosslinking agent solution, which is an ethanol / water mixture containing 3.5 wt% calcium acetate and 2 wt% sodium citrate.
[0069] B4. Take out the cross-linked hydrogel, rinse it with deionized water to remove excess ions, and then use supercritical CO2 drying or freeze drying to obtain phase change material hydrogel microspheres.
[0070] Example 6
[0071] This embodiment describes a third method for preparing phase change material hydrogel microspheres, which includes the following steps:
[0072] B1. Dissolve 10 kg of Pronnic F-127 and 2 kg of sodium alginate together in deionized water cooled in an ice-water bath and stir until completely clear to obtain an aqueous phase; melt 10 kg of tridecaneol into a liquid state at 42 °C; under high-speed shear (15,000 rpm), slowly drip the molten tridecaneol into the aqueous phase cooled in an ice-water bath and continue shearing for 10 minutes to form a stable O / W primary emulsion.
[0073] B2. Transfer the initial emulsion to a 39°C water bath, gently stir and keep warm for 6 minutes to obtain an emulsion gel.
[0074] B3. Quickly pour the emulsion gel into the mold and transfer it to -80°C for rapid freezing. Immerse the frozen product in a pre-cooled mixed crosslinking agent solution at 2°C. The mixed crosslinking agent solution is an ethanol / water mixture containing 5wt% calcium acetate and 3wt% sodium citrate.
[0075] B4. Take out the cross-linked hydrogel, rinse it with deionized water to remove excess ions, and then use supercritical CO2 drying or freeze drying to obtain phase change material hydrogel microspheres.
[0076] Example 7
[0077] This embodiment describes a method for preparing bridging microspheres, which includes the following steps:
[0078] C1. Add 1 kg of phase change material hydrogel microspheres prepared in Example 4 to 1 kg of mesoporous bioglass prepared in Example 1 to the sol. After stirring evenly, place it in a sealed container and treat it with ethanol vapor at 50°C for 1 hour to obtain encapsulated sol microspheres.
[0079] C2. Transfer the coated sol microspheres into a vacuum desiccator, place an ethanol solution containing 0.5 mol / L HCl at the bottom, evacuate to 0.1 MPa, maintain at 30°C for 3 hours to obtain dried microspheres;
[0080] C3. Soak the dried microspheres in 0.1 mg / mL BMP-2 solution (pH = 7.4), shake and load at 2°C for 18 hours, and then dry and fix using supercritical CO2.
[0081] Example 8
[0082] This embodiment describes a second method for preparing bridging microspheres, which includes the following steps:
[0083] C1. Add 1 kg of phase change material hydrogel microspheres prepared in Example 5 to the sol prepared from 1.5 kg of mesoporous bioglass in Example 2. After stirring evenly, place it in a sealed container and treat it with ethanol vapor at 55°C for 1.5 hours to obtain encapsulated sol microspheres.
[0084] C2. Transfer the coated sol microspheres into a vacuum desiccator, place an ethanol solution containing 0.75 mol / L HCl at the bottom, evacuate to 0.15 MPa, maintain at 35°C for 3.5 hours to obtain dried microspheres;
[0085] C3. Soak the dried microspheres in 0.15 mg / mL BMP-2 solution (pH = 7.4), shake and load at 3°C for 24 hours, and then dry and fix using supercritical CO2.
[0086] Example 9
[0087] This embodiment describes a third method for preparing bridging microspheres, which includes the following steps:
[0088] C1. Add 1 kg of phase change material hydrogel microspheres prepared in Example 6 to the sol prepared from 2 kg of mesoporous bioglass in Example 3. After stirring evenly, place it in a sealed container and treat it with ethanol vapor at 60°C for 2 hours to obtain encapsulated sol microspheres.
[0089] C2. Transfer the coated sol microspheres into a vacuum desiccator, place an ethanol solution containing 1 mol / L HCl at the bottom, evacuate to 0.2 MPa, maintain at 40°C for 4 hours to obtain dried microspheres;
[0090] C3. Soak the dried microspheres in 0.2 mg / mL BMP-2 solution (pH = 7.4), shake and load at 4°C for 30 hours, and then dry and fix using supercritical CO2.
[0091] Examples 10-15 below were conducted on four groups of Bama miniature pigs, with the bone cement formulation for each group in Examples 10-15 as follows:
[0092]
[0093] The bone cement formulations of Examples 10-15 were first prepared in vitro at room temperature, and the highest reaction temperature was measured. The specific data are shown below:
[0094] Example Example 10 Example 11 Example 12 Example 13 Example 14 Example 15 Temperature (°C) 36.9 37.8 38.7 37.5 38.6 65.1
[0095] As can be seen from the above experiments, the bone cement formula of the present invention operates at a low temperature during the reaction, and thus does not cause significant damage to existing bone tissue.
[0096] The bone cement formulations of Examples 10-15 were prepared using four female 9-month-old miniature Bama pigs, numbered as Experiment Pig 1, Experiment Pig 2, Experiment Pig 3, and Experiment Pig 4, with weights of 38.5 kg, 39 kg, 42 kg, and 46.5 kg, respectively. In October 2023, both ovaries were removed under general anesthesia, and the pigs were given 150 mg of prednisolone acetate tablets orally daily for a total of 6 months postoperatively.
[0097] Four months post-surgery, to assess osteoporosis, experimental pigs 1 and 2 underwent CT scans, which revealed a decrease in bone mass (T = -1.2).
[0098] Six months post-surgery, to assess the osteoporosis formation, experimental pig 3 underwent CT scans. The results indicated that some vertebrae had reached osteoporosis (T < -2.5), indicating that the model was essentially successful. Oral hormone therapy was discontinued, and the pigs were fed normally.
[0099] Eleven months post-surgery, the vertebral bodies (T12-L5) of four miniature pigs were reinforced using bone cement prepared according to Examples 10-15. The experimental pigs were shaved and skinned in the thoracic and lumbar regions, and under general anesthesia with intubation, the surgeries were performed by three experienced attending physicians or higher. Each vertebra was punctured unilaterally under X-ray guidance. After successful puncture, approximately 0.5 ml of a mixture of bone cement in different proportions was injected into the vertebral body. The four miniature pigs underwent the same procedure sequentially. The groups were as follows:
[0100] Example Bone cement powder volume (ml) Vertebral segment Example 10 5 Waist 1 Example 11 5 Waist 2 Example 12 5 Waist 3 Example 13 5 Waist 4 Example 14 5 Waist 5 Example 15 5 Chest 12
[0101] All experimental pigs recovered normally after surgery, had a good appetite, and stable vital signs. All experimental animals were fed the same feed in the same environment, with the animal room temperature at 22-23℃ and the relative humidity at 60-70%.
[0102] Experimental pigs 1, 2, and 4 were able to stand and walk normally after recovery. Experimental pig 3 was unable to stand on its right hind leg after postoperative recovery; it could stand on the 5th postoperative day, but its right hind leg had weak support, and it could only walk with difficulty; it recovered to stand and walk normally on the 16th postoperative day. Considering the stimulation of the nerve root during the puncture, walking was affected in the short term, but it gradually recovered and did not affect subsequent experimental observations.
[0103] Blood samples were collected from four miniature pigs before anesthesia, one month after surgery, and two months after surgery. After centrifugation at 3500 rpm for 10 min at 4℃, the supernatant was collected and stored in liquid nitrogen for ELISA to detect the expression of osteogenic and ferroptosis-related markers.
[0104] Two months after the surgery, the four miniature pigs were euthanized with medication, and samples were immediately collected, including all 24 "operated vertebrae" and 41 "unoperated vertebrae". Each vertebra was examined and found to have no obvious bone damage or deformity. The paravertebral muscles, anterior longitudinal ligament, and rib heads were dissected, and only part of the spinous process and transverse process were preserved, while the periosteum of the vertebral body was completely preserved.
[0105] The surgical vertebral body was prepared using a bone scalpel and hacksaw. A specimen containing mixed bone cement and surrounding bone was removed, approximately 1.5 cm in diameter and 0.5 cm thick. The specimen was fixed in 4% paraformaldehyde solution and stored at room temperature. Immunohistochemistry, HE staining, Masson staining, and TRAP staining were planned to be performed to detect the effects of the mixed bone cement on osteogenic and osteoclastic changes in the surrounding bone. The cancellous bone surrounding the bone cement was cut into granules, placed in EP tubes, sealed with adhesive, and stored in liquid nitrogen. After transportation to the laboratory, it was stored at -80°C. qPCR was planned to detect changes in osteogenic, osteoclastic, and ferroptosis markers (relevant primers are as follows, GAPDH-F:).
[0106] ATGGTGAAGGTCGGAGTGAAC, GAPDH-R: GCCGTGGGTGGAATCATACT; ALPL-F: CAGGATGGCAGTGAAGGGTT, ALPL-R: AAGACACACTGACCGTCGTC; NFATC 1-F: GAAAACCGACGGAGACCTGT, NFATC2-R: GGCAGGCAGGTAGGTGAAAT; TRAP-F: GCCTTGGCAACTTGGTCTTG, TRAP-R: AACTCACTAGGTGGCTTCGC).
[0107] All vertebrae of the "unoperated vertebrae" were fixed in a 4% paraformaldehyde solution. The vertebrae were then rinsed thoroughly with physiological saline solution, and surrounding tissues were further removed. Each vertebra was then individually wrapped in saline-soaked gauze, sealed in double-layered plastic bags, placed in a foam box, and stored at -20°C. Biomechanical experiments were planned to investigate the effect of different proportions of mixed bone cement on the compressive strength of osteoporotic vertebrae.
[0108] The biocompatibility of the mixed bone cement in different proportions was measured below:
[0109] 1. After obtaining samples from miniature pigs, bone density testing revealed that the vertebral body bone quality did not reach the level of osteoporosis. Therefore, a decalcification solution (0.4916 mmol / L EDTA-Na2 solution (chemical reagents including 183g EDTA-Na2 and 20g NaOH added to approximately 800ml of distilled water, vigorously stirred until completely dissolved, and then diluted to 1000ml) was used to decalcify 41 vertebral bodies. The decalcification solution was changed daily, maintaining the same concentration and volume. During each solution change, a 20ml syringe was used to inject the decalcification solution into the vertebral body through both pedicles to ensure effective internal decalcification. After 15 days of decalcification, the vertebral body bone quality was measured using a dual-energy X-ray absorptiometry (DXA) system, as shown in the table below. Osteoporosis had been achieved, and an in vitro osteoporotic vertebral body model was successfully established.
[0110] Grouping Number of examples <![CDATA[Average bone density (g / cm 2 )]]> Before decalcification 41 1.020±0.056 After decalcification 41 0.456±0.038 p-value P<0.05
[0111] 2. Measure the anterior, posterior, and lateral vertebral body heights of each vertebra and take the average value. The vertebrae were of moderate size, with a height of approximately 4 cm. A total of 32 vertebrae met the requirements and were randomly divided into six groups (A, B, C, D, E, and F), with four vertebrae in each group. Vertebral body reinforcement was performed using bone cement from different implementation methods, with approximately 1.5 ml of mixed bone cement (powder-to-liquid ratio 2.5:1) per vertebra. The groupings are as follows:
[0112] serial number A B C D E F Number of examples 4 4 4 4 4 4 Example 10 11 12 13 14 15
[0113] 3. Vertebral biomechanical experiment
[0114] Using non-standard vertebrae, compressive strength was determined on a microcomputer-controlled electronic universal testing machine (model: UTM5105, Shenzhen Sansi Zongheng Technology Co., Ltd.). Each vertebra in each group was then placed sequentially on the universal testing machine. Due to the incomplete flatness of the vertebral endplates, an initial pressure of 40N was applied to the anterior and middle columns of the vertebrae to fix them in place before testing. This pre-compression ensured that all reinforced vertebrae remained horizontal to the testing machine surface before the initial stage of biomechanical testing. After the vertebrae stabilized, the testing machine was fixed at a compression rate of 4mm / min for vertical loading. The machine was set to automatically stop when the height decreased by 40%, and pressure-displacement curves were obtained. The maximum compressive stress at vertebral fracture during compression was taken as the compressive strength, and the slope of the pressure-displacement curve between 200N and 1000N was taken as the stiffness.
[0115] The final results of the experiment are as follows:
[0116] The osteoporotic vertebrae of the decalcified Xiang pigs were divided into 6 groups (according to Examples 10-15), with 4 cases in each group. The biomechanical properties of the mixed bone cement were tested using a microcomputer-controlled electronic universal testing machine. The results are shown in the table below.
[0117] Example Number of examples Compressive strength (N) Stiffness (N / mm) Example 10 4 760.23±181.89 195.01±30.88 Example 11 4 840.93±140.67 194.34±54.44 Example 12 4 783.53±166.38 181.97±72.10 Example 13 4 809.32±142.09 163.47±97.75 Example 14 4 755.88±250.97 198.93±30.67 Example 15 4 644.01±212.54 309.85±104.64
[0118] As can be seen from the above results, the bone cement of the present invention (Examples 10-14) has both strong compressive strength and plasticity, smaller elastic modulus and good biocompatibility; at the same time, preliminary studies of related biological tests show that the mixed bone cement has osteogenic induction activity.
[0119] The above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention. Technical aspects, shapes, and structures not described in detail in this invention are all well-known technologies.
Claims
1. A composite bone cement comprising polymethyl methacrylate, characterized in that: It also includes calcium phosphate bone cement and bridging microspheres, wherein the total mass percentage of polymethyl methacrylate is 40-60%, the total mass percentage of bridging microspheres is 5-15%, and the remainder is calcium phosphate bone cement; the bridging microspheres have a core-shell structure, wherein the core is a phase change material hydrogel microsphere and the shell is a porous bioglass layer.
2. The composite bone cement according to claim 1, characterized in that, The phase change material hydrogel microspheres use gelatin-sodium alginate hydrogel as the matrix and encapsulate tridecane alcohol as the phase change material.
3. The composite bone cement according to claim 2, characterized in that, The porous bioglass layer of the bridging microspheres is a mesoporous bioglass with a pore size of 5-15 nm.
4. The composite bone cement according to claim 3, characterized in that, The method for preparing the mesoporous bioglass includes the following steps: A1. Dissolve Pronic F-127 and hexadecyltrimethylammonium bromide in pre-cooled dilute nitric acid aqueous solution and stir until completely dissolved to form a clear template solution; A2. While stirring continuously at 2-8℃, add tetraethyl orthosilicate dropwise to the template solution and hydrolyze for 20-30 minutes; then add triethyl phosphate and calcium nitrate in sequence, and stir for 80-120 minutes to obtain a sol. A3. Pour the sol into the pre-cooled mold, and then immediately transfer it to an environment of -20°C to -80°C for rapid freezing; A4. Place the frozen product into a freeze dryer. During the main drying stage, sublime will remove ice crystals and most of the moisture. Then, soak the dried product in an acidic ethanol solution and gently stir at 30℃-40℃ for 5-7 hours. A5. Wash repeatedly with deionized water and ethanol to remove residual acid and salt, and finally freeze-dry or supercritical CO2 drying to obtain mesoporous bioglass with a hierarchical porous structure.
5. A composite bone cement according to claim 4, characterized in that, In step A2, when adding triethyl phosphate and calcium nitrate, 0.5-1.5 mol / L of silver nitrate is also added, with a mass of 10%-30% of the mass of Pronnic F-127.
6. A composite bone cement according to claim 4, characterized in that, The mass ratio of Pronic F-127, hexadecyltrimethylammonium bromide, tetraethyl orthosilicate, triethyl phosphate and calcium nitrate is (3-5):(2-4):(2-3):(1-3):(1-2).
7. A composite bone cement according to claim 6, characterized in that, The preparation method of the phase change material hydrogel microspheres includes the following steps: B1. Dissolve 5-10 parts by weight of Pranic F-127 and 1-2 parts by weight of sodium alginate in deionized water cooled in an ice-water bath, and stir until completely clear to obtain an aqueous phase; melt 4-10 parts by weight of tridecaneol at 38-42°C; under high-speed shearing, slowly drip the molten tridecaneol into the aqueous phase cooled in an ice-water bath, and continue shearing for 5-10 minutes to form a stable O / W primary emulsion; B2. Transfer the initial emulsion to a water bath at 37-39℃, gently stir and keep warm for 4-6 minutes to obtain an emulsion gel. B3. Quickly pour the emulsion gel into a mold and transfer it to -20°C to -80°C for rapid freezing. Immerse the frozen product in a pre-cooled mixed crosslinking agent solution at a temperature of <10°C to obtain a hydrogel. B4. Take out the cross-linked hydrogel, rinse it with deionized water to remove excess ions, and then use supercritical CO2 drying or freeze drying to obtain phase change material hydrogel microspheres.
8. A composite bone cement according to claim 7, characterized in that, In step B3, the mixed crosslinking agent solution is an ethanol / water mixture containing 2-5 wt% calcium acetate and 1-3 wt% sodium citrate.
9. A composite bone cement according to claim 8, characterized in that, The method for preparing the bridging microspheres includes the following steps: C1. Add the phase change material hydrogel microspheres to the sol prepared by mesoporous bioglass, stir evenly, place in a sealed container, and treat with ethanol vapor at 50-60℃ for 1-2 hours to obtain encapsulated sol microspheres. C2. Transfer the coated sol microspheres into a vacuum desiccator, place an ethanol solution containing 0.5-1 mol / L HCl at the bottom, evacuate to 0.1-0.2 MPa, maintain at 30-40℃ for 3-4 hours to obtain dried microspheres; C3. Soak the dried microspheres in a 0.1-0.2 mg / mL BMP-2 solution, shake and load at 2-4℃ for 18-30 hours, and then dry and fix them using supercritical CO2 to obtain bridging microspheres.
10. A composite bone cement according to claim 9, characterized in that, The mass ratio of the phase change material hydrogel microspheres to the mesoporous bioglass is 1:(1-2).