Method for constructing a random mutant library of methanotrophic bacteria transposon and application thereof
By integrating the Himar1 transposase and dethiobiotin-inducible expression element into methanogenic bacteria, a highly efficient transposon random mutant library was constructed, solving the problem of difficult genetic modification of methanogenic bacteria and achieving efficient construction of mutant libraries and a significant improvement in growth rate.
Patent Information
- Application Number
- CN202511677562.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-17
- Publication Date
- 2026-02-10
- Estimated Expiration
- 2045-11-17
AI Technical Summary
The lack of efficient methods for constructing transposon random mutant libraries for the methanogenic bacterium Methylomicrobium alcaliphilum in the current technology limits its genetic modification and performance improvement.
The Himar1 transposase gene was fused with a dethiobiotin-inducible expression element and integrated into the genome of methanogenic bacteria. A library of random transposon mutants was constructed by electroporation, and codon optimization was used to improve transposase expression and mutation efficiency.
It significantly improved the expression level of transposases in methanogenic bacteria and the efficiency of mutant library construction, efficiently constructing mutant transformants with a value of over 10⁴, and providing large sample materials for breeding screening.
Smart Images

Figure CN121137019B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial genetic engineering technology, and relates to a mutation method for creating random mutant materials in the methanogenic bacterium Methylomicrobiumalcaliphilum and its application. Background Technology
[0002] Methanogenic bacteria are a group of bacteria that grow using methane as their sole carbon source. They have important applications in areas such as methane emission reduction, bioconversion using methane as a raw material, and the production of single-cell protein feed.
[0003] Methylomicrobium alcaliphilum, a methanotroph, is an important model strain of methanotrophs, characterized by rapid growth and strong stress resistance. It is a crucial strain for applications such as methane emission reduction, methane bioconversion, and the production of single-cell protein feed using methane as a raw material. As a core strain in these applications, genetic modification of Methylomicrobium alcaliphilum is a vital approach to further enhance its production performance. However, current genetic manipulation of Methylomicrobium alcaliphilum faces challenges, particularly the lack of efficient methods for constructing random mutant libraries, which significantly limits its genetic modification.
[0004] To address the aforementioned technical challenges, it is necessary to develop an efficient method for constructing and applying a random transposon mutant library for the methane-oxidizing bacterium *Methylomicrobium alcaliphilum*. Summary of the Invention
[0005] The purpose of this invention is to solve the problem of methanogenic bacteria. Methylomicrobium alcaliphilum To address the problem of low efficiency in constructing random mutant libraries of transposons, this invention provides a method for constructing random mutant libraries of methanogenic bacteria and its application, which can significantly improve the expression level of transposases in methanogenic bacteria.
[0006] To address the aforementioned technical problems, the present invention provides the following technical solutions:
[0007] A Himar1 transposase gene, the sequence of which is shown in SEQ ID NO.1.
[0008] This invention also provides the application of the above-mentioned Himar1 transposase gene in constructing a library of random mutant transposons of methanogenic bacteria.
[0009] A method for constructing a random mutant library of transposons from methanogenic bacteria includes the following steps: fusing the Himar1 transposase gene with a desulfobiotin-inducible expression element and integrating it into the genome of methanogenic bacteria; adding desulfobiotin to the culture medium to obtain a strain that induced the expression of Himar1 transposase; preparing the strain into electrotransformation competent cells; mixing the transposon DNA with the electrotransformation competent cells for electrotransformation; and reviving the electrotransformed competent cells to obtain mutant transformants; the sequence of the desulfobiotin-inducible expression element is shown in SEQ ID NO.2.
[0010] Furthermore, the method for preparing the transposon DNA includes: adding the Himar1 transposase universal recognition sequence to both ends of the codon-optimized gentamicin resistance gene using primers, and constructing the transposon DNA by PCR amplification; the sequence of the codon-optimized gentamicin resistance gene is shown in SEQ ID NO.3.
[0011] Furthermore, the conditions for electroconversion are 25 μF, 200 Ω, and 2.5 kV.
[0012] Furthermore, the inducing concentration of desulfurized biotin is 15 ng / mL or higher.
[0013] The present invention also provides the application of the above-mentioned Himar1 transposase gene or the above-mentioned method for constructing a random mutant library of methanogenic bacteria transposons in the production of single-cell protein feed.
[0014] The present invention also provides the application of the above-mentioned Himar1 transposase gene or the above-mentioned method for constructing a random mutant library of methanogenic bacteria transposons in improving the growth rate of methanogenic bacteria.
[0015] Beneficial effects
[0016] This invention belongs to the field of microbial genetic engineering technology, and discloses a method for constructing a random mutant library of methanogenic bacteria transposons and its application. Using a codon-optimized Himar1 transposase, the expression level of the transposase in methanogenic bacteria is significantly increased, and further, a random mutant library can be efficiently constructed in methanogenic bacteria. A single transformation can construct 10... 4 The mutant transformants mentioned above are 127.3 times more efficient than existing triparental conjugation technology, providing a large sample of material for their breeding and screening. Attached Figure Description
[0017] Figure 1 Overall technical route for constructing a transposon mutant library of the methanogenic bacterium Methylomicrobium alcaliphilum;
[0018] Figure 2 To optimize the expression of Himar1 transposase by integrating codons; among which Figure 2 In Figure A, the expression of the original Himar1 gene and the codon-optimized gene in Methylomicrobium alcaliphilum 20Z is shown. Figure 2 Figure B shows the expression of the dethiobiotin-induced Himar1 transposase expression system.
[0019] Figure 3 Efficiency testing of transposon mutant library construction for Methylomicrobium alcaliphilum 20Z; among which, Figure 3 A in the diagram compares the growth plates of mutants constructed using the traditional triparental conjugation method with those constructed using the present invention. Figure 3 B represents a quantitative determination of the efficiency of mutant construction using the traditional triparental conjugation method and the mutant construction efficiency of this invention.
[0020] Figure 4 The results are from growth tests of mutant strains with significantly enhanced growth rates selected from the transposon mutant library. Detailed Implementation
[0021] The advantages and effects of the present invention will be explained below with reference to specific embodiments.
[0022] like Figure 1 As shown, the core technical idea of this invention is to pre-integrate an induced transposase into the genome of the methanogenic bacterium Methylomicrobium alcaliphilum, and then electroporate the transposon DNA constructed in vitro into the cell. The expressed transposase randomly inserts the transposon DNA into the genome of the cell, thereby causing the inactivation of the gene corresponding to the insertion site. The corresponding transformant is the mutant.
[0023] Example 1
[0024] In this embodiment, the type strain 20Z of the methanotrophic bacterium *Methylomicrobium alcaliphilum* was selected. Its source is referenced in the Journal of Bacteriology 2012, https: / / doi.org / 10.1128 / jb.06392-11. This strain has the accession number VKM B-2133 at the Russian Microbial Culture Collection Center and the accession number NCIMB 14124 at the British Food Industry and Marine Bacteria Culture Collection Center.
[0025] The Himar1 transposase gene in the pSC123 plasmid was manually optimized according to the codon usage preferences of methanogenic bacteria genes. The optimized sequence is shown in SEQ ID NO.1. Figure 2 As shown in Figure A, the original Himar1 gene (sequence SEQ ID NO.7) and the codon-optimized Himar1 gene in the pSC123 plasmid were constitutively expressed in Methylomicrobium alcaliphilum 20Z under the control of the Ptac promoter. The results showed that the expression of the original Himar1 gene was low, while the expression of the codon-optimized Himar1 gene was significantly increased, which can significantly improve the transposition efficiency. Figure 2 (As indicated by the arrow in A).
[0026] Furthermore, the induced Himar1 transposase (codon-optimized gene, sequence shown in SEQ ID NO.1) was integrated into the genome of the methanogenic bacterium Methylomicrobium alcaliphilum 20Z.
[0027] A neutral integration site was selected from the genome of Methylomicrobium alcaliphilum 20Z strain. In this example, the site was selected 300 bases before the start codon of the pcm gene.
[0028] Genomic site-directed integration into the strain *Methylomicrobium alcaliphilum* 20Z was performed according to the method described in the literature (Appl Environ Microbiol 2016, https: / / doi.org / 10.1128 / AEM.03724-15). The first 500 bp and last 500 bp sequences of the selected neutral integration site were amplified by PCR and used as homologous arm sequences for homologous recombination. The dethiobiotin-inducible expression element (SEQ ID NO.2) was obtained through gene synthesis and contains the tetR gene and P... tetAThe promoter-codon-optimized Himar1 transposase gene (sequence SEQ ID NO.1) was also obtained through gene synthesis. The kanamycin resistance gene with a promoter (sequence shown in SEQ ID NO.6) was obtained by PCR amplification using plasmid pAWP89 as a template. The left homologous arm, dethiobiotin-inducible expression element, codon-optimized Himar1 transposase, promoter-inducible kanamycin resistance gene, and right homologous arm were sequentially ligated using overlap extension PCR to form a linear fragment for integrating the "dethiobiotin-induced Himar1 transposase expression system" into the genome. The ligated fragment was electroporated into competent cells of strain Methylomicrobium alcaliphilum 20Z. After recovery, the cells were plated on kanamycin resistance plates for screening to obtain the target strain with the "dethiobiotin-induced Himar1 transposase expression system" integrated into the genome.
[0029] The expression system of the dethiobiotin-induced Himar1 transposase in the strain was tested and analyzed, such as... Figure 2 As shown in Figure B, the obtained strain can express Himar1 transposase in large quantities under the induction of dethiobiotin, and the appropriate induction concentration of dethiobiotin is 15 ng / mL or higher.
[0030] Example 2
[0031] In vitro construction of transposon DNA
[0032] The Himar1 transposase universal recognition sequences 5'-TAACAGGTTGGCTGATAAGTCCCCGGTCTGACA-3' (SEQ ID NO.4) and 5'-TGTTAGACCGGGGACTTATCAGCCAACCTGTTA-3' (SEQ ID NO.5) were added to both ends of the codon-optimized gentamicin resistance gene (SEQ ID NO.3) using primers, thereby constructing in vitro transposon DNA (double strand) through PCR amplification.
[0033] This double-stranded transposon DNA can be amplified in large quantities by PCR, and after being purified by gel electrophoresis and gel extraction, it can be used for subsequent electroporation.
[0034] Example 3
[0035] Efficiency testing of transposon mutant library construction and application of typical mutants
[0036] The *Methylomicrobium alcaliphilum* 20Z strain obtained in Example 1, which integrates the codon-optimized Himar1 transposase, was used to induce Himar1 transposase expression by adding 15 ng / mL dethiobiotin to the culture medium, following the method described in the literature (Appl Environ Microbiol 2016, https: / / doi.org / 10.1128 / AEM.03724-15). The resulting bacterial cells were collected, washed multiple times with pre-cooled sterile water, and then prepared as electrotransformation competent cells at a concentration of 1.3 × 10⁻⁶ cells / mL. 11 CFU / L.
[0037] The transposon DNA constructed by in vitro PCR was mixed with the above-mentioned electroporation competent cells and then electroporated using an electroporator under the following conditions: 25 μF, 200 Ω, and 2.5 kV.
[0038] After electroporation, the cells were revived for 6 hours and then plated on agar plates containing gentamicin. The colonies that grew were the mutant transformants. Figure 3 As shown in Figure A, compared with the traditional triparental conjugation system, the mutation system in this invention can significantly obtain more mutant transformants; as Figure 3 As shown in Figure B, statistics indicate that the efficiency of constructing a Methylomicrobium alcaliphilum 20Z mutant library using the general triparental conjugation method is only 1.87 × 10⁻⁶. 2 The average efficiency of constructing mutants using the mutation system of this invention is 2.38 × 10⁻⁶ CFU / μg DNA. 4 CFU / μg DNA. That is, the system of this invention is 127.3 times more efficient than the traditional method.
[0039] The mutant library obtained using this mutation system was screened for growth. Transformants that grew preferentially were selected from the plates, resulting in two mutant strains with significantly enhanced growth rates: 20Z-MT29 and 20Z-MT113. Growth tests were then performed simultaneously on the wild-type strain 20Z and the two mutant strains. Figure 4 As shown in the figures, tests revealed that the obtained mutant strains 20Z-MT29 and 20Z-MT113 grew significantly faster than the original wild-type strain, while their growth rates were comparable. The data from this embodiment demonstrate that the present invention can provide a novel genetically modified strain for single-cell protein fermentation production of the methanogenic bacterium *Methylomicrobium alcaliphilum*, thereby further improving the fermentation performance of the strain.
[0040] SEQ ID NO.1 (Codon-optimized Himar1 transposase gene sequence)
[0041]
[0042] SEQ ID NO.2 (DNA sequence of desthiobiotin induction element)
[0043] TTAAGAGCCGGACTCACACTTCAGCTGTTTCTCCAGGCCACAGATAATCAGTTCCAGGCCAAACAGAAATGCCGGTTCTGCACCCTGATGGTCGAACAGTTCAATAGCCTGACGCAGCAGAGGCGGCATAGAGTCGGTAGTCGGGGTTTCGCGCTCTTCCTTAGCAACCTGGTGCTCCTGGTCTTCCAGGACGCAACCCAGGGTGAAGTGGCCCACAGCGCTCAGAGCATACAGGGCGTTTTCCAGGCTAAAACCCTGCTGGCACAGGAAGGCCAGTTGGTTTTCCAGGGTTTCGTACTGCTTTTCAGTCGGACGGGTGCCCAGGTGAACTTTCGCGCCGTCACGGTGGGACAGCAGTGCACAACGGAAGCTTTTGGCGTTGTTACGCAGGAAATCCTGCCAAGATTCACCTTCCAGCGGGCAGAAGTGGGTGTGATGACGATCCAGCATCTCGATAGCCAGAGCGTCCAGCAGCGCGCGCTTGTTTTTAACGTGCCAGTACAGGGTCGGCTGTTCGACACCCAGTTTCTGCGCCAGTTTACGCGTGGTCAGGCCTTCGATACCAACCTCGTTCAGCAGTTCCAGAGCGCTATTGATAACTTTGCTTTTATCCAGACGGGACATCATTAATTCCTAATTTTTGTTGACACTCTATCGTTGATAGAGTTATTTTACCACTCCCTATCAGTGATAGAGAAAAGAATTCGTCGACAAAGAGGAGAAAGATATC。
[0044] SEQ ID NO.3 (Sequence of the codon-optimized gentamicin resistance gene)
[0045] ATGCTGCGCTCTTCTAATGACGTCACCCAGCAGGGCTCCCGTCCGAAAACGAAGCTGGGTGGTAGCAGCATGGGCATCATCCGCACTTGTCGTCTGGGCCCGGATCAGGTAAAATCCATGCGCGCAGCTCTGGACCTGTTCGGCCGTGAATTCGGTGATGTCGCAACTTACAGCCAGCATCAGCCGGACTCTGACTACCTGGGCAACCTGCTGCGTAGCAAGACCTTCATCGCGCTGGCTGCTTTCGATCAGGAAGCTGTGGTAGGTGCCCTGGCTGCTTACGTTCTGCCGCGTTTCGAGCAGCCACGTTCCGAGATCTACATCTACGATCTGGCAGTTTCTGGTGAACACCGTCGTCAAGGCATCGCGACTGCTCTGATTAACCTGCTGAAACACGAGGCCAACGCTCTGGGTGCGTACGTGATCTACGTACAGGCTGACTACGGTGACGATCCAGCTGTAGCCCTGTACACCAAACTGGGTATCCGCGAAGAAGTTATGCACTTCGATATCGACCCATCTACGGCCACCTAA。
[0046] SEQ ID NO.4 (Himar1 transposase general recognition sequence 1)
[0047] TAACAGGTTGGCTGATAAGTCCCCGGTCTGACA。
[0048] SEQ ID NO.5 (Himar1 transposase general recognition sequence 2) [[ID=ID=10]]
[0049] TGTTAGACCGGGGACTTATCAGCCAACCTGTTA。
[0050] SEQ ID NO.6 (kanamycin resistance gene with promoter) [[ID=ID=17]]
[0051] CGCGTATAGCTTGCCGGAAGTCGAAAGCCACGTTGTGTCTCAAAATCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAA。
[0052] The sequence is as shown in SEQ ID NO.7 (original Himar1 gene).
[0053]
Claims
1. A Himar1 transposase gene, characterized in that, The sequence of the Himar1 transposase gene is shown in SEQ ID NO.
1.
2. The application of the Himar1 transposase gene as described in claim 1 in constructing a random mutant library of methanogenic bacteria transposons.
3. A method for constructing a random mutant library of methanogenic bacteria transposons, characterized in that, The method includes the following steps: fusing the Himar1 transposase gene of claim 1 with a desulfobiotin-inducible expression element and integrating it into the genome of a methanogenic bacterium; adding desulfobiotin to the culture medium to obtain a strain that induced the expression of Himar1 transposase; preparing the strain into electrotransformation competent cells; mixing the transposon DNA with the electrotransformation competent cells for electrotransformation; and culturing the electrotransformed competent cells after resuscitation to obtain mutant transformants; the sequence of the desulfobiotin-inducible expression element is shown in SEQ ID NO.
2.
4. The method for constructing a random mutant library of methanogenic bacteria transposons according to claim 3, characterized in that, The method for preparing the transposon DNA includes: adding the Himar1 transposase universal recognition sequence to both ends of the codon-optimized gentamicin resistance gene using primers, and constructing the transposon DNA by PCR amplification; the sequence of the codon-optimized gentamicin resistance gene is shown in SEQ ID NO.
3.
5. The method for constructing a random mutant library of methanogenic bacteria transposons according to claim 3, characterized in that, The conditions for electroconversion are 25μF, 200Ω, and 2.5 kV.
6. The method for constructing a random mutant library of methanogenic bacteria transposons according to claim 3, characterized in that, The inducible concentration of desulfurized biotin is 15 ng / mL or higher.
Citation Information
Patent Citations
Construction of continuous random transposition integration system for prokaryotic bacterium genome
CN118291495A
Application of pore protein PorA in improving ammonia nitrogen utilization capacity of methane-oxidizing bacteria
CN119306809A