CRISPR-cas system combined with metaspr optical sensor quantitative detection system, detection method and application

By combining the CRISPR-Cas system with the MetaSPR optical sensor, and utilizing the Cas12a protein to recognize and cleave DNA probes, high-sensitivity detection of a variety of analytes is achieved. This solves the problems of complex operation, time consumption, and material consumption in traditional methods, and is suitable for food safety and clinical diagnosis.

CN121141595BActive Publication Date: 2026-02-24NANJING NORMAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511705656.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-11-20
Publication Date
2026-02-24
Estimated Expiration
2045-11-20

AI Technical Summary

Technical Problem

Existing technologies are difficult to achieve rapid, high-sensitivity, low-cost, multi-channel parallel detection of various heterogeneous analytes such as lactic acid, ethyl carbamate, vanillin, and arginine, especially in point-of-care testing (POCT).

Method used

The CRISPR-Cas system combined with the MetaSPR optical sensor was used to modify the surface of a gold substrate with single-stranded DNA H1 and H2. The Cas12a protein recognized the target molecule and cleaved H1, causing the gold spheres to detach and resulting in a signal change. The MetaSPR optical sensor was then used for quantitative analysis.

Benefits of technology

It enables rapid, accurate, sensitive, and low-cost detection of various analytes such as lactic acid, ethyl carbamate, vanillin, and arginine, and is suitable for food safety monitoring, clinical diagnosis, and industrial biotechnology.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121141595B_ABST
    Figure CN121141595B_ABST
Patent Text Reader

Abstract

The application provides a CRISPR-Cas system combined with a MetaSPR optical sensor quantitative detection system, a detection method and application, and relates to the technical field of biological sensing and optical detection. The system comprises: a MetaSPR optical sensor, a gold substrate surface of which is modified with single-stranded DNA H1, the 5' end of H1 is modified with a mercapto group, and H1 is fixed to the gold substrate of the MetaSPR optical sensor through an Au-S bond; H1 is combined with single-stranded DNA H2 with a gold ball to form a double-stranded structure through base complementary pairing, the 5' end of H2 is also modified with a mercapto group, and the gold ball is fixed to the surface of the gold substrate; a CRISPR-Cas reaction system, comprising a to-be-detected molecule solution, Cas protein, buffer, guide RNA, nuclease-free water and target DNA; the CRISPR-Cas reaction system is used for recognizing a target molecule, and H1 is cut after the target molecule is recognized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biosensing and optical detection technology, and in particular to a quantitative detection system, detection method and application of a CRISPR-Cas system combined with a MetaSPR optical sensor. Background Technology

[0002] In recent years, with the rapid development of food safety, clinical medical diagnosis, and bioprocess monitoring, the demand for rapid, accurate, and highly sensitive detection of key biomarkers and risk factors has become increasingly urgent. Lactic acid, ethyl carbamate, vanillin, and arginine are four important analytes, and their detection technologies face numerous challenges. Ethyl carbamate is a Group 2A carcinogen widely found in fermented foods (such as soy sauce, rice wine, and yogurt) and alcoholic beverages. Residue limits for it are becoming increasingly stringent in various countries. Therefore, developing highly sensitive detection methods for on-site, large-scale screening is of great significance for ensuring food safety and consumer health.

[0003] Currently, traditional methods for detecting the above-mentioned analytes mainly include high-performance liquid chromatography (HPLC), gas chromatography-mass spectrometry (GC-MS), and enzyme-linked immunosorbent assay (ELISA). Although these methods each have their advantages, they generally have some inherent drawbacks: chromatographic methods usually require complex sample pretreatment, expensive instruments and equipment, professional operators, and long analysis times, making it difficult to meet the needs of rapid on-site detection; while ELISA methods, although highly sensitive, rely on specific antibodies, resulting in problems such as poor reagent stability, high cost, and potential cross-reactivity, and typically can only detect one indicator at a time.

[0004] Therefore, there is an urgent need in this field to develop a new detection platform that can overcome the limitations of existing technologies and achieve rapid, high-sensitivity, low-cost, multi-channel parallel detection of a variety of heterogeneous analytes such as lactic acid, ethyl carbamate, vanillin, and arginine, and has the potential to be used for point-of-care testing (POCT).

[0005] Therefore, this invention is proposed. Summary of the Invention

[0006] To address the aforementioned technical problems, this invention provides a quantitative detection system, detection method, and application combining a CRISPR-Cas system with a MetaSPR optical sensor. This invention develops a novel detection platform combining a CRISPR-Cas system with a MetaSPR optical sensor, which can effectively solve the above-mentioned technical challenges and provide a powerful analytical tool for food safety monitoring, clinical diagnosis, and industrial biotechnology.

[0007] In order to achieve the objective of this invention, the following technical solution is adopted:

[0008] This invention provides a quantitative detection system combining a CRISPR-Cas system with a MetaSPR optical sensor, comprising:

[0009] The MetaSPR optical sensor has a gold substrate surface modified with single-stranded DNA H1, the 5' end of which is modified with a thiol group. The H1 is fixed to the gold substrate of the MetaSPR optical sensor through Au-S bonds. The H1 binds to the single-stranded DNA H2 with gold spheres through base complementary pairing to form a double-stranded structure. The 5' end of H2 is also modified with a thiol group, which fixes the gold spheres to the surface of the gold substrate.

[0010] The CRISPR-Cas reaction system includes a solution of the target molecule, Cas protein, buffer, guide RNA, nuclease-free water, and target DNA; the CRISPR-Cas reaction system is used to identify the target molecule, and cleaves H1 upon identification of the target molecule.

[0011] Furthermore, the Cas protein is the Cas12a protein, and the amino acid sequence of the Cas12a protein is shown in SEQ ID NO.1;

[0012] SEQ ID NO.1

[0013]

[0014] The sequence of the single-stranded DNA H1 is shown in SEQ ID NO.2;

[0015] SEQ ID NO.2

[0016] 5'-SH-CTTTACTCAACTTATTATTACGAACATCAGG-3'

[0017] The sequence of the single-stranded DNA H2 is shown in SEQ ID NO.3;

[0018] SEQ ID NO.3

[0019] 5'-SH-CCTGATGTTCGT-3'

[0020] The nucleotide sequence of the target DNA is any one of SEQ ID NO.4-SEQ ID NO.7;

[0021] SEQ ID NO.4

[0022] 5'-GACGACGAGTAGCGCGTATGAATGCTTTTCTATGGAGTCGTC-3'

[0023] SEQ ID NO.5

[0024] 5'-GGGGGCACGGGAGGTTGCATCGAGCGGTGG-3'

[0025] SEQ ID NO.6

[0026] 5'-CGACCAGCTCATTCCTCAGGAGAAACATGGAGTCTCGATGATAGTAGGAGCGGCGGAACGTAGGAAGAGAGGATGACGGAGGATCCGAGCTCACCAGTC-3'

[0027] SEQ ID NO.7

[0028] 5'-TGACCAGGGCAAACGGTAGGTGAGTGGTCA-3'

[0029] The nucleotide sequence of the guide RNA is any one of SEQ ID NO.8-SEQ ID NO.11.

[0030] SEQ ID NO.8

[0031] 5'-UAAUUUCUACUAAGUGUAGAUAAAGCAUUCAUACGCGCUACUC-3'

[0032] SEQ ID NO.9

[0033] 5'-UAAUUUCUACUAAGUGUAGAUAUGCAACCUCCCGUGCCCCC-3'

[0034] SEQ ID NO.10

[0035] 5'-UAAUUUCUACUAAGUGUAGAUCUCCUGAGGAAUGAGCUGGUCG-3'

[0036] SEQ ID NO.11

[0037] 5'-UAAUUUCUACUAAGUGUAGAUCACCUACCGUUUGCCCUGGUCA-3'

[0038] This invention also provides a method for quantitative detection of molecules using a CRISPR-Cas system combined with a MetaSPR optical sensor quantitative detection system, comprising the following steps:

[0039] S1. Fabrication of AuNPs-H2 probes and functionalized MetaSPR sensors;

[0040] S2. Incubate the molecule to be tested with the corresponding target DNA to form a molecule-target DNA complex;

[0041] S3. The CRISPR-Cas reaction system is added to the reaction system formed in step S2. The remaining unbound target DNA, guide RNA and Cas protein form a ternary complex, which activates the trans-cleavage activity of Cas protein, and the activated CRISPR-Cas reaction system is obtained.

[0042] S4. The activated CRISPR-Cas reaction system is introduced into the functionalized MetaSPR sensor. The Cas protein cleaves the trans-cleavage site in H1, causing the gold ball to fall off and resulting in a change in the MetaSPR signal.

[0043] S5. Quantitatively analyze the concentration of the analyte molecule by detecting changes in the MetaSPR signal.

[0044] Furthermore, the molecule to be tested is any one or more of lactic acid, ethyl carbamate, vanillin, or arginine.

[0045] Furthermore, the MetaSPR signal detection uses WeSPR 100X, the microplate uses a MetaSPR chip with a titanium:gold thickness ratio of 9:90, and the wavelength is selected as 585-605nm.

[0046] Furthermore, in the CRISPR-Cas reaction system, the volume ratio of the test molecule solution: target DNA: Cas protein: buffer: guide RNA: nuclease-free water is 2:5:2:2:2:27.

[0047] Furthermore, in step S2, the incubation time between the molecule to be tested and the corresponding target DNA is 9-11 minutes.

[0048] Furthermore, in step S3, the reaction temperature of the activated CRISPR-Cas reaction system introduced into the MetaSPR optical sensor is 36℃-38℃, and the reaction time is 25min-35min.

[0049] Furthermore, the buffer solution is composed of Tris-HCl, magnesium chloride, sodium chloride, and bovine serum albumin;

[0050] Furthermore, the pH of the buffer solution is 7.4, and the pH of the buffer solution is adjusted using hydrochloric acid.

[0051] Furthermore, the buffer solution consists of 10 mM Tris-HCl, 10 mM magnesium chloride, 10 mM sodium chloride, and 100 mg / mL bovine serum albumin solution.

[0052] Furthermore, the molar concentration of the Cas protein solution is 15nM-25nM; the molar concentration of the target nucleic acid solution is 120nM-130nM; and the molar concentration of the guide RNA solution is 15nM-25nM.

[0053] Furthermore, the molar concentration of the Cas protein solution is 20 nM; the molar concentration of the target nucleic acid solution is 125 nM; and the molar concentration of the guide RNA solution is 20 nM.

[0054] This invention also provides an application of a quantitative detection method for molecules using a CRISPR-Cas system combined with a MetaSPR optical sensor or a CRISPR-Cas system combined with a MetaSPR optical sensor in identifying adulterated oils or evaluating the grade of liquor.

[0055] The present invention has the following technical effects:

[0056] By creatively combining the high specificity and high sensitivity of the CRISPR / Cas system for biometric recognition and signal amplification with the label-free, high sensitivity, and real-time quantitative detection capabilities of the MetaSPR optical sensor, a powerful and universal small molecule detection platform has been constructed.

[0057] This method effectively overcomes the limitations of traditional chromatographic methods, such as complexity, time-consuming and material-intensive operation, and traditional immunoassay methods, such as reliance on antibodies and potential cross-reactions. Ultimately, it demonstrates outstanding advantages of speed, accuracy, sensitivity and relatively low cost in the two core application scenarios of food safety, namely "adulteration of oils and fats" and "authentication of liquor", providing a brand-new technical solution to address industry pain points. Attached Figure Description

[0058] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0059] Figure 1 : This refers to the test results of the nucleic acid probe binding to the gold substrate surface in this invention;

[0060] Figure 2 This is the result of introducing the CRISPR / Cas system into SPR to cleave nucleic acid probes in this invention;

[0061] Figure 3 The result is the detection result of lactic acid molecules using the CRISPR / Cas system combined with SPR in this invention.

[0062] Figure 4 This refers to the results of using the Cas protein provided in the embodiments of the present invention to identify different edible oils;

[0063] Figure 5 This is the result of using the Cas protein provided in the embodiments of the present invention to identify adulterated edible oils;

[0064] Figure 6 This refers to the classification results of different grades of baijiu by the Cas protein provided in the embodiments of the present invention;

[0065] Figure 7 This is the result of using the Cas protein provided in the embodiments of the present invention to adulterate baijiu. Detailed Implementation

[0066] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of this invention, and not all of them. All other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0067] In a first aspect, the present invention provides a quantitative detection system combining a CRISPR-Cas system with a MetaSPR optical sensor, comprising:

[0068] The MetaSPR optical sensor has a gold substrate surface modified with single-stranded DNA H1, the 5' end of which is modified with a thiol group. The H1 is fixed to the gold substrate of the MetaSPR optical sensor through Au-S bonds. The H1 binds to the single-stranded DNA H2 with gold spheres through base complementary pairing to form a double-stranded structure. The 5' end of H2 is also modified with a thiol group, which fixes the gold spheres to the surface of the gold substrate.

[0069] The CRISPR-Cas reaction system includes a solution of the target molecule, Cas protein, buffer, guide RNA, nuclease-free water, and target DNA; the CRISPR-Cas reaction system is used to identify the target molecule, and cleaves H1 upon identification of the target molecule.

[0070] This invention integrates two previously independent technical modules—the CRISPR-Cas biometric amplification module and the MetaSPR optical sensing module—through a DNA probe bridge. The H1-H2-gold ball structure is crucial for signal conversion. H1 acts as an "anchor probe" fixed to the sensor surface, and it is also the "sacrificial site" for Cas12a cleavage. H2 acts as a "connection probe," suspending the gold ball, which has a strong signal amplification effect, on the sensor surface through DNA hybridization. The stability of this structure directly determines the intensity of the initial signal and the magnitude of subsequent signal changes. The CRISPR-Cas reaction system is the "brain" of the system, responsible for specifically recognizing the target. Its working principle is through a "competitive inhibition" or "reporter gene" mode: the analyte binds to the target DNA, modulating the amount of target DNA that can activate Cas12a, thereby modulating the cleavage activity of Cas12a, and ultimately modulating the amount of change in the optical signal.

[0071] This is not a simple A+B, but rather a seamless integration of biochemical reactions and physical signal changes through DNA probes, achieving a 1+1>2 effect. Traditional SPR (Sequencing Resonance Processing) struggles to detect small molecules because their small molecular weight results in negligible changes in refractive index. This invention cleverly bypasses the physical limitations of small molecule detection by introducing gold spheres as "signal amplifiers," transforming weak biochemical events (small molecule binding) into powerful optical signals (gold sphere detachment).

[0072] In some embodiments, the Cas protein is the Cas12a protein, and the amino acid sequence of the Cas12a protein is shown in SEQ ID NO.1;

[0073] The sequence of the single-stranded DNA H1 is shown in SEQ ID NO.2;

[0074] The sequence of the single-stranded DNA H2 is shown in SEQ ID NO.3;

[0075] The nucleotide sequence of the target DNA is any one of SEQ ID NO.4-SEQ ID NO.7;

[0076] The nucleotide sequence of the guide RNA is any one of SEQ ID NO.8-SEQ ID NO.11.

[0077] The Cas12a protein specifies the use of a Cas12a isoform with trans-cleaving activity, and its specific sequence ensures high cleavage efficiency in the system. The H1 sequence contains a trans-cleavage site that can be efficiently recognized by Cas12a; its length and sequence ensure stable hybridization with H2 while being efficiently cleaved by Cas12a. The H2 sequence ensures stable binding to H1 and effective gold globule labeling. The one-to-one correspondence between the specific target DNA and the guide RNA ensures detection accuracy and prevents cross-reactivity.

[0078] Secondly, this invention provides a method for quantitatively detecting molecules using a CRISPR-Cas system combined with a MetaSPR optical sensor quantitative detection system, comprising the following steps:

[0079] S1. Fabrication of AuNPs-H2 probes and functionalized MetaSPR sensors;

[0080] S2. Incubate the molecule to be tested with the corresponding target DNA to form a molecule-target DNA complex;

[0081] S3. Add the CRISPR-Cas reaction system to the reaction system formed in step S2. The remaining unbound target DNA, guide RNA and Cas protein form a ternary complex, which activates the trans-cleavage activity of the Cas protein, and obtains the activated CRISPR-Cas reaction system.

[0082] S4. The activated CRISPR-Cas reaction system is introduced into the functionalized MetaSPR sensor. The Cas protein cleaves the trans-cleavage site in H1, causing the gold ball to fall off and resulting in a change in the MetaSPR signal.

[0083] S5. Quantitatively analyze the concentration of the analyte molecule by detecting changes in the MetaSPR signal.

[0084] In some embodiments, the analyte is any one or more of lactic acid, ethyl carbamate, vanillin, or arginine.

[0085] This invention expands the detection range to organic matter by screening specific target DNA and guide RNA sequences, greatly improving the detection breadth of CRISPR-Cas.

[0086] In some embodiments, the MetaSPR signal detection uses WeSPR 100X, the microplate uses a MetaSPR chip with a titanium:gold thickness ratio of 9:90, and the wavelength is selected as 585-605nm.

[0087] In some embodiments, the volume ratio of the test molecule solution: target DNA: Cas protein: buffer: guide RNA: nuclease-free water in the CRISPR-Cas reaction system is 2:5:2:2:2:27.

[0088] Optimal molar concentrations and volume ratios of components in the CRISPR reaction system are defined to ensure maximum efficiency in molecular recognition, complex formation, and trans-cleavage, while avoiding reagent waste or excessive background signal; thus guaranteeing the sensitivity, repeatability, and cost-effectiveness of the detection. Inappropriate ratios can lead to weak signals, large fluctuations, or high costs.

[0089] In some embodiments, the incubation time between the test molecule and the corresponding target DNA in step S2 is 9 min-11 min.

[0090] In some embodiments, in step S3, the reaction temperature of the activated CRISPR-Cas reaction system introduced into the MetaSPR optical sensor is 36°C-38°C, and the reaction time is 25 min-35 min.

[0091] The optimal time and temperature window for the key incubation steps were defined. A single incubation (9-11 min) ensured complete binding of the molecule to the target DNA; a second incubation (36℃-38℃, 25-35 min) ensured complete cleavage of Cas12a at the optimal activity temperature. This approach, while ensuring complete reaction, achieved rapid detection, meeting the needs of rapid on-site testing, and also guaranteed the stability of the results.

[0092] In some embodiments, the buffer solution consists of Tris-HCl, magnesium chloride, sodium chloride, and bovine serum albumin;

[0093] Furthermore, the pH of the buffer solution is 7.4, and the pH of the buffer solution is adjusted using hydrochloric acid.

[0094] In some embodiments, the buffer solution consists of 10 mM Tris-HCl, 10 mM magnesium chloride, 10 mM sodium chloride, and 100 mg / mL bovine serum albumin solution.

[0095] In some embodiments, the molar concentration of the Cas protein solution is 15 nM-25 nM; the molar concentration of the target nucleic acid solution is 120 nM-130 nM; and the molar concentration of the guide RNA solution is 15 nM-25 nM.

[0096] The composition of this buffer provides an optimal chemical environment for maintaining the best activity and stability of Cas12a, while maximizing the cleavage efficiency of Cas12a, which is the fundamental guarantee for achieving high sensitivity.

[0097] In some embodiments, the molar concentration of the Cas protein solution is 20 nM; the molar concentration of the target nucleic acid solution is 125 nM; and the molar concentration of the guide RNA solution is 20 nM.

[0098] Thirdly, the present invention also provides an application of a quantitative detection method for molecules using a CRISPR-Cas system combined with a MetaSPR optical sensor quantitative detection system or a CRISPR-Cas system combined with a MetaSPR optical sensor quantitative detection system in identifying adulterated oils or evaluating the grade of liquor.

[0099] The following is a detailed explanation using specific embodiments:

[0100] Example 1

[0101] A solution containing 0.001 nM lactic acid molecules was selected as the test solution.

[0102] 1. Preparation of AuNPs-H2 probes:

[0103] 42 μL of H2 probe, 132 μL of 10% Tween 20, and 14.4 μL of 50 mM sodium citrate were added sequentially to 1442 μL of 20 nm AuNPs. After manual reverse mixing, the pH was adjusted to 3 with 2.5 mM HCl and incubated overnight on a rotary mixer. Finally, the mixture was centrifuged at 8000 rpm for 10 minutes, the supernatant was discarded, and the AuNPs-labeled H2 probe was resuspended in 721 μL of 1×PBS and stored at 4°C for later use.

[0104] 2. Fabrication of functionalized MetaSPR sensors

[0105] First, DNA oligonucleotides (H1 and H2, 100 μM) with 5' thiol-modified groups were treated with TCEP solution (10 mM) for 1 hour to activate the probes and expose free thiol groups. Then, 2 μL of TCEP-treated H1 was spotted per well onto the MetaSPR sensor chip and incubated overnight at 4°C for 16 h to immobilize the probes. After washing with PBS buffer to remove unbound H1 DNA, 100 μL of 10 μM MCH (6-mercapto-1-hexanol) solution was added to each well, and the chip was incubated at room temperature for 1 hour to block the gold surface and reduce non-specific adsorption. After washing with PBS to remove MCH, 50 μL of AuNPs-labeled H2 probes was added, and the chip was incubated at 37°C for 20 minutes for complementary pairing. Finally, unbound AuNPs-H2 probes were washed with PBS buffer to obtain the functionalized MetaSPR sensor. The experimental results are shown below. Figure 1 As shown, from Figure 1 The results show that the nucleic acid probe successfully bound to the gold substrate surface of MetaSPR, and the RU value increased to 138.

[0106] 3. Construction of the CRISPR reaction system

[0107] 2 μL of 50 nM Cas12a protein solution, 2 μL of the analyte solution, 5 μL of 125 nM target DNA solution, 2 μL of 50 nM guide RNA (crRNA) solution, 39 μL of nuclease-free water, and 2 μL of reaction buffer (1 × NEBuffer 2.1, which is a mixture of 10 mM Tris-HCl, 10 mM magnesium chloride, 10 mM sodium chloride, and 100 mg / mL bovine serum albumin solution, and then adjusted to pH 7.4 with hydrochloric acid).

[0108] The specific procedure is as follows: In an enzyme-free centrifuge tube, add nuclease-free water, target DNA, and the test solution. After mixing, incubate at room temperature for 10 minutes to allow the molecules to bind with the target DNA and form a complex. Then add the Cas12a / crRNA complex, which has been co-incubated at 37 °C beforehand, and 1 × NEBuffer 2.1. After thorough mixing, add 50 μL of the reaction mixture to the well of the functionalized MetaSPR sensor chip and lyse at 37 °C for 30 minutes. Calculate λ... 585nm -λ 605nm Data was obtained in units of response units (RU), and the experimental results are as follows: Figure 2 As shown, from Figure 2 The results show that after adding the CRISPR system, the RU value gradually increases because the Cas12a protein adsorbs onto the gold membrane surface. Then, rinsing the gold membrane surface with PBS causes some of the Cas12a protein to gradually decrease the RU value. Adding proteinase K cleaves the remaining Cas12a on the gold membrane surface, and the RU value gradually decreases. Finally, washing the gold membrane surface with PBS removes the residual H2-AuNPs, and the RU value drops to -35.6, which represents the H2-AuNPs cleaved by Cas12a at 0.001 nM lactate. The obtained |ΔRU| is used to represent the concentration of lactate molecules.

[0109] 4. The testing process includes

[0110] First, H1 probes were modified and blocked on a 96-well MetaSPR chip. After washing, 50 μL of AuNPs-labeled H2 probes were added, and the SPR signal change was detected on the instrument. After binding for 20 minutes, the chip was washed with PBS, and then 50 μL of CRISPR reaction system was added, and the SPR signal change was detected. Quantitative analysis was achieved based on the signal differences corresponding to different molecule concentrations. The experimental results are as follows: Figure 3 As shown, from Figure 3 It can be seen that |ΔRU| is inversely proportional to the concentration of lactic acid molecules and has a linear relationship, R 2 It is 0.9983.

[0111] Example 2

[0112] The specific implementation method is consistent with Example 1, except that the analyte is replaced with an oil sample. The experimental results are as follows: Figures 4-5 As shown. This method successfully achieves high-precision differentiation of various edible oils, such as... Figure 4 The key lies in the fact that different edible oils possess specific small-molecule "fingerprints" (conformation and ratio), which specifically interact with Cas proteins, causing varying degrees of enzyme activity changes and transforming into unique SPR response signals (|ΔRU|). Cluster analysis shows that signals from similar edible oils are highly clustered, while signals from dissimilar oils are significantly separated, thus providing a reliable basis for identification.

[0113] This method can also be used to identify adulteration in edible oils, such as... Figure 5 When soybean oil is mixed with different proportions of olive oil, the intensity of the mixed edible oil will deviate from that of the olive oil with different proportions after cluster analysis.

[0114] Example 3

[0115] The specific implementation method is consistent with Example 1, except that the molecule to be tested is replaced with a baijiu sample from Luzhou Laojiao. The experimental results are as follows: Figures 6-7 As shown. This method successfully achieved high-precision differentiation of various liquor samples, such as... Figure 6 As shown, since the content of characteristic molecules in different types of baijiu varies, each type of baijiu will specifically interact with Cas protein and generate a unique SPR response signal. Cluster analysis shows that the SPR signals of baijiu from the same fermentation pit are highly clustered, while the SPR signals of baijiu from different fermentation pits are significantly separated. This method achieves efficient identification of baijiu samples from different fermentation pits based on Cas protein response and SPR technology.

[0116] This method can also be used to identify adulteration in baijiu (Chinese liquor), such as... Figure 5 When different proportions of water are added to a baijiu sample, the intensity of the |ΔRU| of the adulterated sample deviates from that of the pure baijiu sample after cluster analysis. The signals of all adulterated samples form independent clusters in the cluster analysis, and their positions are significantly different from those of the pure baijiu sample, thus realizing the identification of adulteration of baijiu.

[0117] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the technical solutions of the embodiments of the present invention.

Claims

1. A quantitative detection system combining a CRISPR-Cas system with a MetaSPR optical sensor, characterized in that: include: The MetaSPR optical sensor has a gold substrate surface modified with single-stranded DNA H1, the 5' end of which is modified with a thiol group. The H1 is fixed to the gold substrate of the MetaSPR optical sensor through Au-S bonds. The H1 binds to the single-stranded DNA H2 with gold spheres through base complementary pairing to form a double-stranded structure. The 5' end of H2 is also modified with a thiol group, which fixes the gold spheres to the surface of the gold substrate. The CRISPR-Cas reaction system includes a solution of the target molecule, Cas protein, buffer, guide RNA, nuclease-free water, and target DNA; the CRISPR-Cas reaction system is used to recognize the target molecule, and cleaves H1 upon recognition of the target molecule. The Cas protein is the Cas12a protein, and the amino acid sequence of the Cas12a protein is shown in SEQ ID NO.1; The sequence of the single-stranded DNA H1 is shown in SEQ ID NO.2; The sequence of the single-stranded DNA H2 is shown in SEQ ID NO.3; The nucleotide sequence of the target DNA is any one of SEQ ID NO.4-SEQ ID NO.7; The nucleotide sequence of the guide RNA is any one of SEQ ID NO. 8-SEQ ID NO. 11; MetaSPR signal detection uses WeSPR 100X, with a MetaSPR chip of titanium:gold thickness ratio of 9:90 selected for the microplate, and a wavelength of 585-605nm chosen. The method for quantitatively detecting molecules using the CRISPR-Cas system combined with the MetaSPR optical sensor quantitative detection system includes the following steps: S1. Fabrication of AuNPs-H2 probes and functionalized MetaSPR sensors; S2. Incubate the molecule to be tested with the corresponding target DNA to form a molecule-target DNA complex; S3. Add the CRISPR-Cas reaction system to the reaction system formed in step S2. The remaining unbound target DNA, guide RNA and Cas protein form a ternary complex, which activates the trans-cleavage activity of the Cas protein, and obtains the activated CRISPR-Cas reaction system. S4. The activated CRISPR-Cas reaction system is introduced into the functionalized MetaSPR sensor. The Cas protein cleaves the trans-cleavage site in H1, causing the gold ball to fall off and resulting in a change in the MetaSPR signal. S5. Quantitatively analyze the concentration of the analyte molecule by detecting changes in the MetaSPR signal; The molecule to be tested is any one or more of lactic acid, ethyl carbamate, vanillin, or arginine. The volume ratio of the test molecule solution, target DNA, Cas protein, buffer, guide RNA, and nuclease-free water in the CRISPR-Cas reaction system is 2:5:2:2:2:

27.

2. The quantitative detection system combining the CRISPR-Cas system with the MetaSPR optical sensor according to claim 1, characterized in that, In step S2, the incubation time between the molecule to be tested and the corresponding target DNA is 9-11 minutes.

3. The quantitative detection system combining the CRISPR-Cas system with the MetaSPR optical sensor according to claim 1, characterized in that, In step S3, the reaction temperature of the activated CRISPR-Cas reaction system introduced into the MetaSPR optical sensor is 36℃-38℃, and the reaction time is 25min-35min.

4. The quantitative detection system combining the CRISPR-Cas system with the MetaSPR optical sensor according to claim 1, characterized in that, The buffer solution consists of Tris-HCl, magnesium chloride, sodium chloride, and bovine serum albumin; Furthermore, the pH of the buffer solution is 7.4, and the pH of the buffer solution is adjusted using hydrochloric acid.

5. The quantitative detection system combining the CRISPR-Cas system with the MetaSPR optical sensor according to claim 1, characterized in that, The molar concentration of the Cas protein solution is 15nM-25nM; the molar concentration of the target nucleic acid solution is 120nM-130nM; and the molar concentration of the guide RNA solution is 15nM-25nM.

6. The application of the CRISPR-Cas system combined with the MetaSPR optical sensor quantitative detection system as described in any one of claims 1-5 in identifying adulterated oils or evaluating the grade of liquor.

Citation Information

Patent Citations

  • Nucleic acid detection kit based on CRISPR (clustered regularly interspaced short palindromic repeats) technology and surface plasmon resonance technology and application thereof

    CN116287426A