Enzyme compositions, reagents, kits, and library construction methods for improving the efficiency and sensitivity of plasma DNA library construction.

Abstract

This invention relates to the field of library construction, and particularly to enzyme compositions, reagents, kits, and methods for improving the efficiency and sensitivity of plasma DNA library construction. This invention improves the sensitivity of pathogen detection by modifying the plasma DNA library construction method. By adding a specific ligase during traditional adapter ligation, the enrichment of small nucleic acid fragments is enhanced, thereby increasing detection sensitivity. Subsequently, the multi-round magnetic bead purification step after adapter ligation is eliminated, and a specific mixed enzyme treatment system is added for PCR activation, effectively removing adapter dimers, reagent residues, and human interference. Furthermore, this method optimizes the PCR reaction based on the traditional library construction process, significantly improving the detection effect of pathogen DNA.

Description

Technical Field

[0001] This invention relates to the field of library construction, and particularly to enzyme compositions, reagents, kits, and methods for improving the efficiency and sensitivity of plasma DNA library construction. Background Technology

[0002] Metagenomic next-generation sequencing (mNGS) holds immense potential in patients with suspected infections across various fields due to its broad-spectrum detection capabilities. Since blood flows through all tissues and organs throughout the body, even localized infections outside the bloodstream may allow sufficient pathogenic DNA fragments to enter the bloodstream and be detected by mNGS.

[0003] Previous studies have shown that pathogen genomic DNA from other sites of infection can be detected in cell-free plasma DNA (cfDNA), highlighting the significant potential of non-invasive plasma cfDNA in the field of infection control. Compared to other local bodily fluid samples, blood samples have a high host concentration, which significantly impacts the sensitivity of blood mNGS detection. Especially in cases of low-abundance pathogen infection, the background noise of host DNA can make pathogen signals difficult to distinguish, leading to false negatives. Abnormal host conditions (overgrowth of symbiotic microorganisms, increased permeability of the intestinal mucosal barrier, or impaired immune function), contamination during sample collection, and contamination during the experimental procedure can all contribute to false positives in blood mNGS detection. Previous studies have found that bacterial DNA levels in blood are typically low; in the lower quartile of sepsis patients, only 5 bacterial genome copies per milliliter were detected. Therefore, the reduced sensitivity of blood mNGS detection is extremely concerning for patients with non-septic infections.

[0004] Existing technologies primarily address adapter contamination in plasma DNA library construction through traditional multi-round purification steps. Existing solutions typically include the following steps (such as...) Figure 1 (as shown)

[0005] (1) Extraction of plasma cfDNA: Plasma cfDNA was extracted using the magnetic bead method.

[0006] (2) End repair and 5' end phosphorylation of extracted plasma DNA followed by magnetic bead purification: End repair involves converting 3' or 5' protruding ends into blunt ends using end repair enzyme solutions (such as T4 DNA polymerase or T4 polynucleotide kinase), followed by 5' end phosphorylation. Subsequently, magnetic bead purification is used to remove impurities such as enzymes and dNTPs.

[0007] (3) 3' end suspension with dA and magnetic bead purification: dA is added to the 3' end of the DNA fragment to make it complementary to the subsequent adapter, improving ligation efficiency. Then, magnetic beads are used for purification to remove unbound dATP, enzymes, and other impurities, and the DNA fragment with added dA is recovered.

[0008] (4) Adapter ligation and magnetic bead purification: The DNA suspended at the 3' end was ligated to the sequencing adapter to obtain the ligation product. Then, it was purified using magnetic beads.

[0009] (5) Library amplification and magnetic bead purification: The purified DNA fragments are added to specific primers and amplification reagents for PCR amplification, and then purified using magnetic beads.

[0010] (6) Obtaining DNA library: Use Qubit to quantify plasma DNA library to obtain qualified library.

[0011] There are other methods such as Figure 2 As shown:

[0012] (1) Extraction of plasma cfDNA: Plasma cfDNA was extracted using the magnetic bead method.

[0013] (2) End repair and A addition: The enzyme combination solution was used to carry out the end repair and A addition reaction to obtain the end repair and A addition products.

[0014] (3) Adapter ligation and magnetic bead purification: The DNA suspended at the 3' end was ligated to the sequencing adapter to obtain the ligation product. Then, it was purified using magnetic beads.

[0015] (4) Library amplification and magnetic bead purification: The purified DNA fragments are added to specific primers and amplification reagents for PCR amplification, and then purified using magnetic beads.

[0016] (5) Obtaining DNA library: Use Qubit to quantify plasma DNA library to obtain qualified library.

[0017] It is evident that the main drawbacks of existing technologies include:

[0018] (1) Poor removal of host DNA: Existing methods cannot effectively remove host DNA from plasma DNA libraries, which often causes the pathogen DNA signal to be masked by the background noise of the host DNA, especially in the case of low abundance pathogen infection, which easily leads to false negative results.

[0019] (2) Adapter dimer contamination: Although traditional methods use multiple purification steps to remove adapter contamination, they still cannot completely avoid the residue of adapter dimers, which has a negative impact on the quality and accuracy of the final library.

[0020] (3) Insufficient enrichment of small DNA fragments: In the existing technology, due to the failure to effectively enrich free small nucleic acid fragments, especially DNA from low-abundance pathogens, the loss of small fragments further reduces the sensitivity of pathogen detection and affects the accuracy of detection.

[0021] In summary, while existing technologies have simplified sample processing procedures to some extent (reducing purification steps), they still face technical challenges such as adapter dimer residue and loss of small fragments of pathogen-free nucleic acids. Therefore, there is an urgent need for a plasma DNA library construction scheme that can efficiently enrich and reduce the risk of adapter dimer residue. Summary of the Invention

[0022] In view of this, the present invention improves the sensitivity of pathogen detection by modifying the plasma DNA library construction method. By adding a specific ligase during the traditional adapter ligation process, the enrichment of small nucleic acid fragments is enhanced, thereby improving detection sensitivity. Subsequently, the multi-round magnetic bead purification step after adapter ligation is eliminated, and a specific mixed enzyme treatment system is added for PCR reaction activation, effectively removing adapter dimers, reagent residues, and human interference. Furthermore, this method optimizes the PCR reaction based on the traditional library construction process, significantly improving the detection effect of pathogen DNA.

[0023] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0024] In a first aspect, the present invention provides an enzyme composition comprising a mixed ligase and a PCR activating enzyme;

[0025] The mixed ligase includes T4 DNA ligase, R2D ligase (from phage CR9), and Polμ DNA polymerase;

[0026] The PCR activating enzymes include T5 exonuclease and EXO-1 enzyme.

[0027] In some specific embodiments of the present invention, the enzyme activity ratio of T4 DNA ligase, R2D ligase (derived from bacteriophage CR9), and Polμ DNA polymerase in the mixed ligase is 10:10:(0.025~0.2).

[0028] In the PCR activating enzyme, the activity ratio of T5 exonuclease to EXO-1 enzyme is 6:(3~9).

[0029] In a second aspect, the present invention also provides the use of the enzyme composition in the preparation of reagents or kits for any of the following:

[0030] (I) Reduce host DNA background noise during plasma DNA library construction; and / or

[0031] (II) Avoid joint dimer residue; and / or

[0032] (III) Avoid insufficient enrichment of small fragments; and / or

[0033] (IV) Improve the sensitivity and / or accuracy of pathogen DNA detection; and / or

[0034] (V) Improve the efficiency of library construction; and / or

[0035] (VI) Simplify the workflow for building a library; and / or

[0036] (VII) Reduce the risk of contamination during the library construction process; and / or

[0037] (VIII) Improve the specificity and / or purity of pathogen DNA detection.

[0038] Thirdly, the present invention also provides an enzyme combination reagent, comprising the enzyme composition described above.

[0039] In some specific embodiments of the present invention, the enzyme combination reagent includes a ligase mixture and a PCR activation solution;

[0040] The ligase mixture comprises, in 50 µL increments:

[0041] T4 DNA ligase 5 U / µL 2 µL;

[0042] R2D ligase 10 U / µL 1 µL;

[0043] Polμ DNA polymerase 0.05 U / µL 0.5~4 µL;

[0044] 5 µL of 10× T4 ligase buffer;

[0045] dATP (10 mM) 1 µL;

[0046] Add nuclease-free water to a final volume of 50 µL;

[0047] The PCR activation solution comprises, in 30 µL increments:

[0048] T5 exonuclease 1 U / µL 6µL;

[0049] EXO-1 enzyme 1 U / µL 3~9 µL;

[0050] 10× NEB Buffer 23 µL;

[0051] Nuclease-free water was added to a final volume of 30 μL.

[0052] Fourthly, the present invention also provides a kit comprising the enzyme composition or the enzyme combination reagent.

[0053] Fifthly, the present invention also provides any of the following applications in library construction;

[0054] (I) The enzyme composition described above;

[0055] (II) The enzyme combination reagents described above; or

[0056] (III) The kit described above.

[0057] Sixthly, the present invention also provides a library construction method, comprising the following steps:

[0058] Step 1: Obtain cell-free DNA from plasma;

[0059] Step 2: Repair the DNA fragment ends by adding A to form sticky ends, thus obtaining the end repair product;

[0060] Step 3: Connect the ligase mixture in the enzyme combination reagent to obtain the ligated product;

[0061] Step 4: Activate the PCR reaction using the PCR activation solution in the enzyme combination reagent. Obtain the PCR activation product;

[0062] Step 5: Library amplification;

[0063] Step 6: Library purification and quality control;

[0064] This does not include the multi-round magnetic bead purification step after connector connection.

[0065] In some specific embodiments of the present invention, in step 3, the connection reaction system of the connector, calculated as 67.5 µL, comprises:

[0066] 50 µL of the end-repair product obtained in step 2;

[0067] 15 µL of ligase mixture;

[0068] 2.5 µL of diluted universal adapter primers (0.25 μM);

[0069] Preferably, the universal adapter primer has:

[0070] (I) Nucleotide sequences as shown in SEQ ID No. 1 and SEQ ID No. 2; or

[0071] Nucleotide sequences as shown in SEQ ID No. 3 and SEQ ID No. 4;

[0072] (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I), and which has the same or similar function to the nucleotide sequence shown in (I); or

[0073] (III) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in (I) or (II);

[0074] Preferably, the temperature at which the connector is connected is 20 ℃, and the connection time is 15 min;

[0075] Preferably, in step 4, the reaction system for PCR activation comprises, in 70.5 µL increments:

[0076] The ligation product obtained in step 3 was 67.5 µL;

[0077] The PCR activation solution was 3 µL;

[0078] Preferably, the PCR reaction activation procedure includes: heating at 105 °C; 37 °C for 5 min; 85 °C for 5 min; and holding at 4 °C.

[0079] In some specific embodiments of the present invention, in step 5, the amplification system for library amplification, calculated as 100.5 µL, includes:

[0080] 70.5 µL of the PCR reaction activation product;

[0081] 5 µL of adapter primer (20 μM);

[0082] PCR amplification premix 25 µL;

[0083] Preferably, the degree of library amplification includes: hot capping at 105 °C; 95 °C for 3 min; 98 °C for 20 s → 60 °C for 15 s → 72 °C for 30 s; 14 cycles; 72 °C for 5 min; and holding at 4 °C.

[0084] Preferably, the adapter primer has:

[0085] (I) Nucleotide sequences as shown in SEQ ID No. 5 and SEQ ID No. 6; or

[0086] Nucleotide sequences as shown in SEQ ID No. 7 and SEQ ID No. 8;

[0087] (II) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I), and which has the same or similar function to the nucleotide sequence shown in (I); or

[0088] (III) A nucleotide sequence having at least 90% sequence homology with the nucleotide sequence described in (I) or (II).

[0089] This patent aims to address the issue of the impact of excessively high host DNA proportions on the sensitivity of pathogen detection during plasma DNA library construction. Existing plasma DNA library construction methods cannot effectively remove host DNA and adapter dimers, causing the pathogen DNA signal to be masked by background noise from the host DNA, thus affecting the detection accuracy of low-abundance pathogens. Furthermore, traditional methods fail to effectively enrich small nucleic acid fragments, leading to the loss of small pathogen-free nucleic acid fragments, further reducing the sensitivity of pathogen detection.

[0090] (1) Improve the sensitivity of pathogen detection: By adding specific mixed ligases during adapter ligation, small fragment nucleic acids are enriched, thereby significantly improving the detection sensitivity of low-abundance pathogen DNA in blood samples.

[0091] (2) Removal of host DNA interference: This invention optimizes the library construction process, eliminating the need for traditional multi-round magnetic bead purification after adapter ligation, and using specific enzymes for PCR activation. This removes host DNA from the plasma DNA library, reducing background noise and preventing interference from host DNA on pathogen DNA signals, thereby improving the accuracy of pathogen detection.

[0092] (3) Simplify the PCR amplification process: By optimizing the PCR reaction procedure, the number of purification steps in the traditional method is reduced, the operation process is simplified, the experimental time is shortened, and the quality of library construction and detection sensitivity are maintained or improved. Attached Figure Description

[0093] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the description of the embodiments or the prior art will be briefly introduced below.

[0094] Figure 1 This shows the routine plasma DNA bank construction process from earlier years;

[0095] Figure 2 This demonstrates the routine plasma DNA bank construction process in recent years;

[0096] Figure 3 This is a flowchart of the patent.

[0097] Figure 4This paper presents the results of a comparison between the present invention and conventional commercial reagents and the size of the observed library fragments. Detailed Implementation

[0098] This invention discloses enzyme compositions, reagents, kits, and library construction methods for improving the efficiency and sensitivity of plasma DNA library construction. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired results. It is particularly important to note that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. The methods and applications of this invention have been described through preferred embodiments. Those skilled in the art can clearly modify or appropriately change and combine the methods and applications described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.

[0099] The technical solution of this invention can effectively solve problems such as host DNA background noise, adapter dimer residue, and insufficient enrichment of small fragments during plasma DNA library construction, thereby significantly improving the detection sensitivity and accuracy of pathogenic microorganism DNA. This solution not only improves the efficiency of library construction but also simplifies the operation process, reduces the risk of contamination during experiments, and ensures high specificity and high purity of experimental results (e.g., ...). Figure 3 (As shown).

[0100] The beneficial effects of the present invention include, but are not limited to:

[0101] (1) Improving the ligation efficiency of small pathogenic nucleic acid fragments: This invention optimizes the enzyme combination and reaction conditions of the adapter ligation reaction, enabling efficient ligation of small pathogenic nucleic acid fragments (30-100 bp), especially small fragments in low-abundance or high-background samples. In existing technologies, processing these small fragments often suffers from low ligation efficiency and high failure rates, while the technical solution of this invention can significantly improve ligation efficiency and library quality.

[0102] In traditional library preparation, ligation efficiency is typically low when processing pathogen nucleic acid fragments of around 30 bp, especially in low-abundance samples, where the success rate is generally only around 60%. By optimizing the combination of adapter ligases and reaction conditions, this invention can significantly improve the ligation efficiency of small pathogen nucleic acid fragments. Experimental data show that for pathogen nucleic acid fragments of around 30 bp, the ligation rate reached 85%, an improvement of 25% compared to traditional methods.

[0103] (2) Simplified library preparation process: Traditional library preparation methods typically require multiple magnetic bead purification steps to remove adapter dimers, etc. In contrast, this invention effectively removes adapter dimers and unligated adapter fragments by combining PCR activation and enzyme treatment, eliminating the cumbersome magnetic bead purification steps and simplifying the library preparation process. This not only reduces operation time and steps but also lowers potential operational errors in experiments.

[0104] (3) Efficient removal of adapter dimers and reduced background noise: This invention achieves efficient removal of adapter and primer dimers by activating specific T5 exonucleases and EXO-1 enzymes through PCR reaction. In existing technologies, additional purification steps are typically required to remove these dimers, which is both time-consuming and increases experimental complexity. The solution of this invention removes dimers through the specific action of enzymes while avoiding traditional purification steps, ensuring the purity and high quality of the library. This invention significantly reduces background noise and improves the uniformity and scalability of the library.

[0105] Traditional adapter dimer removal procedures often rely on multiple magnetic bead purification processes, typically removing only about 60%–70% of adapter dimers, resulting in high background noise in the library. This study utilizes a specific enzyme-activated PCR reaction to remove adapter dimers. This invention efficiently removes over 90% of adapter dimers, significantly reducing library background noise and substantially improving sequencing quality.

[0106] (4) Library purity and amplification efficiency: In traditional library preparation methods, the purity of the amplified library is usually below 80% due to interference from adapter dimers and unconnected adapter fragments, and the amplification efficiency drops significantly in low-abundance samples, leading to amplification bias. By removing adapter dimers and primer dimers and optimizing library amplification conditions, experiments show that the purity of the library in this invention can reach over 95%, and the amplification efficiency is improved by about 30%. In particular, the uniformity and accuracy of amplification are significantly improved in samples with low-abundance pathogen nucleic acids and high background.

[0107] The enzyme composition, reagents, kits, and library construction methods provided by this invention for improving the efficiency and sensitivity of plasma DNA library construction all use raw materials and reagents that are commercially available.

[0108] R2D ligase is a novel ligase derived from bacteriophage CR9 that can effectively recognize and ligate DNA fragments with atypical or broken ends, making it particularly suitable for processing small fragments from cfDNA. This significantly increases the proportion of these fragments in the library, thereby improving sequencing sensitivity.

[0109] The present invention will be further illustrated below with reference to the embodiments:

[0110] Example 1

[0111] 1. Extraction of cell-free DNA from plasma

[0112] Objective: To obtain plasma cfDNA.

[0113] Cell-free DNA (cfDNA) was extracted from the plasma sample to be analyzed using a magnetic bead method. Nucleic acids were quantified using the Qubit dsDNA HSAssay Kit, and the concentration was diluted to approximately 0.5 ng / µL.

[0114] 2. Terminal repair suspension reaction

[0115] Objective: To repair DNA fragment ends, ensuring their high efficiency in subsequent adapter ligation, and to form sticky ends suitable for adapter ligation through an A-addition reaction.

[0116] (1) Configuration of the end-of-life repair suspension A system

[0117] Take 20 µL of enriched plasma cf DNA into a PCR tube, add 15 µL of nuclease-free water (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: P071-01), 8 µL of end repair buffer (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: ND608-01), 2 µL of DNA damage repair solution (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: ND608-01) and 5 µL of end repair enzyme (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: ND608-01), vortex to mix, and then centrifuge briefly to collect the reaction solution to the bottom of the tube.

[0118] (2) Product reaction system

[0119] Place the PCR tube containing the reaction mixture from the previous step into a PCR instrument and proceed with the reaction according to the following procedure: heat cap 75 ℃; 30 ℃ for 20 min; 65 ℃ for 15 min; maintain at 4 ℃.

[0120] 3 Connector Connection

[0121] Objective: To efficiently bind cfDNA fragments to adapters via paired-end adapters, ensuring that each fragment in the library can be effectively labeled and amplified. At the same time, by introducing a specific mixed enzyme system, the enrichment and ligation efficiency of small pathogen DNA fragments can be effectively improved.

[0122] Key Technology: In traditional adapter ligation processes, the ligation efficiency between the adapter and DNA fragment is typically limited by the size of the DNA fragment, its end structure, and the characteristics of the enzyme. Especially for small nucleic acid fragments, traditional methods often fail to guarantee efficient and specific ligation, leading to the loss of pathogen fragments. This invention, however, employs an innovative hybrid enzyme system of T4 DNA ligase, R2D ligase (derived from bacteriophage CR9), and Polμ DNA polymerase, significantly improving the ligation efficiency of small DNA fragments and ensuring the efficient enrichment of pathogen DNA fragments.

[0123] (1) Preparation of ligase mixture

[0124] Pre-prepared ligase mixture, comprising: T4 DNA ligase (5 U / µL) (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: C301-01): 2 µL; R2D ligase (brand: Arcticzymes Technolo, catalog number: 71900-105) (10 U / µL): 1 µL; Polμ DNA polymerase (brand: Sigma-Aldrich, catalog number: D1806): 0.5~4 µL (2 µL is optimal); 10× T4 ligase buffer: 5 µL; dATP (10 mM): 1 µL; nuclease-free water: bring to 50 µL, and mix thoroughly.

[0125] The enzyme reaction solution was stored at -20°C and removed before each experiment. T4 ligase is a commonly used enzyme for adapter ligation, responsible for connecting adapters to cf DNA fragments. R2D ligase is a novel ligase derived from bacteriophage CR9, capable of effectively recognizing and ligating DNA fragments with atypical or broken ends, particularly suitable for processing small fragments from cf DNA. This significantly increases the proportion of these fragments in the library, thereby improving sequencing sensitivity. Polμ DNA polymerase, a novel enzyme solution, exhibits end-filling and template-independent polymerization, repairing broken DNA ends and promoting the ligation of atypical ends. This enzyme helps repair broken ends of small DNA fragments caused by shearing or other reasons, ensuring successful adapter ligation for each fragment in the library and preventing the loss of small fragments.

[0126] (2) Connecting the reaction system

[0127] The enzyme reaction system consisted of 67.5 µL. Add 50 µL of the product from the end-repair suspension A reaction, 15 µL of the ligase mixture, and 2.5 µL of diluted universal adapter primers (0.25 μM). Mix thoroughly. Place the reaction tube in a PCR instrument and run the following program at 20 °C for 15 min.

[0128] The adapter primer sequence is as follows:

[0129] Applicable to BGI platform:

[0130] MGI_Ad_1:

[0131] 5'P-AGTCGGAGGCCAAGCGGTCTTAGGAAGACAATCAG (as shown in SEQ ID No. 1)

[0132] MGI_Ad_2: TTGTCTTCCTAAGCAACTCCTTGGCTCACAGAACGACATGGCTACGATCCGACTT (as shown in SEQ ID No.2)

[0133] Applicable to the Inmena platform: ILM-Ad-1: ACACTCTTTCCCTACACGACGCTCTTCCGATCT (as shown in SEQ ID No. 3)

[0134] ILM-Ad-2:

[0135] GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (as shown in SEQ ID No. 4)

[0136] 4. PCR reaction activation

[0137] (1) Preparation of PCR activation solution

[0138] Prepare pre-mixed PCR activation buffer. This PCR kinase includes T5 exonuclease and EXO-1 enzyme. To prepare 30 μL of PCR activation buffer, you will need: T5 exonuclease (1 U / µL) (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number 14538ES): 6 µL; EXO-1 enzyme (1 U / µL) (purchased from Yisheng Biotechnology (Shanghai) Co., Ltd., catalog number 14535ES80): 3-9 µL (6 µL is optimal); 10× NEB Buffer 2 (purchased from NEB, catalog number: B7002S): 3 µL; nuclease-free water: bring the total volume to 30 μL. Mix thoroughly. Store the enzyme reaction solution at -20℃, removing it before each experiment.

[0139] The T5 exonuclease possesses exonuclease activity, capable of recognizing and degrading free adapter dimers (especially those with the TT structure), and removing unwanted unligated adapters and other residues. The EXO-1 enzyme is an enzyme that specifically hydrolyzes single-stranded DNA. In library construction, the EXO-1 enzyme removes unligated adapters and free adapter fragments, effectively reducing their interference with sequencing results, especially important in the construction of low-abundance pathogen DNA libraries. 1×NEB Buffer 2 is a T5-specific buffer, providing the necessary ionic environment and pH. The T5 exonuclease requires a specific buffer to effectively remove adapter dimers and other impurities.

[0140] (2) PCR reaction activation reaction system

[0141] The enzyme reaction system consisted of 70.5 µL. 67.5 µL of the ligation reaction product and 3 µL of PCR activation buffer were added as required, and the mixture was thoroughly mixed. The reaction tube was placed in a PCR instrument, and the following program was run: hot cap 105 °C; 37 °C for 5 min; 85 °C for 5 min; hold at 4 °C.

[0142] 5. Library amplification

[0143] Objective: To increase the abundance of target fragments in a library by PCR amplification of pathogen DNA fragments enriched in the library, thereby ensuring sequencing sensitivity.

[0144] The library amplification reaction system was 100.5 µL: Add 5 µL of adapter primer (20 μM) and 25 µL of PCR amplification premix (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: N616-01) to 70.5 µL of the PCR activation reaction product as required. Mix thoroughly, place the reaction tube in the PCR instrument, and run the following program: 105 °C hot cap; 95 °C for 3 min; 98 °C for 20 s → 60 °C for 15 s → 72 °C for 30 s; 14 cycles; 72 °C for 5 min; 4 °C hold.

[0145] Connector primers:

[0146] Applicable to BGI platform:

[0147] MGI_1_xxx: 5'-P-CTCTCAGTACGTCAGCAGTTNNNNNNNNCAACTCCTTGGCTCACAGAAC (as shown in SEQ ID No.5)

[0148] MGI_2_xxx: GCATGGCGACCTTATCAGNNNNNNNNTTGTCTTCCTAAGACCGCTTGG (as shown in SEQ IDNo.6)

[0149] Applicable to the Inmena platform:

[0150] ILM_1_xxx: AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTC (as shown in SEQ ID No.7)

[0151] ILM_2_xxx: CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTGACTGGAGTTCAGACGTGTGC (as shown in SEQ ID No.8)

[0152] Where NNNNNNNN is the index sequence, which is 8 bases in length.

[0153] 6. Library Purification and Quality Control

[0154] Objective: To remove impurities from PCR amplification through purification, ensuring high library purity and suitability for subsequent sequencing.

[0155] (1) Magnetic bead purification

[0156] ① Add 80 µL of magnetic beads (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: N411-02, the same below) to 100 μL of PCR product, vortex to mix, let stand at room temperature for 5 min, place the reaction tube on a magnetic rack, magnetically hold it for 2 min, transfer the supernatant to a new tube, and discard the magnetic beads.

[0157] ② Subsequently, add 20 µL of magnetic beads to the reaction tube, vortex to mix, let stand at room temperature for 5 min, place the reaction tube on a magnetic rack, let stand magnetically for 2 min, discard the supernatant, and keep the magnetic beads.

[0158] ③ Add 200 µL of 80% ethanol to the reaction tube to clean the magnetic beads, incubate at room temperature for 30 s, and remove the supernatant.

[0159] ④ Repeat step ③.

[0160] ⑤ Finally, add 25 µL of nuclease-free water to the reaction tube to wash the magnetic beads, vortex to mix, let stand at room temperature for 5 min, place the reaction tube on a magnetic rack, let stand magnetically for 2 min, and transfer 23 µL of the library to a new centrifuge tube.

[0161] (2) Library Quantitative Analysis and Quality Control

[0162] Library quantification was performed using the Qubit dsDNA HS Assay.

[0163] Example 2: Comparative study of the process of the present invention and the traditional detection process.

[0164] Nucleic acid was extracted from the clinical plasma of 8 patients who tested positive for the pathogen, and the traditional detection procedure 2 (such as...) was used simultaneously. Figure 2 The detection is performed according to the process of the present invention (as shown).

[0165] 1. Detection process of this invention:

[0166] (1) End-stage repair suspension A:

[0167] Take 20 µL of enriched plasma cf DNA, add 15 µL of nuclease-free water, 8 µL of end-repair buffer (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: ND608-01), 2 µL of DNA damage repair solution (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: ND608-01), and 5 µL of end-repair enzyme (purchased from Nanjing Novizan Biotechnology Co., Ltd., catalog number: ND608-01), and mix thoroughly. Place the reaction tube in a PCR instrument and run the reaction program: 30℃, 20 min; 65℃, 15 min; 4℃, hold.

[0168] (2) Connector connection:

[0169] After the reaction is complete, add 15 μL of ligase mixture and 2.5 μL of universal adapter primer to the tube, mix thoroughly, place the reaction tube in the PCR instrument, and run the reaction program: 20 ℃, 15 min.

[0170] (3) PCR reaction activation:

[0171] Add 3 μL of PCR activation solution to the above reaction system and mix thoroughly. Place the reaction tube in a PCR instrument and run the following program: heat cap 105 °C; 37 °C for 5 min; 85 °C for 5 min; hold at 4 °C.

[0172] (4) Library expansion:

[0173] Add 25 μL of PCR amplification premix and 5 μL of adapter primer to the above reaction tube, mix thoroughly, place the reaction tube in the PCR instrument, and run the following program: heat cap 105 ℃; 95 ℃ 3 min; 98 ℃ 20 s → 60 ℃ 15 s → 72 ℃ 30 s; cycle 14 times; 72 ℃ 5 min; hold at 4 ℃.

[0174] (5) Library purification:

[0175] Take 100.5 μL of the reaction product, add 80 μL of magnetic beads, and purify.

[0176] (6) Quantitative analysis of the library:

[0177] Library quantification was performed using the Qubit dsDNA HS Assay reagent, and the concentrations were recorded.

[0178] 2. Routine Testing Procedure

[0179] The VAHTS Universal Pro DNA Library Prep Kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number: NDM608-02) was used as a control reagent, and the library was constructed according to the kit instructions.

[0180] 3. Library concentration and fragment size

[0181] The library concentrations constructed by the two methods are shown in the table below. The library concentrations are comparable and meet the requirements for computer testing.

[0182] Table 1

[0183]

[0184] The file sizes of the libraries built using the two methods are as follows: Figure 4 As shown, it can be seen that the present invention has a better enrichment effect on small pathogen fragments, while conventional commercial kits mainly enrich host free nucleic acids.

[0185] 4. Sequencing

[0186] The constructed library was mixed and prepared with DNB according to the requirements of the BGI MGISEQ-200 sequencing platform, and then sequenced and detected.

[0187] 5. Sequencing Results Analysis

[0188] Data analysis was performed on the sequencing data, and the number of pathogen reads detected by each sample under both methods was statistically analyzed. The results are shown in the table below. Under the same sequencing data volume, the number of pathogen reads detected by this invention was significantly higher than that of the commercial kit, and some indicators that were negative in the commercial kit were positive in the present invention. This indicates that the present invention is significantly superior to existing methods in pathogen detection.

[0189] Table 2

[0190]

[0191]

[0192] Example 3: Study on the dosage of ligase mixture and ligation conditions

[0193] Enzyme dosage optimization

[0194] The dosage of PolμDNA polymerase in the ligase mixture was studied using cfDNA extracted from the plasma of four clinical cases. Five enzyme concentrations were designed: 0.5 μL, 1 μL, 2 μL, 3 μL, and 4 μL. The ligation program was 20 °C for 15 min. Other conditions were determined according to the steps in Example 1 of this invention.

[0195] The library outputs for different amounts of Polμ DNA polymerase are shown in the table below. It can be seen that the library output is relatively stable when the amount of enzyme added is above 2 μL. Considering the stability and cost of the reagents, 2 μL was selected as the final addition volume.

[0196] Table 3

[0197]

[0198] 1. Study on the dosage of ligase mixture

[0199] The dosage of ligase mixture was studied using cfDNA extracted from the plasma of four clinical cases. Five different ligase dosages were designed for the study: 10 μL, 12.5 μL, 15 μL, 17.5 μL, and 20 μL. The ligation program was 20 °C for 15 min. Other conditions were performed according to the steps in Example 1 of this invention.

[0200] The library yields for different ligase additions are shown in the table below. It can be seen that the library yield is relatively stable when the ligase addition is above 12.5 μL. Considering reagent stability and cost, 15 μL was selected as the final addition volume.

[0201] Table 4

[0202]

[0203] 2. Study on connection time and connection temperature

[0204] The ligation time and temperature were investigated using cfDNA extracted from the plasma of four clinical cases. Four groups of different ligation times and five groups of ligation temperatures were designed for the study. Other conditions were tested according to the steps in Example 1 of this invention.

[0205] The ligation time was set to 5 min, 10 min, 15 min, and 20 min, and the ligation temperature was 20℃. The results are shown in the table below. It can be seen that different ligation times have an impact on library production. However, the increase in library concentration after ligation time of 20 min is not significant and is not much different from that of 15 min. Therefore, 15 min is taken as the optimal ligation time.

[0206] Table 5

[0207]

[0208] The connection temperatures were set to 15℃, 18℃, 20℃, 22℃, and 25℃, and the connection time was 20 minutes for the study. The library concentrations are shown in the table below. It can be seen that the concentrations of the library were better when the reaction temperature was between 18-22℃, with 20℃ being the optimal temperature.

[0209] Table 6

[0210]

[0211] Example 4: Alternative Study of PCR Reaction Activation for the Purification of Ligation Product Magnetic Beads

[0212] Four clinical plasma samples were used to extract cfDNA for PCR activation, replacing magnetic beads for purification. The detection method of the VAHTSU Universal Pro DNA Library Prep Kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number: NDM608-02) was used as a control. The ligation products were purified using magnetic beads according to the normal procedure, and a comparative study was designed using different amounts of EXO-1 enzyme (3 μL, 6 μL, and 9 μL). The remaining steps were performed according to the detection steps in Example 1 of this invention. The library concentrations and the proportion of dimers in each library are shown in the table below. It can be seen that when the amount of EXO-1 enzyme in the PCR activation solution is 6 μL, the content of library dimers is comparable to that of the conventional method, and further increasing the amount does not significantly reduce the dimer content. The optimal amount is 6 μL.

[0213] Table 7

[0214]

[0215] Four clinical plasma samples were used to extract cfDNA for PCR purification using a PCR activation solution instead of magnetic beads. The detection method of the VAHTSU Universal Pro DNA Library Prep Kit (Nanjing Novizan Biotechnology Co., Ltd., catalog number: NDM608-02) was used as a control. The ligation products were purified using magnetic beads according to the normal procedure, and a comparative study was designed using different amounts of PCR activation solution. The remaining steps were performed according to the detection steps in Example 1 of this invention. The library concentrations and the proportion of dimers in each library are shown in the table below. It can be seen that when the PCR activation solution volume reaches 3 μL, the library dimer content is comparable to that of the conventional method; further increases in volume do not significantly reduce dimer content. The optimal volume is 3 μL.

[0216] Table 8

[0217]

[0218] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. An enzyme composition, characterized in that, Includes mixed ligases and PCR activators; The mixed ligase includes T4 DNA ligase, R2D ligase and Polμ DNA polymerase; The PCR activating enzymes include T5 exonuclease and EXO-1 enzyme; In the mixed ligase, the enzyme activity ratio of T4 DNA ligase, R2D ligase and Polμ DNA polymerase is 10:10:(0.025~0.2). In the PCR activating enzyme, the activity ratio of T5 exonuclease to EXO-1 enzyme is 6:(3~9).

2. The use of the enzyme composition according to claim 1 in the preparation of reagents or kits for any of the following; (I) Reduce host DNA background noise during plasma DNA library construction; and / or (II) Avoid joint dimer residue; and / or (III) Avoid insufficient enrichment of small fragments; and / or (IV) Improve the sensitivity and / or accuracy of pathogen DNA detection; and / or (V) Improve the efficiency of library construction; and / or (VI) Simplify the workflow for building a library; and / or (VII) Reduce the risk of contamination during the library construction process; and / or (VIII) Improve the specificity and / or purity of pathogen DNA detection.

3. An enzyme combination reagent, characterized in that, Includes the enzyme composition as described in claim 1.

4. The enzyme combination reagent as described in claim 3, characterized in that, Includes ligase mixture and PCR activation solution; The ligase mixture comprises, in 50 µL increments: T4 DNA ligase 5 U / µL 2 µL; R2D ligase 10 U / µL 1 µL; Polμ DNA polymerase 0.05 U / µL 0.5~4 µL; 5 µL of 10× T4 ligase buffer; dATP 10 mM 1 µL; Nuclease-free water was added to bring the total volume to 50 µL. The PCR activation solution comprises, in 30 µL increments: T5 exonuclease 1 U / µL 6µL; EXO-1 enzyme 1 U / µL 3~9 µL; 10× NEB Buffer 2 3 µL; Nuclease-free water was added to a final volume of 30 μL.

5. A reagent kit, characterized in that, Includes the enzyme composition as described in claim 1, or the enzyme combination reagent as described in claim 3 or 4.

6. Any of the following applications in library construction; (I) The enzyme composition as described in claim 1; (II) The enzyme combination reagent as described in claim 3 or 4; or (III) The kit as described in claim 5.

7. A library construction method, characterized in that, Includes the following steps: Step 1: Obtain cell-free DNA from plasma; Step 2: Repair the DNA fragment ends by adding A to form sticky ends, thus obtaining the end repair product; Step 3: Perform ligase ligation using the ligase mixture in the enzyme combination reagent as described in claim 4 to obtain the ligated product; Step 4: Perform PCR activation using the PCR activation solution in the enzyme combination reagent as described in claim 4; obtain the PCR activation product; Step 5: Library amplification; Step 6: Library purification and quality control; This does not include the multi-round magnetic bead purification step after connector connection.

8. The library construction method as described in claim 7, characterized in that, In step 3, the connection reaction system of the connector, calculated at 67.5 µL, includes: 50 µL of the end-repair product obtained in step 2; 15 µL of ligase mixture; The diluted universal adapter primer was 0.25 μM in 2.5 µL.

9. The library construction method as described in claim 8, characterized in that, The nucleotide sequence of the universal adapter primer is as follows: Nucleotide sequences as shown in SEQ ID No. 1 and SEQ ID No. 2; or Nucleotide sequences as shown in SEQ ID No. 3 and SEQ ID No.

4.

10. The library construction method as described in claim 8, characterized in that, The connection temperature of the connector is 20 ℃, and the connection time is 15 min.

11. The library construction method as described in claim 7, characterized in that, In step 4, the PCR reaction activation reaction system, in 70.5 µL increments, comprises: The ligation product obtained in step 3 was 67.5 µL; The PCR activation solution is 3 µL.

12. The library construction method as described in claim 11, characterized in that, The PCR reaction activation procedure includes: hot cap 105 ℃; 37 ℃ 5 min; 85 ℃ 5 min; 4 ℃ hold.

13. The library construction method as described in claim 7, characterized in that, In step 5, the amplification system for library amplification, calculated in 100.5 µL, includes: 70.5 µL of the PCR reaction activation product; Adapter primer 20 μM 5 µL; PCR amplification premix 25 µL.

14. The library construction method as described in claim 13, characterized in that, The library amplification procedure includes: heating at 105 ℃; 95 ℃ for 3 min; 98 ℃ for 20 s → 60 ℃ for 15 s → 72 ℃ for 30 s; repeating 14 times; 72 ℃ for 5 min; and holding at 4 ℃.

15. The library construction method as described in claim 13, characterized in that, The nucleotide sequence of the adapter primer is as follows: Nucleotide sequences as shown in SEQ ID No. 5 and SEQ ID No. 6; or Nucleotide sequences as shown in SEQ ID No. 7 and SEQ ID No. 8.

Images