KASP markers related to the thousand kernel weight trait of brassica napus and application thereof

Abstract

The application discloses a SNP site related to the thousand kernel weight trait of Brassica napus and a KASP marker primer set thereof, belongs to the field of genetic engineering, and the SNP marker is located at the position of 3967014bp of the A09 chromosome of Brassica napus, the reference genome version is ZS11.v0, has G / A polymorphism, A is an excellent allelic genotype, the phenotype contribution rate of the thousand kernel weight is 10.0%-12.8%, and the individual with the genotype AA or AG at the position has a higher thousand kernel weight trait than the individual with the genotype GG. A specific KASP marker primer set is developed for the SNP site, the KASP marker primer set can realize the site genotyping, can be used for molecular marker assisted breeding selection, accelerates the identification and breeding of the thousand kernel weight trait in the rapeseed breeding process, and improves the breeding screening efficiency.

Description

TECHNICAL FIELD

[0001] The application belongs to the field of genetic engineering, and particularly relates to a SNP site related to the thousand kernel weight trait of Brassica napus and a KASP marker primer set thereof. BACKGROUND

[0002] Rape is the largest oil crop in China, and thousand kernel weight is one of the three major factors affecting the yield of rapeseed. The traditional weighing detection method is performed after the seeds mature, and the thousand kernel weight phenotype is greatly affected by the environment, and the weighing detection method is difficult to accurately correspond to the effect of the related genotype. The molecular marker assisted breeding technology can effectively avoid the influence of environmental factors and human errors on phenotype identification. Among them, the KASP (Kompetitive Allele-Specific PCR) technology is based on the complementary matching principle of the terminal base of the primer to SNP typing. The technology has the advantages of economy, simple operation, high throughput and high efficiency, and has a wide application prospect in breeding. SUMMARY

[0003] The technical problem to be solved by the application is to provide a SNP site related to the thousand kernel weight trait of Brassica napus and a KASP marker primer set thereof.

[0004] The technical solution of the application is: the application of the SNP marker in the thousand kernel weight trait assisted breeding of Brassica napus, the SNP marker is located at the position of 3967014 bp of the A09 chromosome of Brassica napus, the reference genome version is ZS11.v0, has G / A polymorphism, A is an excellent allele, and individuals with AA or AG genotypes at the position have higher thousand kernel weight traits than individuals with GG genotype.

[0005] The application of the substance for detecting the polymorphism or genotype of the SNP site in the thousand kernel weight trait assisted breeding of Brassica napus, the SNP site is located at the position of 3967014 bp of the A09 chromosome of Brassica napus, the reference genome version is ZS11.v0, has G / A polymorphism, A is an excellent allele, and individuals with AA or AG genotypes at the position have higher thousand kernel weight traits than individuals with GG genotype.

[0006] Further, the substance is a KASP primer set, and the nucleotide sequence of the KASP primer set is shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3.

[0007] The application relates to an application of a substance for detecting SNP site polymorphism or genotype in the preparation of a Brassica napus thousand-grain-weight trait assisted selection kit, wherein the SNP site is located at the position of 3967014 bp of the A09 chromosome of the Brassica napus, the reference genome version is ZS11.v0, has G / A polymorphism, A is an excellent allele genotype, and individuals with the AA or AG genotype have a higher thousand-grain-weight trait than individuals with the GG genotype.

[0008] Further, the substance is a KASP primer group, and the nucleotide sequences of the KASP primer group are shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3.

[0009] The KASP primer group has the nucleotide sequences shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3.

[0010] Compared with the prior art, the application has the following beneficial effects:

[0011] The application patent carries out second-generation sequencing on 168 Brassica napus breeding parent lines, carries out genome scanning in combination with a thousand-grain-weight phenotype, covers 19 pairs of 38 chromosomes in a genetic map, constructs a genetic map, detects a Brassica napus thousand-grain-weight related site on the A09 chromosome, further converts the KASP marker, and verifies that the KASP marker has a significant influence on the Brassica napus thousand-grain-weight, can be used for molecular marker assisted breeding selection, speeds up the identification of the thousand-grain-weight trait in Brassica napus breeding, and improves breeding screening efficiency. BRIEF DESCRIPTION OF DRAWINGS

[0012] Figure 1 Results of SNP typing of 16 extreme phenotype Brassica napus in a GWAS positioning population at the SNP site of 3967014 bp of the A09 chromosome by the KASP marker primer group.

[0013] Figure 2 SNP typing results of 307 Brassica napus at the SNP site of 3967014 bp of the A09 chromosome by the KASP marker primer group.

[0014] Figure 3 SNP typing results of 307 Brassica napus at the SNP site of 3967014 bp of the A09 chromosome and thousand-grain-weight statistics. DETAILED DESCRIPTION

[0015] In the following examples, the experimental methods are conventional methods unless otherwise specified. In the following examples, the experimental materials are purchased from commercial channels unless otherwise specified.

[0016] Example 1: Mining of a thousand-grain-weight trait significantly related SNP site

[0017] 168 Brassica napus core breeding parents were subjected to second-generation sequencing, combined with genome scanning of thousand-grain weight phenotype, a genetic map covering 19 pairs of 38 chromosomes was constructed, and a significant SNP site related to thousand-grain weight of Brassica napus was detected on chromosome A09. The SNP site is located at position 3967014 bp of chromosome A09, the reference genome version is ZS11.v0, the base at this site has G / A polymorphism, and A is the excellent allelotype of thousand-grain weight.

[0018] Example 2 Detection of SNP genotype

[0019] (1) Design of KASP primer

[0020] Based on the upstream and downstream sequences of the SNP site, a specific KASP primer set for detecting the genotype of the SNP site was designed:

[0021] A09-3967014-F1: gaaggtgaccaagttcatgct ACCATCATGAGATATAGATG (underlined FAM KASP fluorescent tag sequence, SEQ ID No. 1)

[0022] A09-3967014-F2: gaaggtcggagtcaacggatt ACCATCATGGGATATAGATA (underlined HEX KASP fluorescent tag sequence, SEQ ID No. 2)

[0023] A09-3967014-R: TGCTGCTTATTTGCAACTTG (SEQ ID No. 3)

[0024] (2) Establishment of detection method

[0025] 1) Extract DNA from the Brassica napus material to be tested.

[0026] 2) Use KASP primer set to configure marker detection system: KASP Mix 5 μl, KASP primer set mixed primer 1.4 μl, H2O 2.6 μl, DNA 1 μl (100 ng / μl).

[0027] 3) The PCR reaction program is as follows: first step, 95℃ pre-denaturation for 15 min; second step, 94℃ denaturation for 20 sec, 65℃ annealing and extension for 60 sec, 10 cycles, each cycle with 1℃ decrease in annealing temperature; third step, 94℃ denaturation for 20 sec, 55℃ annealing and extension for 60 sec, 34 cycles; fourth step, 37℃ stable for 1 min before signal collection.

[0028] (3) KASP typing results

[0029] The 168 rapeseed materials for resequencing, combined with genotypes and thousand kernel weight data, screening extreme materials such as Table 1, 8 materials with thousand kernel weight ≥6g, 8 materials with thousand kernel weight ≤3.5g, the results of using the KASP primer set of the application to type 16 materials are shown in Table 1, the KASP marker primer set of the application can clearly type the SNP at position 3967014bp of A09 chromosome. Figure 1

[0030] Table 1: 16 extreme material phenotypes used for KASP marker development

[0031]

[0032] Example 3 Verification of SNP molecular markers

[0033] Using the marker of the application to detect 307 rapeseed, the genotyping results are shown in Table 2, the application can clearly genotype A / A, A / G, G / G genotypes in rapeseed population, and the genotype and phenotype data are shown in Table 2. Figure 2

[0034] Table 2: 307 rapeseed identified by KASP marker of the application

[0035]

[0036] As shown in Table 2, 202 A / A genotypes were detected, with an average thousand kernel weight of 5.41g; 43 A / G genotypes, with an average thousand kernel weight of 5.21g; 62 G / G genotypes, with an average thousand kernel weight of 4.35g. The average thousand kernel weight of A / A, A / G genotypes and G / G genotypes has significant difference, combined with phenotype and genotype data, it is shown that the application can be used for molecular assisted selection of rapeseed kernel weight trait genotype.​​

Claims

1. Application of a substance for detecting SNP site polymorphism or genotype in Brassica napus thousand kernel weight trait assisted selection, wherein the SNP site is located at the position of 3967014 bp on A09 chromosome of Brassica napus, the reference genome version is ZS11.v0, and has G / A polymorphism, and A is an excellent allele genotype, and individuals with AA or AG genotype at the position have higher thousand kernel weight trait than individuals with GG genotype.

2. Use according to claim 1, characterized in that, The substance is a KASP primer group sequence, and the KASP primer group nucleotide sequences are shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No.

3.

3. Application of a substance for detecting SNP site polymorphism or genotype in preparation of a Brassica napus thousand kernel weight trait assisted selection kit, wherein the SNP site is located at the position of 3967014 bp on A09 chromosome of Brassica napus, the reference genome version is ZS11.v0, and has G / A polymorphism, and A is an excellent allele genotype, and individuals with AA or AG genotype at the position have higher thousand kernel weight trait than individuals with GG genotype.

4. Use according to claim 3, characterized in that, The substance is a KASP primer group, and the KASP primer group nucleotide sequences are shown in SEQ ID No. 1, SEQ ID No. 2 and SEQ ID No. 3.

Images