Application of ptnf-yb9 gene in plant drought genetic improvement
By cloning and regulating the PtNF-YB9 gene of trifoliate orange, and using CRISPR and antisense RNA technology, the problem of insufficient drought resistance in citrus was solved, and the drought resistance of trifoliate orange plants was significantly improved or reduced, and physiological indicators such as photosynthetic intensity and electrical conductivity were improved.
Patent Information
- Application Number
- CN202511331024.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-17
- Publication Date
- 2026-05-22
- Estimated Expiration
- 2045-09-17
AI Technical Summary
Citrus fruits are sensitive to drought, and traditional breeding methods are insufficient to quickly cultivate drought-resistant high-quality germplasm resources. Existing genetic engineering techniques lack an effective drought-resistant gene regulatory network.
The PtNF-YB9 gene of trifoliate orange was cloned, and its expression level was regulated by knockout or overexpression. CRISPR gene editing and antisense RNA technology were used to increase or decrease its expression level in trifoliate orange plants, thereby improving drought resistance.
The study showed that the PtNF-YB9 gene significantly improved or reduced the drought resistance of trifoliate orange plants, and significantly improved physiological indicators such as photosynthetic intensity and electrical conductivity, demonstrating the important role of the PtNF-YB9 gene in regulating the drought resistance of trifoliate orange.
Smart Images

Figure FT_1 
Figure FT_2 
Figure FT_3
Abstract
Description
Technical Field
[0001] This invention belongs to the field of plant genetic engineering, specifically relating to the application of the PtNF-YB9 gene from trifoliate orange in the genetic improvement of drought resistance in plants. The applicant isolated and cloned a drought-positive regulatory gene from trifoliate orange (Poncirus trifoliata). After interfering with this gene in the trifoliate orange peel, the resulting transgenic plants were significantly more sensitive to drought, and the overexpressed plants showed increased drought resistance, demonstrating that this gene plays an important positive regulatory role in drought resistance in citrus. Background Technology
[0002] Citrus is currently the world's largest fruit tree and the third largest traded agricultural product, ranking first among all fruits in terms of planting area, yield, and import / export volume. Citrus thrives in moist conditions and is intolerant of drought, requiring ample irrigation to promote new shoot growth, flower bud development, and high-quality, high-yield production. However, in recent years, due to extreme weather events, most regions have suffered from frequent droughts caused by global warming. my country's main citrus-producing areas are mostly located in the hilly regions of the south, prone to seasonal droughts. High temperatures, low humidity, and dry air easily lead to droughts in summer, autumn, and even consecutive summer-autumn droughts, directly affecting fruit setting, fruit enlargement, and fruit development, resulting in poor quality and reduced yield. Furthermore, prolonged drought can cause irreversible damage to citrus trees, hindering photosynthesis in leaves. Mild cases result in leaf dehydration and curling, low flower bud differentiation rate and poor differentiation quality, flower and fruit drop, fruit cracking, and sunburn; severe cases lead to tree decline, wilting, and death. Therefore, cultivating drought-resistant and high-quality germplasm resources is an important requirement for the healthy development of the citrus industry.
[0003] Because most citrus fruits exhibit polyembryonic characteristics, citrus hybridization breeding faces insurmountable challenges such as long juvenile stages, embryo abortion, and distant incompatibility. Traditional breeding methods cannot meet the needs of the rapidly developing citrus industry. Grafting, as a vegetative propagation technique for citrus, is widely used in the industry. Rootstock significantly influences the quality, yield, and stress adaptability of citrus. Trifoliate orange (Poncirus trifoliata (L.) Raf), a close relative of citrus, is characterized by its preference for light and warmth, resistance to cold, humidity, drought, and disease, but inability to tolerate saline-alkali soils. Due to its good overall resistance, strong grafting compatibility, early fruiting, and high yield, it is currently widely used for grafting citrus rootstocks. Therefore, based on genetic engineering techniques, identifying important drought-resistant genes and molecular regulatory networks is of significant practical importance for creating stress-resistant citrus germplasm resources through modern methods such as gene editing.
[0004] The nuclear transcription factor Y (NF-Y) complex is a widely conserved transcriptional regulatory unit in eukaryotes, with the NF-YB subunit exhibiting significant functional differentiation and structural specificity in plants. Studies have shown that NF-YB family members form heterodimers with NF-YC through conserved histone folding domains (HFD), subsequently recruiting NF-YA or proteins containing CCT domains to assemble into functional trimers, specifically recognizing cis-elements such as CCAAT or CCACA. NF-YB members play a central role in plant development and stress responses. In Arabidopsis, LEC1 / L1L (NF-YB subtype) forms a complex with NF-YC2 and bZIP67, directly activating the storage protein genes CRC and SUS2. In rice, OsMADS14 interacts with NF-YB1, synergistically activating the key starch synthesis genes OsAGPL2 and the Waxy promoter, regulating endosperm starch accumulation. In terms of stress response, wheat TaNF-YB11 interacts with NF-YC through a phosphorylation-dependent mechanism, activating the ABA synthesis gene TaNCED3, thereby enhancing the accumulation of the osmotic regulator proline and the ability to scavenge ROS, thus improving drought resistance. Although NF-YB family transcription factors have been widely reported, their role in drought resistance in citrus is currently unknown. Studying the mechanism of action of NF-YB on drought resistance is of great value for crop drought-resistant breeding. Summary of the Invention
[0005] The present invention provides the application of trifoliate orange transcription factor PtNF-YB9 in controlling drought resistance traits in plants. Knocking out or inhibiting this gene or its homologs in plants significantly reduces drought resistance, while overexpressing this gene or its homologs significantly enhances drought resistance. The protein encoded by the trifoliate orange transcription factor PtNF-YB9 is shown in SEQ ID NO. 2.
[0006] To achieve the above objectives, the present invention adopts the following technical measures.
[0007] The applicant identified and cloned a novel gene, PtNF-YB9, from *Citrus trifoliata* using plant gene cloning technology. Its sequence is shown in SEQ ID NO. 1, and the protein it encodes is shown in SEQ ID NO. 2. The gene is 813 bp in length, encoding 270 amino acids, and its sequence is shown in SEQ ID NO. 2. The gene encoding this protein is shown in SEQ ID NO. 1. Molecular weight prediction shows that the protein has a molecular weight of 30.24 kDa and an isoelectric point (pI) of 5.71.
[0008] The applicant constructed PtNF-YB9 silent lines and analyzed the drought resistance phenotype and related physiological indicators of PtNF-YB9 transgenic plants before and after drought treatment. The results showed that compared to the unexpressed plants, the PtNF-YB9 interference lines exhibited significantly increased drought sensitivity, decreased photosynthetic intensity, and increased electrical conductivity and MDA content. Conversely, by constructing PtNF-YB9 overexpression lines, the applicant analyzed the drought resistance phenotype and related physiological indicators of PtNF-YB9 transgenic plants before and after drought treatment. The results showed that compared to the unexpressed plants, the PtNF-YB9 overexpression lines exhibited significantly increased drought resistance, decreased photosynthetic intensity inhibition, and significantly lower electrical conductivity and MDA content. This indicates that PtNF-YB9 is a potential breeding gene that positively regulates drought resistance in *Citrus trifoliata*.
[0009] The scope of protection of this invention also includes:
[0010] The application of the PtNF-YB9 gene in regulating drought resistance in trifoliate orange, wherein the protein encoded by the PtNF-YB9 gene is shown in SEQ ID NO.2.
[0011] The applications described above, specifically:
[0012] Application of increasing PtNF-YB9 gene expression in improving drought resistance of trifoliate orange;
[0013] The above-described application involves introducing substances that enhance the expression of the PtNF-YB9 gene in trifoliate orange into the trifoliate orange.
[0014] The applications described above refer to expression cassettes, recombinant vectors, or recombinant microorganisms that enhance the expression level of the PtNF-YB9 gene.
[0015] Application of knocking out or inhibiting the expression level of the PtNF-YB9 gene in reducing the drought resistance of trifoliate orange;
[0016] The application described above involves introducing a substance that reduces or eliminates the expression of the PtNF-YB9 gene in trifoliate orange into the trifoliate orange. The substance is an expression cassette, recombinant vector, or recombinant microorganism that reduces the expression of the PtNF-YB9 gene.
[0017] The above-described applications involve knockout using homologous recombination or CRISPR gene editing methods. The knockout gene translates into a protein that has no original function or cannot be translated into a protein.
[0018] The above-described applications involve inhibition using antisense RNA technology or interfering RNA technology.
[0019] The interfering RNA technology described above utilizes VIGS technology.
[0020] The PtNF-YB9 gene described in the above applications is shown in SEQ ID NO.1.
[0021] Application of reagents for detecting the PtNF-YB9 gene in the screening or breeding of drought resistance in trifoliate orange.
[0022] The method for determining the type of trifoliate orange in the above-described applications is as follows: if the expression level of the PtNF-YB9 gene is significantly higher than that of wild-type trifoliate orange, it is a drought-resistant trifoliate orange; if the gene is not detected or its expression level is significantly lower than that of normal, it is a drought-susceptible trifoliate orange.
[0023] Applications of expression cassettes, recombinant vectors, or recombinant microorganisms to enhance PtNF-YB9 gene expression in the creation of drought-resistant trifoliate oranges.
[0024] Compared with the prior art, the present invention has the following advantages:
[0025] The cloning and isolation of the drought-regulating gene PtNF-YB9 in trifoliate orange provides a new genetic resource for molecular design breeding of plant stress resistance, and a new genetic resource for implementing green agriculture and water-saving agriculture. The development and utilization of this genetic resource is conducive to reducing agricultural production costs and achieving environmental friendliness. Attached Figure Description
[0026] Figure 1 This is a technical flowchart of the present invention.
[0027] Figure 2 This is a schematic diagram of the expression mode of PtNF-YB9 in response to drought stress treatment according to the present invention.
[0028] Where: A is the relative expression level of the PtNF-YB9 gene under treatment; B is GUS staining of callus transiently transformed by the PtNF-YB9 promoter; C is quantitative analysis.
[0029] Figure 3 This is a schematic diagram of the subcellular localization of PtNF-YB9 in this invention;
[0030] Wherein: A is a schematic diagram of the construction of the PtNF-YB9 subcellular localization vector of the present invention; B is the detection of PtNF-YB9 subcellular localization of the present invention.
[0031] Figure 4 This is a schematic diagram of the PCR amplification detection results of the VIGS silencing material of this invention.
[0032] TRV2-F is the forward primer for the vector, and PtNF-YB9-R is the reverse primer for the fragment.
[0033] Figure 5This is a schematic diagram illustrating the quantitative relative expression of the PtNF-YB9 gene in the VIGS silencing material of this invention.
[0034] Figure 6 This is a schematic diagram illustrating the drought resistance analysis of the VIGS silent material of this invention;
[0035] Wherein: A is the drought resistance phenotype identification of PtNF-YB9 interferometric material (TRV-NF-YB9) and empty (TRV); B is the determination of chlorophyll fluorescence Fv / Fm values of the two groups of plants; C and D are the leaf electrical conductivity and MDA content before and after drought treatment.
[0036] Figure 7 The expression levels of this gene in different strains of PtNF-YB9 trifoliate orange were shown.
[0037] Figure 8 This is a schematic diagram illustrating the drought resistance analysis of the overexpression material of this invention;
[0038] Wherein: A is the drought resistance phenotype identification of PtNF-YB9 overexpression material (OE-NF-YB9) and empty vector (OE-EV); B is the determination of chlorophyll fluorescence Fv / Fm values of the two groups of plants; C and D are the leaf electrical conductivity and MDA content before and after drought treatment. Detailed Implementation
[0039] The present invention will now be described in detail with reference to specific embodiments. Based on the following description and embodiments, those skilled in the art can determine the basic features of the present invention, and various changes and modifications can be made to the present invention without departing from its spirit and scope to make it suitable for various uses and conditions.
[0040] Unless otherwise specified, the technical solutions described in this invention are all conventional technologies in the biological field; unless otherwise specified, the reagents or materials described are all from commercial sources.
[0041] Example 1:
[0042] Cloning of the full-length cDNA of the PtNF-YB9 gene of Citrus aurantium
[0043] Using trifoliate orange cDNA as a template, amplification was performed using a high-fidelity enzyme. The primer sequences were as follows: forward primer: 5'-ATGGATCAATCAGATCAAACACAACAGC-3', reverse primer: 5'-AGGGTCATTTTGTTGTTGTTGAGGT-3'.
[0044] The amplified product was purified and recovered using the AxyPrep-96 DNA gel extraction kit. Using seamless DNA cloning technology, the purified product was ligated into the pEASY-Blunt vector. The ligation product was then transformed into DH5α competent cells (Weidi Biotechnology, China), plated, and incubated upside down at 37°C. Spots were picked and shaken to detect bacterial growth. After PCR detection, positive clones were sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for sequencing. Based on the sequencing results, the full-length gene sequence of PtNF-YB9 was obtained.
[0045] Sequencing results revealed that the gene is 813 bp in length, encoding 270 amino acids. Molecular weight prediction showed that the protein has a molecular weight of 30.24 kDa and an isoelectric point (pI) of 5.71. The gene was named PtNF-YB9, with the nucleotide sequence shown in SEQ ID NO.1 and the amino acid sequence shown in SEQ ID NO.2.
[0046] Example 2:
[0047] Expression analysis of PtNF-YB9 under drought treatment
[0048] Wild-type trifoliate orange seedlings were grown in a light-controlled incubator until they reached 2 months of age. Seedlings with uniform growth were carefully removed from the soil substrate without damaging the root system. The roots were gently cleaned of soil with water and placed on dry filter paper for dehydration. Samples were taken at 0 h, 1 h, 3 h, 6 h, 12 h, 24 h, and 48 h. Leaves collected at each time point were immediately frozen in liquid nitrogen and then stored at -80℃ for subsequent gene expression pattern analysis.
[0049] The drought expression pattern of the PtNF-YB9 gene was analyzed using real-time quantitative PCR (qPCR). The qPCR was performed using AceQ qPCR SYBR Green Master Mix reagent (Novizan, China), following the manufacturer's instructions. The prepared reaction mixture was processed using a QuantStudio 7 Flex system (Applied Biosystems, USA) quantitative PCR analyzer.
[0050] Using Actin from Citrus aurantium as an internal reference gene, 2 -ΔΔCt The algorithm calculates gene expression. The primers used are as follows:
[0051] Actin-F: 5'-CCGACCGTARAVGCAAGGAAA-3'
[0052] Actin-R: 5'-TTCCTGTGGACAATGGATGGA-3''
[0053] PtNF-YB9-qPCR-F: 5'-GTTGTAGCTGGTGCTGGTCA-3'
[0054] PtNF-YB9-qPCR-R: 5'-GGCTTGTTGGTAGGCAAGC-3'
[0055] The results of this experiment indicate that PtNF-YB9 gene expression is strongly induced by drought, with the highest expression level occurring 3 hours after dehydration treatment, increasing approximately 10-fold compared to 0 hours. Figure 2 (A) This indicates that PtNF-YB9 is a drought-inducible gene and may play an important role in plant drought response.
[0056] Example 3:
[0057] GUS staining analysis of callus transiently transformed by the PtNF-YB9 gene promoter
[0058] 1. Carrier Construction
[0059] This experiment was based on the *Citrus aurantium* whole genome database CPBD (http: / / citrus.hzau.edu.cn / ). Specific primers were designed based on the promoter sequence of the PtNF-YB9 (Pt9g015340) gene. Amplification was performed using *Citrus aurantium* cDNA as a template with a high-fidelity enzyme (Novozymes, China). The amplification reaction system and procedure are shown in Tables 1 and 2. After ligation into the pEASY intermediate vector, sequencing was performed to confirm the PtNF-YB9 promoter sequence. The amplification primer sequences are as follows:
[0060] pPtNF-YB9-F: 5'-ATCTTCCTTCTATCGTGCTTTC-3'
[0061] pPtNF-YB9-R: 5'-GCCCAATTTTTGAAAACTTTTCCTC-3'
[0062] The amplified products were purified and recovered using the AxyPrep-96 DNA gel extraction kit (Axygene, USA). The purified products were ligated into the pEASY-Blunt vector (ligation system shown in Table 3). After incubation at room temperature for 5 min, the ligation was performed on competent E. coli DH5α cells. The cells were plated, single clones were picked, and PCR was performed for positive identification. Positive clones were sent to Wuhan Tianyi Huayu Gene Technology Co., Ltd. for sequencing. Based on the sequencing results, the promoter sequence of the PtNF-YB9 gene was obtained.
[0063] Using the plasmid with correct sequencing results from the previous step as a template, specific primers were designed to amplify the 5' end of each vector by adding a 15-20 bp sequence from the linearized vector terminal as a homologous sequence. This primer pair was then used to amplify the insert fragment containing the homologous sequence. Using the OneStep Cloning Kit (Novizan, China), the insert was ligated between the PstⅠ and BamHI restriction sites on the DX2181G vector. After successful sequencing, the constructed vector was transformed into GV3101 competent cells. The primers used are as follows:
[0064] pPtNF-YB9-DX2181G-F:
[0065] 5'- CTACAGCGCTAAGCTTTGGCTGCAGCAATCTTCCTTCTATCGTGCTTTC -3'
[0066] pPtNF-YB9-DX2181G-R:
[0067] 5'- AAGGGACTGACCACCCGGGATCCGCCCAATTTTTGAAAACTTTTCCTC -3'
[0068] 2. Sweet orange wound healing instant transformation
[0069] (1) Suspension callus: 4-5 days in advance, use a sterile spoon to transfer the prepared sweet orange callus to 50 ml of MT liquid culture medium and shake it thoroughly on a shaker (120 r / min) in a dark room at room temperature;
[0070] (2) Activation of Agrobacterium: Take Agrobacterium stored at -80℃, streak it in LB solid medium (containing antibiotics with carrier resistance) with a sterile inoculation loop, and incubate it upside down in a 28℃ incubator for 2 days until single colonies grow;
[0071] (3) Expanding culture: Use a sterile inoculation loop to pick up a single colony on the plate, inoculate it again onto LB solid medium with the same resistance, streak it twice, and incubate it upside down in a 28℃ incubator for 2-3 days. After the colony has grown, it can be used for infection.
[0072] (4) Preparation of infection solution: On a clean bench, scrape the Agrobacterium cells that have been streaked twice with a sterile knife and add them to 50 ml of suspension medium containing 50 mg / L AS (MT liquid + 0.5 g / L maltose + 1.5 g / L L-glutamine). Shake at 200 r / min for 20 min at 28℃ to fully disperse the cells. Then adjust the OD600 value of the bacterial solution to between 0.6 and 0.8 with MT suspension.
[0073] (5) Infection and culture: Let the shaken callus stand for a few minutes until the callus sinks to the bottom of the bottle. Carefully pour off the liquid on top. Use a sterile spoon or tweezers to transfer the callus to a glass dish lined with sterile filter paper. Drain the water and then transfer it to the prepared Agrobacterium infection solution. Shake at 30 ℃ for 10 min at 200 r / min and let stand for 30 min. Similarly, spread the infected callus on multiple layers of filter paper until the callus dries (let stand at low wind speed in a clean bench for about 40 min). Transfer the callus to co-culture medium (MT solid medium + 50 mg / L AS) with sterile filter paper and incubate at room temperature in the dark for 3-5 days.
[0074] (6) After co-culturing for 3 days, part of the callus tissue was kept in the co-culture medium, and the other part was transferred to MT medium (MT solid medium + 50 mg / L AS + 10% PEG) containing 10% PEG to simulate drought treatment, and then GUS staining was performed.
[0075] 3. GUS staining analysis
[0076] GUS staining of sweet orange callus was performed using a GUS staining kit (coolaber, SL7160, China), and the GUS staining results were quantified using ImageJ software.
[0077] The results of this experiment show that the callus transformed by pPtNF-YB9:GUS without drought treatment is light yellow, while the callus transformed by pPtNF-YB9:GUS becomes significantly darker blue after drought treatment. Figure 2 (Middle B), indicating that drought can enhance the activity of the PtNF-YB9 promoter ( Figure 2 (C), further demonstrating that PtNF-YB9 is strongly induced to express by drought.
[0078] Example 4:
[0079] PtNF-YB9 gene subcellular localization
[0080] Amplify the ORF region of PtNF-YB9 (without a stop codon) using the following primer sequences (underlined portions indicate restriction enzyme sites):
[0081] p101YFP-PtNF-YB9-F:5'- ATGGGATCTACTAGTGAATTCATGGATCAATCAGATCAAACACAACAGC -3'
[0082] p101YFP-PtNF-YB9-R:5'-GGGGGTACCGTCGACGGATCCAGGGTCATTTTGTTGTTGTTGAGGT-3';
[0083] The target gene was constructed into the p101YFP vector (containing YFP protein, CN118085051B). The YFP protein is located at the 3' end of the gene, and its expression is driven by the CaMV35S promoter. Figure 3 (A) 35S:PtNF-YB9-YFP+mCherry and control 35S:YFP (i.e., empty p101YFP vector)+mCherry were transiently transformed into leaf epidermal cells of *Nicotiana benthamiana*. Laser confocal fluorescence observation revealed that the control cell fluorescence filled the entire epidermal cell, including the cytoplasm and nucleus, while the fluorescence of the 35S:PtNF-YB9-YFP transformed cell was concentrated only in the nucleus. This indicates that PtNF-YB9 is a nuclear localization protein (…). Figure 3 (B)
[0084] Example 5:
[0085] VIGS Interference Identification of Trifoliate Orange and Positive Seedlings
[0086] 1. Carrier Construction
[0087] Using *Citrus aurantium* cDNA as a template, specific primers were designed to amplify a non-conserved region of approximately 500 bp in the CDS of the PtNF-YB9 gene. A one-step ligation method using a OneStep Cloning Kit (Novizan, China) was employed to insert the fragment between the BamHI and SmaI restriction sites on the pTRV2 vector, yielding the recombinant plasmid TRV2-PtNF-YB9. The empty vector was a vector plasmid containing no target fragment. Both the correctly sequenced recombinant plasmid and the empty vector plasmid were transformed into GV3101 competent cells. The primers used to construct the vector are as follows (underlined portions indicate restriction sites):
[0088] pTRV2- PtNF-YB9-F (BamH I):5'- AGAAGGCCTCCATGGGGATCCATGGATCAATCAGATCAAACACAACAGC -3';
[0089] pTRV2- PtNF-YB9-R (Sma I):5'-TGTCTTCGGGGACATGCCCGGGGTGATTCTTGAAGTCGGCCG-3'.
[0090] 2. VIGS infection
[0091] Seeds were isolated from the fruit of the trifoliate orange, soaked in 1 mol / L NaOH solution for 15 min to remove pectin, rinsed twice with sterile water, and then spread flat on a moistened clean gauze. They were then placed in a 28 ℃ incubator in the dark to germinate. Once the seedlings had germinated to 1-2 cm in length, they were ready for VIGS infection. The procedure is as follows:
[0092] 1) Agrobacterium containing TRV1, TRV2, TRV2-PtNF-YB9, etc., were streaked onto LB solid medium (containing 50 mg / L Rif and 50 mg / L Kan) and cultured upside down at 28 ℃ for 2-3 days to obtain single clones;
[0093] 2) Pick one single clone from each culture and place it in 5 mL of LB liquid medium containing the same antibiotic. Incubate at 28 °C and 220 r / min for 24-48 h with gentle shaking to fully activate the cells.
[0094] 3) Inoculate the activated Agrobacterium tumefaciens bacterial suspension at a ratio of 1:100 into LB liquid medium containing the same culture medium. Incubate at 28 °C and 220 r / min for 10-12 h. Centrifuge at 4000 r / min to collect the bacterial cells. Resuspend the cells in MES buffer (10 mmol / L MES, 10 mmol / L MgCl2, 150 μmol / L AS, pH=5.6-5.7). OD 600 Adjust to 1.0;
[0095] 4) Mix TRV1 and TRV2, and TRV1 and TRV2-PtNF-YB9 resuspensions in a 1:1 ratio respectively. After mixing, incubate in the dark at 28 ℃ for 2-3 h to prepare the infection solution.
[0096] 5) Use a syringe needle to gently poke some small holes in the germinating seedlings, completely immerse them in the prepared Agrobacterium infection solution, vacuum for 10 minutes, then quickly release the air to allow the Agrobacterium to penetrate the germinating seeds. Repeat this process 3 times. After that, let them stand for 15 minutes, then remove the infected seeds and air them on dry filter paper. After standing for 2-3 minutes, spread them evenly in a large dish with filter paper moistened with sterile water. Incubate in a dark room at room temperature for 2-3 days.
[0097] 6) Rinse the seeds after dark culture with clean water to remove residual bacterial solution, sow them in the substrate (soil:vermiculite = 3:1), and grow them in a room temperature light incubator for about one month before positive identification.
[0098] 3. Identification of positive materials
[0099] VIGS-silenced trifoliate orange positive plants were identified by PCR using extracted trifoliate orange DNA as a template and a reverse primer constructed from the TRV2 forward primer and the target gene recombinant vector. The sequences are as follows:
[0100] TRV2-F: 5'-ATTCACTGGGAGATGATACGCT-3'
[0101] PtNF-YB9-R: 5'-gtgattcttgaagtcggccg-3'.
[0102] The results are as follows Figure 4 As shown, the recombinant plasmid carrying the target gene in the VIGS vector was successfully transformed into the plant. The PtNF-YB9 gene in the positive plants was quantified using the real-time quantitative PCR (qPCR) method described in Example 2. The results are as follows. Figure 5 As shown, the expression level of the PtNF-YB9 gene in VIGS-silenced trifoliate orange plants was significantly lower than that in the control group.
[0103] Example 6:
[0104] Drought resistance identification of PtNF-YB9 trifoliate orange
[0105] Positive plants with high inhibition levels of TRV-PtNF-YB9 expression in the silent line were selected and subjected to drought treatment. Before treatment, there was no significant difference in growth between the empty vector plants (TRV2) and the silent line plants (TRV2-NF-YB9). However, after 22 days of natural drought treatment, the TRV2-PtNF-YB9 silent line plants showed severe leaf curling, yellowing and drying, and even death, while the empty vector plants only showed mild yellowing and wilting. Figure 6 (A) This indicates that TRV2-NF-YB9 interference significantly increased drought stress damage in trifoliate orange. Simultaneously, chlorophyll imaging showed that the photosynthetic intensity of the TRV2-NF-YB9 silent line plants after drought treatment was significantly lower than that of the untreated plants, and the Fv / Fm value was also significantly reduced. Figure 6 (B) indicates that the photosynthetic response of the TRV2-NF-YB9 silent line was severely inhibited under drought stress. The electrical conductivity and MDA content of the TRV2-NF-YB9 silent line after drought... Figure 6 The values of C and D in the middle were significantly higher than those in the uninoculated plants, indicating that the TRV2-NF-YB9 silent line plants suffered greater drought damage compared to the uninoculated plants.
[0106] The above results demonstrate that silencing PtNF-YB9 can significantly reduce the drought resistance of trifoliate orange plants, further proving the important regulatory role of PtNF-YB9 in improving plant drought resistance.
[0107] Example 6:
[0108] Construction of overexpression of trifoliate orange plants
[0109] 1. Carrier Construction
[0110] Using trifoliate orange cDNA as a template, recognition sequences for type IIs restriction enzymes (such as BsaI and BbsI) were introduced into the 5' and 3' ends of the full-length CDS of the PtNF-YB9 gene via PCR. The amplified and recovered target fragment product was mixed with the pGK1300-OE empty vector, and then digested and ligated with BbsI and T4 ligase and related reaction buffers.
[0111] Reaction program: (37 ℃ 10 min, 16 ℃ 10 min) 3 cycles; 85 ℃ 20 min, 16 ℃ hold
[0112] The primers for constructing the vector are as follows (underlined parts indicate restriction enzyme sites):
[0113] PtNF-YB9-1300-F:5'- gtGAAGACAAAATGATCTTCCTTCTATCGTGCTTTC -3';
[0114] PtNF-YB9-1300-R:5'-gtGAAGACAAAAGCGCCCAATTTTTGAAAACTTTTCCTC-3'.
[0115] 2. Transformation of Citrus Hairy Roots
[0116] Select citrus materials that have grown for about six months to one year, with slightly firm stems, good growth, and no pests or diseases. Use pruning shears to remove the root system of the citrus material, retaining stem segments of suitable length for infection. Immerse the lower part of the stem segments in Agrobacterium rhizogenes solution under vacuum at less than 30 psi for 30 minutes. Transfer the explants to culture bottles containing moist vermiculite, watering and observing regularly. Hairy roots induced by Agrobacterium rhizogenes will be visible approximately one month after infection. The success of the transformation of the target vector can be visualized using a fluorescence microscope or a handheld fluorescent lamp. Remove any non-positive roots that do not contain the target vector. Continue culture for about one month to induce a large number of roots, which can be used for subsequent resistance analysis and other experiments.
[0117] 3. Identification of positive materials
[0118] The expression level of the PtNF-YB9 gene in plants overexpressing PtNF-YB9 was detected by real-time quantitative PCR, as shown in Example 2. The results are as follows. Figure 7As shown, the expression level of this gene in the overexpressing PtNF-YB9 trifoliate orange was significantly higher than that in the wild type (OE-EV). OE plants with higher PtNF-YB9 expression levels than empty vector plants were selected as positive materials for further drought resistance analysis.
[0119] Example 7:
[0120] Identification of drought resistance in Citrus aurantium with overexpression of PtNF-YB9
[0121] PtNF-YB9 overexpression-positive plants were subjected to drought treatment. Before treatment, there was no significant difference in growth between empty vector plants (OE-EV) and overexpression plants (OE-NF-YB9). However, after 30 days of natural drought treatment, OE-PtNF-YB9 plants only showed slight yellowing and wilting, while empty vector plants showed severe leaf curling, yellowing and drying, and even death. Figure 8 (A) indicates that OE-NF-YB9 significantly improved the drought resistance of trifoliate orange. Simultaneously, after drought treatment, the photosynthetic intensity of OE-NF-YB9 plants was significantly lower than that of the untreated plants, and the Fv / Fm value was also significantly reduced. Figure 8 (B) indicates that the photosynthetic response of OE-NF-YB9 plants under drought stress was significantly less inhibited than that of the unloaded plants. The electrical conductivity and MDA content of OE-NF-YB9 plants after drought... Figure 8 The values of C and D in the OE-NF-YB9 plants were also significantly lower than those in the unloaded plants, indicating that the drought resistance of the OE-NF-YB9 plants was significantly improved compared to the unloaded plants.
[0122] The above results demonstrate that overexpression of PtNF-YB9 can significantly improve the drought resistance of trifoliate orange plants, further proving the positive regulatory role of PtNF-YB9 in improving plant drought resistance.
Claims
1. Improve PtNF-YB9 Gene expression levels increase in trifoliate orange (Illicium verum) Poncirus trifoliata Application of drought resistance in the above-mentioned PtNF-YB9 The protein encoded by the gene is shown in SEQ ID NO.
2.
2. The application according to claim 1, characterized in that: Its application process involves improving the quality of trifoliate orange. PtNF-YB9 Substances that increase gene expression levels are introduced into trifoliate orange.
3. The application according to claim 2, characterized in that: The substance described is for improving PtNF-YB9 Gene expression cassettes, recombinant vectors, or recombinant microorganisms.
4. Inhibition PtNF-YB9 The application of gene expression in reducing the drought resistance of trifoliate orange, as described above. PtNF-YB9 The protein encoded by the gene is shown in SEQ ID NO.
2.
5. The application according to claim 4, characterized in that: Its application process involves inhibiting the growth of trifoliate orange. PtNF-YB9 The substance that reduces gene expression or inhibits gene expression is introduced into trifoliate orange. PtNF-YB9 Gene expression cassettes, recombinant vectors, or recombinant microorganisms.
6. Testing PtNF-YB9 The application of gene-based reagents in the screening or breeding of drought resistance in trifoliate orange, as described above. PtNF-YB9 The protein encoded by the gene is shown in SEQ ID NO.
2.
7. The application according to claim 6, wherein the determination method in the application is: if detected PtNF-YB9 If the gene expression level is significantly higher than that of wild-type trifoliate orange, it is a drought-resistant trifoliate orange; if the gene is not detected or the gene expression level is significantly lower than that of normal, it is a drought-susceptible trifoliate orange.
8. Improve PtNF-YB9 The application of gene expression cassettes, recombinant vectors, or recombinant microorganisms in the preparation of drought-resistant trifoliate orange, wherein the gene... PtNF-YB9 The encoded protein is shown in SEQ ID NO.
2.
9. The application according to claim 1, 4, 6 or 8, wherein... PtNF-YB9 The gene is shown in SEQ ID NO.1.
Citation Information
Patent Citations
Application of cold-resistant gene PtrERF9 of Poncirus trifoliata in cold-resistant genetic improvement of plants
CN112898391A
Poncirus trifoliate cold-resistant gene PtrP5CS1 and application thereof in cold-resistant genetic improvement of plants
CN116622655A