A molecular marker related to the content of oat neutral detergent fiber, a primer combination and application thereof

Abstract

The present application relates to the breeding technology field of oat, and discloses a molecular marker, primer combination and application related to the neutral detergent fiber content of oat, wherein the molecular marker is a PAV marker, the PAV molecular marker is located on the 5D chromosome of the oat reference genome, the physical position is 5D:424169687, and 161 bp is deleted; the accession number of the national genome database of the oat reference genome is GWHGDJH00000000.1. The molecular marker, primer combination and application related to the neutral detergent fiber content of oat are used, the molecular marker and the detection method are used, the detection can be performed on the oat seedling stage, the breeding cycle is significantly shortened, the breeding efficiency is improved, and the breeding cost is reduced, meanwhile, the PCR primer combination designed based on the molecular marker has high specificity and high accuracy, can be used for the prediction and screening of the neutral detergent fiber content of the forage oat, and is used for the genetic breeding of the oat.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of oat breeding, and in particular to a molecular marker related to the neutral detergent fiber content of oats, a primer combination and application thereof. BACKGROUND

[0002] Neutral detergent fiber (NDF) is one of the core indicators for evaluating the nutritional value of feed, mainly composed of cellulose, hemicellulose and lignin, and its content directly affects the intake and digestibility of herbivorous animals - oat feed with low NDF content can improve the digestion efficiency and production performance of animals, so cultivating high-quality forage oat varieties with low NDF content has important agricultural economic value.

[0003] At present, the breeding selection of oat NDF content mainly relies on traditional phenotype determination: samples are collected after the plant matures, the NDF content is determined by Van Soest method, and then single plant selection is carried out according to the determination results. This method has the following significant defects: 1. Long cycle, waiting for the plant to mature (usually 3-4 months); 2. High cost, a large amount of chemical reagents and manpower are consumed in the determination process; 3. The accuracy is significantly affected by the environment (such as soil fertility, precipitation), and the NDF content of the same variety in different regions can vary by 5%-8%, resulting in low selection efficiency.

[0004] Molecular marker technology provides the possibility for early selection of crop traits, but there are obvious deficiencies in the current research on molecular markers for oat NDF content: existing researches mainly focus on simple sequence repeat (SSR) or single nucleotide polymorphism (SNP) markers, but their correlation with NDF content is weak (the phenotypic contribution rate is usually <5%), and the stability is poor (the consistency of detection results in different years or places is <60%); at the same time, the NDF-related markers found in other crops (such as corn, alfalfa) cannot be directly applied to oats due to differences in genetic background. Therefore, the existing technology cannot meet the needs of efficient breeding of oat low-NDF varieties. SUMMARY

[0005] In order to solve the problems of long cycle, high cost and low accuracy caused by the dependence on traditional phenotype determination in the breeding of oat NDF content in the prior art, and the lack of stable and effective correlation molecular markers, the present application provides a 161bp PAV (presence-absence variation) molecular marker significantly correlated with oat NDF content, as well as a primer combination, a detection method and applications thereof based on the marker, so as to realize early, rapid and accurate screening of oat NDF content and improve the breeding efficiency of low-NDF oat varieties.

[0006] The present application aims to provide a molecular marker related to the neutral detergent fiber content of oats, a primer combination and application thereof, in order to solve the above technical problems.

[0007] To achieve the above object, the application provides a molecular marker related to the content of oat neutral detergent fiber, which is a PAV marker, and the PAV molecular marker is located on the 5D chromosome of the oat reference genome, at a physical position of 5D:424169687, with a deletion of 161 bp, and the deletion sequence is: CTCACTCC GAACCTACACACTGCATCACGGTTGATTATCTAAGGCACACAAAAGTGCCTTAGAAAATAACAATAGTGCCTTAAAAAATCTTTGAAGGCAATTAAAAAAATGCCGAATCAAATAGGGTAGGGAAAAATCGTTTAAGGCACTTTATAAAACTG.

[0008] The oat reference genome has a national genome database accession number of GWHGDJH00000000.1.

[0009] Further, the deletion sequence is of the REF type, and the nucleotide sequence is as follows:

[0010] REF: ATTTTTTGTGTGTACTCCTGTTTCAAAATATAAGATGTTTTAGA TTTGTGAACGTAGCGTATCTAGACACCTATTAGTGTGTAGATTCGGAGTGAACCTCAAAAAATATATCTTTCGAGGCACTTTTAAAATTGCCTTAAAAGATCTACCTTTTGAGGCATTTTAAAAATTGCCTTGTACTAATTTAAGGCACTAT.

[0011] The non-deletion sequence is of the ALT type, and the nucleotide sequence is as follows:

[0012] ALT: ATTTTTTGTGTGTACTCCTGTTTCAAAATATAAGATGTTTTAGA TTTGTGAACGTAGCGTATCTAGACACCTATTAGTGTGTAGATTCGGAGTGAAC CTCACTCCGAACCTACACACTGCATCACGGTTGATTATCTAA GGCACACAAAAGTGCCTTAGAAAATAACAATAGTGCCTTAAAAAATCTTTGAAGGCAATTAAAAAAATGCCGAATC AAATAGGGTAGGGAAAAATCGTTTAAGGCACTTTATAAAACTG CTCAAAAAATATATCTTTCGAGGCACTTTTAAAATTGCCTTAAAAGATCTACCTTTTGAGGCATTTTAAAAATTGCCTTGTACTAATTTAAGGCACTAT.

[0013] To achieve the above object, the application further provides application of the molecular marker in identifying neutral detergent fiber content of oat.

[0014] To achieve the above object, the application further provides a primer combination for identifying neutral detergent fiber content of oat, which is used for amplifying the above molecular marker.

[0015] Further, the primer combination comprises sequences shown in SEQ ID NO. 4-5.

[0016] To achieve the above object, the application further provides application of the primer combination in preparing a kit for identifying neutral detergent fiber content of oat.

[0017] To achieve the above object, the application further provides a kit for identifying neutral detergent fiber content of oat, comprising the primer combination.

[0018] To achieve the above object, the application further provides application of the primer combination or the kit in genetic breeding of oat.

[0019] To achieve the above object, the application further provides a method for identifying neutral detergent fiber content of oat, comprising the following steps:

[0020] Step 1, extracting genomic DNA of a sample to be tested;

[0021] Step 2, performing PCR amplification on the genomic DNA by using the primer combination;

[0022] Step 3, performing sequencing on the amplification product, and judging the genotype.

[0023] Further,

[0024] ① When the genotype is "- / -", it is the REF type, and the neutral detergent fiber content of oat is 51.88-54.47%, with an average of 53.68%;

[0025] ② When the genotype is "161bp / -", it is the ALT type, and the neutral detergent fiber content of oat is 55.03-58.15%, with an average of 56.41%.

[0026] The molecular marker, primer combination and application related to neutral detergent fiber content of oat have the following advantages and positive effects:

[0027] 1. The application provides a PAV molecular marker significantly related to neutral detergent fiber content of forage oat, which can be used for prediction and screening of neutral detergent fiber content of forage oat, and for genetic breeding of oat.

[0028] 2、The PCR primer combination designed based on the molecular marker in the application has high specificity, can directly distinguish different genotypes through electrophoresis, and the detection process is rapid and efficient, and a single reaction can be completed within 2 hours, which is suitable for large-scale and high-throughput screening of breeding materials.

[0029] 3、The molecular marker and the detection method of the application can be used for detection at the oat seedling stage, without waiting for the plant to mature, which can significantly shorten the breeding period, improve the breeding efficiency, and reduce the breeding cost.

[0030] 4、The detection result of the molecular marker in the application is not affected by environmental factors, has high accuracy, and effectively improves the accuracy of high neutral detergent fiber oat variety breeding.

[0031] The technical solutions of the application will be further described in detail below with reference to the drawings and examples. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 The GWAS results in the embodiments of the application are as follows:

[0033] Figure 2 The neutral detergent fiber content comparison between different genotypes in the embodiments of the application is as follows:

[0034] Figure 3 The electrophoresis results (part) of the PAV marker genotyping in the embodiments of the application are as follows: the ALT type is 346bp, and the REF type is 185bp. DETAILED DESCRIPTION

[0035] The technical solutions of the application will be further described in detail below with reference to the drawings and examples.

[0036] Unless otherwise defined, the technical terms or scientific terms used in the application shall have the usual meanings understood by those skilled in the art to which the application belongs.

[0037] EMBODIMENT

[0038] 1、Obtaining of the PAV molecular marker:

[0039] Test material: 1078 oat germplasm resources (including local varieties, bred varieties and core germplasm) collected worldwide, with rich neutral detergent fiber (NDF) content variation (range: 35.2%-62.8%).

[0040] Planting and Phenotypic Determination: Oat germplasm resources were planted in experimental fields in Guyuan, Ningxia and Zhangjiakou, Hebei, using a randomized block design (3 replicates). Aboveground samples were collected at the milk stage, dried, and pulverized. NDF content was determined using the Van der Waals method (GB / T20806-2006). Each sample was replicated 3 times, and the average value was taken as the phenotypic value.

[0041] DNA extraction and sequencing: Young leaves of various oat materials were collected, and genomic DNA was extracted using the CTAB method. After quality testing (OD260 / 280 between 1.8 and 2.0), whole-genome resequencing was performed using the Illumina NovaSeq platform to obtain raw sequencing data with an average sequencing depth of 10×.

[0042] Structural variant identification and graphical pan-genome construction: Using 17 representative high-quality hexaploid oat genomes assembled from samples, precise whole-genome identification of insertion / deletion variants (PAVs) was achieved. The identified PAVs from the 17 representative high-quality hexaploid oat genomes were merged using SURVIVOR software to obtain a set of non-redundant PAVs. The reference genome was cultivated oat Marvell ous (genome data released to the National Genome Database, accession number GWHGDJH00000000.1). A graphical pan-genome of oats, PanPAV, was constructed using vg software.

[0043] Quality control was performed on 1078 raw oat sequencing reads to filter out low-quality reads and adapter sequences. The filtered sequencing data were then aligned to PanPAVs using "vg giraffe," and PAVs within the PanPAV population were genotyped using "vg call." Finally, Bcftools and VCFtools software were used to merge and filter the VCF files of each individual in the population, with parameters including a deletion rate of less than or equal to 20%, a minimum allele frequency of greater than or equal to 0.05, and a site coverage depth of greater than or equal to 2, resulting in a set of 47,110 non-redundant PAVs.

[0044] PAV association analysis: Using population PAV information and measured NDF content phenotypic values, genome-wide association analysis (GWAS) was performed using the GLM model in TASSEL 5.0 software. Population structure was corrected (with the first three principal components as covariates), and a PAV molecular marker significantly associated with oat neutral detergent fiber content was finally identified. Figure 1 (As shown).

[0045] The PAV molecular marker is located on the 5D chromosome of the oat reference genome (National Genome Database Accession Number: GWHGDJH00000000.1), at a physical location of 5D:424169687, with a deletion of 161 bp, and the deletion sequence is: CTCACTCCGAACCTACACACTGCATCACGGTTGATTATCTAAGGCACACAAAAGTGCCTTAGAAAATAACAATAGTGCCTTAAAAAATCTTTGAAGGCAATTAAAAAAATGCCGAATCAAATAGGGTAGGGAAAAATCGTTTAAGGCACTTTATAAAACTG (SEQ ID NO. 1).

[0046] The REF type is a deletion of 161 bp, and the sequence is as follows:

[0047] REF: ATTTTTTGTGTGTACTCCTGTTTCAAAATATAAGATGTTTTAGATTGTGAACGTAGCGTATCTAGACACCTATTAGTGTGTAGATTCGGAGTGAACCTCAAAAAATATATCTTTCGAGGCACTTTTAAAATTGCCTTAAAAGATCTACCTTTTGAGGCATTTTAAAAATTGCCTTGTACTAATTTAAGGCACTAT (SEQ ID NO. 2).

[0048] The ALT type contains 161 bp, and the sequence is as follows:

[0049] ALT: ATTTTTTGTGTGTACTCCTGTTTCAAAATATAAGATGTTTTAGATTGTGAACGTAGCGTATCTAGACACCTATTAGTGTGTAGATTCGGAGTGAAC CTCACTCCGAACCTACACACTGCATCACGGTTGATTATCTAA GGCACACAAAAGTGCCTTAGAAAATAACAATAGTGCCTTAAAAAATCTTTGAAGGCAATTAAAAAAATGCCGAATC AAATAGGGTAGGGAAAAATCGTTTAAGGCACTTTATAAAACTG CTCAAAAAATATATCTTTCGAGGCACTTTTAAAATTGCCTTAAAAGATCTACCTTTTGAGGCATTTTAAAAATTGCCTTGTACTAATTTAAGGCACTAT (SEQ ID NO. 3).

[0050] 2. Primer combination design:

[0051] For the above-mentioned PAV molecular marker, the PCR primer combination is designed by using Primer 5 software, and the specific sequence is as follows:

[0052] Specific upstream primer F: TTTGTGTGTACTCCTGTTTCAA (SEQ ID NO.4);

[0053] Specific downstream primer R: GCCTTAAATTAGTACAAGGCAAT (SEQ ID NO.5).

[0054] 3. PAV molecular markers are used to identify the content of neutral detergent fiber in oats:

[0055] Genomic DNA was extracted from the 223 oat samples used as feed. Using the extracted DNA as a template, PCR amplification was performed using the primer combination described above. The PCR reaction system (10 μL) consisted of: 5 μL of 2×Es Taq MasterMix DNA polymerase (containing Taq DNA polymerase, dNTPs, reaction buffer, etc., accounting for 50% of the total system volume), 0.2 μL each of 10 μM specific upstream primer F and specific downstream primer R, 1 μL of genomic DNA (20 ng / μL), and 3.8 μL of ultrapure water.

[0056] Amplification program: 94℃ pre-denaturation for 15 min; 94℃ denaturation for 20 s, 58℃ annealing and extension for 10 s (30 cycles); storage at 4℃. Electrophoresis analysis showed that amplified fibers of 346 bp were ALT type with an average neutral detergent fiber content of 56.41%, and amplified fibers of 185 bp were REF type with an average neutral detergent fiber content of 53.68% (average neutral detergent fiber content is shown in the figure). Figure 2 As shown, some electrophoretic typing results Figure 3 (As shown).

[0057] The genotyping results and neutral detergent fiber content results of 225 samples are shown in Table 1:

[0058] Table 1. Classification results and neutral detergent fiber content

[0059]

[0060]

[0061] Therefore, this invention employs the aforementioned molecular marker, primer combination, and application related to the neutral detergent fiber content of oats. Using the molecular marker and detection method of this invention, detection can be performed during the oat seedling stage, significantly shortening the breeding cycle, improving breeding efficiency, and reducing breeding costs. At the same time, the PCR primer combination designed based on this molecular marker has high specificity and accuracy, and can be used for the prediction and screening of neutral detergent fiber content in feed oats, and for the genetic breeding of oats.

[0062] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and not to limit them. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can still be made to the technical solutions of the present invention, and these modifications or equivalent substitutions cannot cause the modified technical solutions to deviate from the spirit and scope of the technical solutions of the present invention.

Claims

1. A molecular marker associated with the neutral detergent fiber content of oats, characterized in that: The molecular marker is an insertion / deletion PAV marker, located on chromosome 5D of the oat reference genome at position 5D:424169687, with a deletion of 161 bp. The deleted nucleotide sequence is: CTCACTCC GAACCTACACACTGCATCACGGTTGATTATCTAAGGCACACAAAAGTGCCTTAGAAAATAACAATAGTGCCTTAAAAAATCTTTGAAGGCAATTAAAAAAATGCCGAATCAAATAGGGTAGGGAAAAATCGTTTAAGGCACTTTATAAAACTG; the national genome database accession number for the oat reference genome is GWHGDJH00000000.

1.

2. The molecular marker related to the neutral detergent fiber content of oats according to claim 1, characterized in that: The oat nucleotide sequence is as follows: Oat is REF type with a 161bp deletion: REF:ATTTTTTGTGTGTACTCCTGTTTCAAAATATAAGATGTTTTAGA TTTGTGAACGTAGCGTATCTAGACACCTATTAGTGTGTAGATTCGGAGTGAACCTCAAAAAATATATCTTTCGAGGCACTTTTAAAATTGCCTTAAAAGATCTACCTTTTGAGGCATTTTAAAAATTGCCTTGTACTAATTTAAGGCACTAT; The oat nucleotide sequence does not contain a 161bp deletion; it is an ALT-type oat. The nucleotide sequence is as follows: ALT:ATTTTTTGTGTGTACTCCTGTTTCAAAATATAAGATGTTTTAGATTTGTGAACGTAGCGTATCTAGACACCTATTAGTGTGTAGATTCGGAGTGAACCTCACTCCGAACCTACACACTGCATCACGGTTGATTATCTAAGGCACACAAAAGTGCCTTAGAAAATAACAATAGTGCCT TAAAAAATCTTTGAAGGCAATTAAAAAAATGCCGAATCAAATAGGGTAGGGAAAAATCGTTTAAGGCACTTTATAAAACTGCTCAAAAAATATATCTTTCGAGGCACTTTTAAAATTGCCTTAAAAGATCTACCTTTTGAGGCATTTTAAAAATTGCCTTGTACTAATTTAAGGCACTAT.

3. The application of the reagent for detecting the molecular marker as described in claim 1 or 2 in identifying the neutral detergent fiber content of oats, characterized in that: Oats lacking 161bp are classified as REF type, and the neutral detergent fiber content of oats is 51.88-54.47%. Oatmeal without the missing 161bp is of the ALT type, and the neutral detergent fiber content of oatmeal is 55.03-58.15%.

4. A primer combination for identifying the neutral detergent fiber content of oats, characterized in that: The primer combination is used to amplify the molecular marker according to claim 1 or 2; the primer combination sequence is shown in SEQ ID NO. 4-5.

5. The application of the primer combination according to claim 4 in the preparation of a kit for identifying the content of neutral detergent fiber in oats, characterized in that: The primer combination is used to amplify the molecular marker described in claim 1 or 2 and to identify the content of neutral detergent fiber in oats; oats with a deletion of 161bp are classified as REF type, and the content of neutral detergent fiber in oats is 51.88-54.47%; oats without a deletion of 161bp are classified as ALT type, and the content of neutral detergent fiber in oats is 55.03-58.15%.

6. A kit for identifying the neutral detergent fiber content of oats, characterized in that: It includes the primer combination as described in claim 4.

7. The application of the primer combination of claim 4 or the kit of claim 6 in genetic breeding related to the neutral detergent fiber content of oats, characterized in that: The primer combination described in claim 4 or the kit described in claim 6 are used to predict and screen the neutral detergent fiber content of feed oats for the genetic breeding of oats. The primer combination described in claim 4 was used to amplify the molecular marker described in claim 1 or 2 to identify the content of neutral detergent fiber in oats; oats lacking 161bp were classified as REF type, with a neutral detergent fiber content of 51.88-54.47%; oats without 161bp were classified as ALT type, with a neutral detergent fiber content of 55.03-58.15%.

8. A method for determining the neutral detergent fiber content of oats, characterized in that, Includes the following steps: Step 1: Extract genomic DNA from the sample to be tested; Step 2: Perform PCR amplification of genomic DNA using the primer combination described in claim 4; Step 3: Sequencing the amplification products to determine the genotype of the molecular marker described in claim 1 or claim 2 in the sample to be tested; ① When the genotype is "- / -", a deletion of 161bp occurs, resulting in the REF type, and the neutral detergent fiber content of oats is 51.88-54.47%; ② When the genotype is "161bp / -", there is no deletion of 161bp, it is the ALT type, and the neutral detergent fiber content of oats is 55.03-58.15%.

Images