Hyaluronic acid and folic acid double-target-head modified cationic safflower polysaccharide nano-carrier as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of drug carriers, and particularly relates to a hyaluronic acid and folic acid double-target-head modified cationic safflower polysaccharide nano-carrier as well as a preparation method and application thereof. The preparation method comprises the following steps: selecting cationic safflower polysaccharide (SPS-PEI) as a basic carrier, preparing self-assembled nanoparticles (Nanoparticles, NPs) by combining with siRNA through an electrostatic adsorption effect, covalently binding hyaluronic acid (HA) and folic acid (FA) through an esterification reaction to form a polymer, and coating the SPS-PEI with the polymer to construct the dual targeting nano gene carrier (HA-FA-SPS-PEI Nanoparticles, HFSPNPs). Research results show that compared with self-assembled single-target-head nanoparticles and target-head-free nanoparticles, the double-target-head nanoparticles siBMP2 / HFSPNPs disclosed by the invention have relatively strong tumor targeting property, and can be more effectively accumulated in tumor tissues and release siBMP2, so that expression of BMP2 protein is reduced, apoptosis of liver cancer cells is promoted, and the purpose of gene therapy is achieved.

Description

Technical Field

[0001] This invention belongs to the field of drug carrier technology, specifically relating to a hyaluronic acid and folic acid dual-target modified cationic safflower polysaccharide nanocarrier, its preparation method, and its uses. Background Technology

[0002] Liver cancer has an alarmingly high incidence rate worldwide, with a higher proportion of male patients, making it the second leading cause of cancer death in men. While traditional surgical and chemotherapy treatments may offer some therapeutic benefits, they still carry certain risks. RNA interference (RNAi) technology is a widely used gene-interference method in tumor treatment. It can not only replace traditional surgery, chemotherapy, and radiation therapy but also effectively improve patients' quality of life. Introducing double-stranded RNA as a novel regulatory mechanism can significantly reduce the expression of specific genes, thereby achieving precise regulation of genes within target cells. RNAi technology has demonstrated strong selectivity, specificity, sensitivity, and high gene silencing efficiency in the treatment of liver cancer. It can effectively inhibit important oncogenes and their corresponding signaling pathways within cancer cells, thus effectively preventing further cancer spread and becoming a highly effective treatment method.

[0003] In recent years, gene therapy has gained increasing attention, making gene vectors a research hotspot and challenge. Natural polysaccharides, found in nature, have gradually come into the view of researchers as safe, efficient, and low-toxicity gene vectors. With the advancement of technology, natural polysaccharides, due to their excellent safety, high biocompatibility, and complete self-repair capabilities, are increasingly becoming a hot topic in biomaterials research. Through amination reactions with polyethyleneimine (PEI), many different types of natural polysaccharides can be prepared, providing excellent transfection efficiency. Utilizing surface sugar recognition receptor technology, cationic polysaccharide-based vectors have significant advantages, resulting in significant therapeutic effects. Safflower polysaccharide (SPS) is found in the safflower plant (Carthamus tinctorius). Carthamus tinctorius L. SPS is a natural polysaccharide that possesses anti-tumor, immune-enhancing, and antioxidant properties. The presence of the active group -OH allows it to exert a variety of different biological functions through chemical modification.

[0004] Receptor-mediated gene delivery technology enables state-of-the-art cell-based drug therapy. By binding a ligand of a specific receptor to negatively charged DNA, a ligand-cationic conjugate can be constructed. This structure can transmit the receptor signal to the cell via electrostatic adsorption, thereby achieving receptor endocytosis. The advantage of this method is its high specificity and affinity, allowing for faster delivery to the lesion. Specific receptors are a crucial class of biological substances that can influence cell growth, development, immune function, and stability by regulating intracellular chemical reactions. In recent years, receptor-mediated targeted therapy has become a very important drug treatment approach, enabling precise delivery of drugs to the patient's lesion through precise nanoparticle projection, thus achieving better therapeutic effects.

[0005] Bone morphogenetic proteins 2 (BMP2) is an important transcription factor that promotes enhanced gene expression, thereby improving cell function and growth. Recent studies have found that its expression is significantly increased in many epithelial cell tumors. Changes in BMP2 expression levels may affect the malignant differentiation, spread, invasion, metastasis, and recurrence of liver cancer, but research in this area is quite limited.

[0006] However, there are currently no reports on hyaluronic acid and folic acid dual-target modified cationic safflower polysaccharide nanocarriers that can effectively deliver siRNA-BMP2 and their use in the treatment of liver cancer. Summary of the Invention

[0007] To overcome the defects and shortcomings of existing technologies, the inventors selected cationic safflower polysaccharide (SPS-PEI) as the basic carrier and prepared self-assembled nanoparticles (NPs) by combining siRNA through electrostatic adsorption. To effectively improve the delivery speed, hyaluronic acid (HA) and folic acid (FA) were covalently bonded through an esterification reaction to form a polymer, which was then encapsulated on the outside of SPS-PEI. This effectively reduced the positive charge and cytotoxicity, and enabled simultaneous targeting of FA and HA receptors on the surface of liver cancer cells, constructing dual-targeting nanogene carriers (HA-FA-SPS-PEI Nanoparticles, HFSPNPs). Based on this, a hyaluronic acid and folic acid dual-target modified cationic safflower polysaccharide nanocarrier capable of effectively delivering siRNA-BMP2 was successfully prepared.

[0008] Specifically, the present invention is achieved through the following technical solutions: In a first aspect, the present invention provides a modified cationic safflower polysaccharide nanocarrier, wherein the nanocarrier is a self-assembled nanoparticle prepared by combining a therapeutic gene with a modified cationic safflower polysaccharide base carrier through electrostatic adsorption, and the nanoparticle has a particle size of 100-200 nm.

[0009] Alternatively, in the above-mentioned nanocarrier, the modification is a dual-target modification of hyaluronic acid and folic acid, the therapeutic gene is siRNA-BMP2, and the cationic safflower polysaccharide is prepared by amination reaction of safflower polysaccharide and polyethyleneimine.

[0010] Preferably, the mass ratio of the safflower polysaccharide to the polyethyleneimine is 1:2.

[0011] Preferably, the meaningful strand of siRNA-BMP2 is GGAUGACUGAGUACCUGAATT, and the antisense strand is UUCAGGUACUCAGUCAUCCTT.

[0012] Alternatively, in the above-mentioned nanocarrier, hyaluronic acid and folic acid are covalently bonded through an esterification reaction to form a polymer, and then the polymer is wrapped around the cationic safflower polysaccharide to obtain a modified cationic safflower polysaccharide-based carrier.

[0013] Preferably, the mass ratio of hyaluronic acid to folic acid is 1:2.

[0014] Preferably, the polymer (HA-FA) and the modified cationic safflower polysaccharide (SPS-PEI) are both diluted to a solution of 1 mg / mL, with a volume ratio of 1:1.

[0015] Alternatively, in the above-mentioned nanocarrier, the P / N ratio of the therapeutic gene to the basic carrier is 5:1-20:1.

[0016] Preferably, the P / N ratio of the therapeutic gene to the basic vector is 10:1.

[0017] The P / N ratio refers to the ratio of phosphorus atoms (P) present in the therapeutic gene (i.e., siRNA) to nitrogen atoms (N) present in the basic vector (i.e., PEI).

[0018] In a second aspect, the present invention provides a method for preparing the nanocarrier described in the first aspect above, the method comprising the following steps: Step 1: Preparation of hyaluronic acid-folic acid polymer: Hyaluronic acid and folic acid are covalently bonded through esterification reaction in the presence of dicyclohexylcarbodiimide and N-hydroxysuccinimide to form a polymer. Step 2: Preparation of the basic carrier: Cationic safflower polysaccharide was prepared by amination of safflower polysaccharide and polyethyleneimine. Under stirring conditions, the cationic safflower polysaccharide solution was slowly added to the hyaluronic acid-folic acid polymer solution prepared in Step 1. The basic carrier with high dispersibility was prepared by dialysis-ultrasonic treatment. Step 3: Preparation of modified cationic safflower polysaccharide nanocarrier: The therapeutic gene is added to the basic carrier solution, and the modified cationic safflower polysaccharide nanocarrier is prepared under electrostatic action.

[0019] As an optional method, in the above preparation method, step 1 specifically includes the following steps: adding folic acid to an appropriate amount of DMSO solution and stirring at room temperature for 20-40 min to make it completely dissolved; then adding an appropriate amount of a mixture of dicyclohexylcarbodiimide and N-hydroxysuccinimide and placing it in an environment of 25-35°C for continuous activation for 4-6 h to remove the precipitate generated during activation; adding hyaluronic acid to an appropriate amount of formamide aqueous solution and stirring at 30-50°C to dissolve it; during this process, adding the activated folic acid solution dropwise to the hyaluronic acid solution; reacting in the dark for 40-55 h to remove the precipitate generated; dialyzing the liquid with the precipitate removed using deionized water in the dark; and then freeze-drying to obtain the hyaluronic acid-folic acid polymer.

[0020] As an optional approach, in the above preparation method, step 2 specifically includes the following steps: preparing the hyaluronic acid-folic acid polymer into a solution, slowly adding the cationic safflower polysaccharide solution into the hyaluronic acid-folic acid polymer solution, magnetically stirring for 10-20 min, dissolving the prepared nanoparticles in DMSO, continuously stirring at room temperature and 800-1200 rpm for 1.5-2.5 h, then slowly adding them into deionized water, dialyzing with DMSO, and then sonicating for 2-5 min to prepare the basic carrier with high dispersibility.

[0021] As an optional approach, in the above preparation method, step 3 specifically includes the following steps: adding the therapeutic gene to the base carrier solution, obtaining self-assembled nanoparticles under electrostatic action, removing the free therapeutic gene by centrifugation at 2500-3500 rpm for 10-20 min, and freeze-drying to obtain the modified cationic safflower polysaccharide nanocarrier, wherein the P / N ratio of the therapeutic gene to the base carrier is 5:1-20:1.

[0022] Preferably, the P / N ratio of the therapeutic gene to the basic vector is 10:1.

[0023] In a third aspect, the present invention provides the use of the nanocarrier described in the first aspect above, or the nanocarrier prepared by the preparation method described in the second aspect above, in the preparation of a drug for treating cancer.

[0024] Alternatively, in the above-described use, the cancer is liver cancer.

[0025] Compared with the prior art, the present invention has the following advantages: The inventors have successfully prepared a hyaluronic acid and folic acid dual-target modified cationic safflower polysaccharide nanocarrier capable of effectively delivering siRNA-BMP2. Studies have shown that HFSPNPs exhibit excellent transfection efficiency and superior biocompatibility, while also possessing dual HA and FA receptor functions, making them an ideal nanogene carrier. siBMP2 / HFSPNPs demonstrate good in vitro and in vivo stability as a gene carrier, with a suitable particle size, strong gene-carrying capacity, efficient cellular uptake, high transfection efficiency, and precise targeted therapy for tumors. By releasing siBMP2, the content of BMP2 protein in tumor cells can be significantly reduced, thereby promoting apoptosis in cancer cells and improving the effectiveness of gene therapy. siBMP2 / HFSPNPs can be used as a novel anti-cancer gene carrier, particularly suitable for liver cancer cells, as it can efficiently deliver genes, thereby inhibiting the growth of liver cancer cells. Attached Figure Description

[0026] Figure 1 Methods for preparing blank carriers.

[0027] Figure 2 HA-FA 1 H-NMR spectrum.

[0028] Figure 3 FT-IR spectrum of HA-FA.

[0029] Figure 4 TEM image of self-assembled nanoparticles.

[0030] Figure 5 Serum stability of blank nanocarriers.

[0031] Figure 6 Protein adsorption rate of blank nanocarriers.

[0032] Figure 7 : Cytotoxicity of blank nanocarriers.

[0033] Figure 8 : Proton buffering capacity of blank nanoparticles.

[0034] Figure 9Gel electrophoresis images of siRNA / SPNPs at different N / P ratios.

[0035] Figure 10 Gel electrophoresis image of self-assembled nanoparticles under optimal N / P ratio.

[0036] Figure 11 : Drug release capacity of each carrier in vitro.

[0037] Figure 12 Quantitative analysis of in vitro drug release from nanoparticles in SMMC-7721 cells at different time points.

[0038] Figure 13 Confocal microscopy was used to investigate the distribution of dual-target nanoparticles in LO2 cells at 1h, 2h, and 4h.

[0039] Figure 14 Confocal microscopy was used to examine the competitive inhibition of uptake by the FA and HA dual receptors.

[0040] Figure 15 Screening for high-silencing-efficiency BMP2.

[0041] Figure 16 BMP2 protein expression after transfection with different nanoparticles.

[0042] Figure 17 Relationship between BMP2 protein expression level and concentration.

[0043] Figure 18 Cell scratch assay.

[0044] Figure 19 : Schematic diagram of the tumor-bearing process in mice.

[0045] Figure 20 : Three-dimensional in vivo imaging of a mouse.

[0046] Figure 21 Changes in body weight of mice in each group during model establishment and drug administration. Specifically, compared to the Control group, P <0.05.

[0047] Figure 22 : Tumor tissue weight of mice in each group.

[0048] Figure 23 : The expression level of BMP2 protein in tumor tissue.

[0049] Figure 24 Changes in the expression levels of TNF-α and IL-12 p70 in mouse serum.

[0050] Figure 25 HE staining results of tumors in mice in each group after treatment.

[0051] Figure 26 HE staining results of other organs of mice in each group after treatment. Detailed Implementation

[0052] The present invention will be further described below with reference to specific embodiments. It should be understood that the specific embodiments described herein are for illustrative purposes only and are not intended to limit the scope of the invention.

[0053] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0054] Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods. Unless otherwise specified, the experimental materials used in the following embodiments are commercially available products.

[0055] Example 1: Construction and Characterization of Dual-Targeting Gene Vectors 1. Main experimental materials Human hepatocellular carcinoma SMMC-7721 cells and normal human hepatocytes LO2 were purchased from Shanghai Fuheng Technology Co., Ltd. and cultured in the Traditional Chinese Medicine Cell Laboratory of Heilongjiang University of Traditional Chinese Medicine.

[0056] The siRNA used in this example is a negative control siRNA, which is from Suzhou GeneGene Co., Ltd.

[0057] The meaningful strand of the negative control siRNA is UUCUCCGAACGUGUCACGUdTdT, and the antisense strand is ACGUGACACGUUCGGAGAAdTdT.

[0058] 2. Main Experimental Methods 2.1 Preparation and Characterization of HA-FA Polymer 2.1.1 Preparation of HA-FA polymer Add 50 mg FA to 3 mL DMSO solution and stir at room temperature for 30 min to ensure complete dissolution. After complete dissolution, add a mixture of 1.0 g dicyclohexylcarbodiimide (DCC) and 288 mg N-hydroxysuccinimide (NHS) and incubate at 30 °C for 5 h. Remove the precipitate formed during activation by vacuum filtration.

[0059] 100 mg of HA was then added to 10 mL of formamide aqueous solution and stirred at 40 °C to dissolve it. During this process, the activated FA solution was added dropwise to the solution, and the reaction was carried out for 48 h in the dark. Finally, the precipitate was removed by vacuum filtration.

[0060] The filtered liquid was placed in a dialysis bag with an MWCO of 3000 and then dialyzed with deionized water in a dark environment for 48 hours. During this process, the water was changed every 6 hours, followed by dialysis and freeze-drying to obtain the final product.

[0061] 2.1.2 1H NMR spectrum ( 1 Characterization by H-NMR and Fourier Transform Infrared Spectroscopy (FT-IR) The conventional method was used.

[0062] 2.2 Preparation and Characterization of Nanoparticles (NPs) 2.2.1 Preparation of blank carrier Three different self-assembled nanoparticles (SPNPs, HSPNPs, and HFSPNPs) were prepared using a dialysis-ultrasound technique. HA and HA-FA were mixed to form a 1 mg / mL aqueous solution. Then, SPNPs prepared via amination (i.e., a 1 mg / mL SPS-PEI aqueous solution) were slowly added to the mixture while magnetically stirring to achieve optimal mixing. After addition, the mixture was kept stable for 15 min to obtain HSPNPs and HFSPNPs. The prepared nanoparticles were dissolved in DMSO and stirred continuously at 1000 rpm for 2 h at room temperature. Then, the solution was slowly added to deionized water, and dialysis was performed with DMSO for 1 day. Finally, the solution was sonicated for 3 min to obtain a highly dispersible nanoparticle solution. The preparation method is as follows: Figure 1 As shown.

[0063] The preparation method of SPS-PEI is as follows: DMSO (10 mL) and SPS (100 mg) were mixed until completely dissolved. Then, under nitrogen protection, N,N'-carbonyldiimidazole (CDI) (100 mg) and tetramethylsilane (TMS) (20 μL) were added sequentially, and the reaction was carried out for 1 h. PDI (200 mg) was then added, and the mixture was incubated with magnetic stirring in a water bath at 40 °C for 24 h. Ethanol was added to form a precipitate, which was washed with ethanol, redispersed in deionized water, dialyzed with deionized water, and then freeze-dried to obtain the SPS-PEI polymer.

[0064] 2.2.2 Preparation of self-assembled nanoparticles Self-assembled nanoparticles (siRNA / SPNPs, siRNA / HSPNPs, and siRNA / HFSPNPs) loaded with siRNA were prepared using the same procedure as for the blank nanoparticles. Self-assembled nanoparticles were obtained by adding different doses of siRNA to different NP solutions under electrostatic attraction, and free siRNA was removed by centrifugation at 3000 rpm for 15 min. Finally, siRNA / SPNPs, siRNA / HSPNPs, and siRNA / HFSPNPs were obtained under freeze-drying conditions.

[0065] 2.2.3 Comparison of property characterization 2.2.3.1 Nanoparticle size distribution and Zeta potential The conventional method was used.

[0066] 2.2.3.2 Transmission electron microscopy (TEM) characterization of self-assembled nanoparticles The conventional method was used.

[0067] 2.3 Safety assessment of nanoparticles 2.3.1 Serum stability 100 μL of blank SPNPs, HSPNPs, and HFSPNPs nanoparticle solutions were added to 96-well plates, respectively. A 0.9% saline group (Control group, CG) was used as a control. 100 μL of FBS was added to each well, and the plates were incubated at 37 ℃ in the dark. The absorbance of each group at 630 nm was measured using a full-wavelength microplate reader at 0, 3, 6, 12, 18, and 24 h. The relative turbidity of each group was obtained by measuring the absorption coefficient of different samples at different time points.

[0068] 2.3.2 Adsorption of proteins Equal concentrations of SPNPs, HSPNPs, and HFSPNPs were mixed with equal volumes of BSA solution, with PBS used as CG. The mixtures were incubated at 4 °C for 6 h, followed by centrifugation at 12000 rpm and 4 °C for 15 min to achieve varying degrees of separation between free BSA and nanoparticles. 20 μL of the supernatant from each group was placed in a 96-well plate, and protein concentration was determined using the BCA method.

[0069] The protein adsorption rate (PAR%) is calculated as follows: PAR%= Where: C oC1 represents the protein concentration of the supernatant in the control group after centrifugation; C2 represents the protein concentration of the supernatant in each sample group after centrifugation.

[0070] 2.3.3 Cytotoxicity The conventional method was used.

[0071] 2.4 Investigation of the proton buffering capacity of blank nanoparticles The buffering capacity of SPNPs, HSPNPs, and HFSPNPs was investigated using acid-base titration. 0.2 mg / mL of SPNPs, HSPNPs, and HFSPNPs were dispersed separately in 0.15 mol / mL NaCl aqueous solution, followed by the addition of 0.1 mol / mL NaOH aqueous solution until the pH reached 10. Then, 1–5 μL of 0.1 mol / mL HCl solution was added. The pH of the mixture was measured using a pH meter after each addition of HCl solution. 0.15 mol / mL NaCl solution served as a negative control, and 0.2 mg / mL PEI served as a positive control.

[0072] 2.5 Investigation on the adsorption capacity of self-assembled nanoparticles for siRNA 2.5.1 Adsorption efficiency of SPNPs for siRNA The adsorption of siRNA by SPNP nanoparticles was studied using agarose gel electrophoresis.

[0073] 2.5.2 Adsorption efficiency of HSPNPs and HFSPNPs for siRNA HA or HA-FA was added dropwise to siRNA / SPNPs at an N / P ratio of 10, and the mixture was vortexed to obtain self-assembled nanoparticles with single or dual targeting functions. After maintaining equilibration at room temperature for 15 min, siRNA / HSPNPs and siRNA / HFSPNPs were obtained, and then agarose gel electrophoresis was performed.

[0074] 2.6 In vitro drug release study Dynamic analysis was used to investigate the release capacity of three self-assembled nanoparticles (SPNPs, HSPNPs, and HSPNPs) of siRNA in PBS (pH 7.4). 1 mL of siRNA / SPNPs, siRNA / HSPNPs, siRNA / HFSPNPs, and free siRNA were injected into activated dialysis bags, and 50 mL of the release medium was analyzed in a shaking incubator at 37 ℃ and 120 rpm. The release medium was periodically replaced with the same volume of fresh medium, and the amount of siRNA released was determined using fluorescence spectroscopy.

[0075] 2.7 Data Processing The results were analyzed using SPSS 15.0 statistical software. Analysis of variance was used for each group of data. Results are expressed as mean ± standard deviation. The significance level was set according to the statistical results. P＜ 0.01 and 0.05.

[0076] 3. Experimental Results 3.1 Synthesis of HA-FA polymer and 1 H-NMR analysis The HA-FA compound is an orange-yellow solid powder with good water solubility. According to... Figure 2 The results showed that the characteristic peak of FA was located between δ=6.6 and 8.6 ppm, indicating that FA had been attached to HA.

[0077] 3.2 FT-IR characterization analysis of HA-FA polymers according to Figure 3 The FT-IR spectrum of HA-FA shows that when at 1565 cm⁻¹... -1 At this time, the stretching vibration peak of the ester bond C=O is significantly enhanced, while at 3277 cm⁻¹... -1 and 1606 cm -1 At that time, the peak values ​​of both -COOH and -NH2 absorption peaks were significantly increased, indicating that FA had been effectively grafted onto HA. Through 1 Based on H-NMR and FT-IR experimental results, the polymer HA-FA with dual target receptors was successfully synthesized.

[0078] 3.3 Property Characterization Analysis 3.3.1 Comparison of Particle Size Distribution and Zeta Potential Self-assembled nanoparticles (SPNPs, HSPNPs, and HFSPNPs) form complexes with siRNA via electrostatic interactions. According to the results in Table 1, the complexes show a decreasing zeta potential as the N / P ratio changes from 20:1 to 1:1. When the N / P ratio of the self-assembled nanoparticles is <5, the nanoparticles gradually acquire a negative charge. Appropriate particle size of the NPs is also crucial for efficient siRNA delivery. The particle sizes of siRNA / SPNPs, siRNA / HSPNPs, and siRNA / HFSPNPs increase with increasing N / P ratio. Positively charged self-assembled nanoparticles with diameters of 100–200 nm are suitable for cellular uptake.

[0079] Table 1. Particle size, potential, and dispersion index of blank and self-assembled nanoparticles. 3.3.2 TEM characterization of self-assembled nanoparticles like Figure 4 As shown, the siRNA / SPNPs, siRNA / HSPNPs, and siRNA / HFSPNPs self-assembled nanoparticles observed by TEM have rounded morphologies and uniform distribution.

[0080] 3.4 Safety Assessment 3.4.1 Serum stability according to Figure 5 As shown, uncoated SPNPs exhibit a significant positive charge, and their interaction with serum becomes increasingly pronounced over time. After coating treatment, the interaction between HSPNPs and HFSPNPs and serum is significantly reduced, with no significant changes observed over the duration of treatment. The binding of HA and HA-FA significantly reduces serum-induced aggregation, thereby significantly improving serum stability.

[0081] 3.4.2 Adsorption rate of proteins By weakening the binding of nanoparticles to non-specific proteins, their duration of stay within cells can be prolonged. According to... Figure 6 The results showed that the protein adsorption rate of the SPNPs group reached 41.2%, but when coated with HA and HA-FA, this value dropped to 11.6% and 8.7%, respectively. The binding of HA and HA-FA can significantly reduce protein adsorption, which helps to enhance the activity of the carrier and make its operation in the cell more stable.

[0082] 3.4.3 Cytotoxicity from Figure 7 The results showed that when the concentrations of siRNA / SPNPs, siRNA / HSPNPs, and siRNA / HFSPNPs ranged from 3.1 to 100 μg / mL, the cell viability of LO2 and SMMC-7721 cells remained above 90%, indicating that SPNPs, HHPNPs, and HFSPNPs possessed excellent safety profiles. Blank nanoparticles treated with HA and HA-FA exhibited extremely low toxicity and were completely compatible with their environment.

[0083] 3.5 Analysis of the results of the investigation on the proton buffering capacity of blank nanoparticles The results showed that SPNPs and HSPNPs exhibited lower buffering capacity compared to HFSPNPs, but all NPs showed greater proton buffering capacity than NaCl. Figure 8The reason for this result may be that SPNPs and HSPNPs have relatively fewer amino groups than HFSPNPs. The analytical results may also be due to the good proton buffering capacity of HFSPNPs, which leads to increased swelling of endocytic vesicles and allows HFSPNPs to carry siRNA into the cytoplasm through a "proton sponge" effect.

[0084] 3.6 Analysis of the results of the study on the adsorption capacity of nanoparticles for siRNA The results are as follows Figure 9 As shown, the free siRNA band is distinct. With increasing N / P ratio, the band brightness gradually decreases until N / P = 10, at which point the band brightness slowly disappears, indicating that the siRNA has been completely adsorbed by the SPNPs. In subsequent experiments, an N / P ratio of 10 will be used to prepare siRNA / SPNPs to ensure complete adsorption of the blank nanoparticles by the siRNA. Figure 10 As a result, siRNA / SPNPs, siRNA / HSPNPs, and siRNA / HFSPNPs did not show significant bands, indicating that neither HA nor HA-FA had any effect on siRNA expression.

[0085] 3.7 Analysis of in vitro drug release study results Figure 11 In vitro drug release profiles of free siRNA, siRNA / SPNPs, siRNA / HSPNPs, and siRNA / HFSPNPs are shown. Results indicate that over 87% of free siRNA was rapidly released within 8 hours. Conversely, siRNA / HFSPNPs exhibited a bidirectional release pattern. In the first 8 hours, HFSPNPs rapidly released 30% of the siRNA, followed by a gradual release of 54.1% over 64 hours. This may be because some siRNA is located near the surface of SPNPs, HSPNPs, and HFSPNPs, leading to an initial burst release, while siRNA located inside HFSPNPs underwent sustained release. These results suggest that HFSPNPs have potential application as sustained-release carriers for siRNA. Sustained release can reduce siRNA release before reaching the pathological site while increasing the duration of action of siRNA.

[0086] Example 2: Study on the in vitro uptake characteristics and antitumor activity of nanoparticles 1. Main experimental materials The cells used in this embodiment are the same as those in Example 1.

[0087] The siRNA used in this study FAMIts nucleotide sequence is the same as that of siRNA, the only difference being that it carries a fluorescent label, and it also comes from Suzhou Jima Gene Co., Ltd.

[0088] The meaningful strand of the siBMP2 S1 sequence is GGAUGACUGAGUACCUGAATT, and the antisense strand is UUCAGGUACUCAGUCAUCCTT; the meaningful strand of the S2 sequence is TGTCTTCTAGCGTTGCTGCTT, and the antisense strand is TGCCTTTCCAGGGATGCCAA. Both the S1 and S2 sequences were obtained from Suzhou Genomics Co., Ltd.

[0089] 2. Main Experimental Methods 2.1 Investigation of Cellular Uptake Characteristics of Gene-Loaded Nanoparticles 2.1.1 Quantitative Investigation by Flow Cytometry SMMC-7721 cells were seeded in 6-well plates, with approximately 1 x 10⁻⁶ cells per well. 6 After 24 hours of culture, the cells were cultured until the cell proliferation rate reached 70%. The culture medium was then discarded, and the cells were incubated with a solution free of siRNA. FAM siRNA FAM / SPNPs, siRNA FAM / HSPNPs and siRNA FAM / HFSPNPs were taken up in serum-free medium for 4 h. After takeup, the cells were washed with PBS, digested with trypsin, centrifuged, and collected. They were then repeatedly pipetted and separated with PBS to remove residual and unextracted drugs. After resuspending the cells, the expression of FAM was determined by flow cytometry.

[0090] 2.1.2 Confocal microscopy (CLSM) was used to examine the intracellular localization of siRNA. LO2 cells were seeded onto a 10 mm glass substrate (1×10⁻⁶ cells / year). 6 Incubate the culture medium (in each well) for 24 hours until it adheres to 70% of the glass substrate. Discard the old culture medium and add culture medium containing free siRNA. FAM siRNA FAM / SPNPs, siRNA FAM / HSPNPs and siRNA FAMSerum-free culture medium was taken up from / HFSPNPs at 1 h, 2 h, and 4 h. After takeup, the cells were washed with PBS, and 1 mL of 4% paraformaldehyde (10 mg / mL) was added to each well and incubated at room temperature in the dark for 10 min. After rinsing three times with PBS, 1 mL (10 mg / mL) of Hoechst 33258 solution was added, and nuclear staining was performed at 37 °C in the dark for 15 min. The cells were then rinsed with PBS, mounted with an anti-fluorescence quencher, and finally photographed and analyzed under CLSM.

[0091] 2.1.3 Competitive inhibition experiment of FA and HA dual receptors To investigate the effects of FA and HA receptors on the self-assembled dual-target nanoparticle siRNA FAM The influence of / HFSPNPs on cellular uptake was investigated using HA-FA polymers, free FA, and free HA as receptor inhibitors, employing conventional methods to explore how their presence affects siRNA. FAM The uptake of / HFSPNPs in SMMC-7721 cells was observed and analyzed using CLSM.

[0092] 2.2 Investigation of siBMP2 in vitro transfection efficiency 2.2.1 Western blotting for screening effective sequences By analyzing the BMP2 mRNA sequence, two different siRNAs were constructed in order to find a siBMP2 sequence that could provide superior silencing performance. SMMC-7721 cells were transfected using Lipofectamine 2000, and the expression of BMP2 protein was detected by Western blotting. The siRNA-NC group was set as the negative control group, and the siRNA-β-actin group was set as the positive control group.

[0093] SMMC-7721 cells in the logarithmic growth phase were seeded into 6-well plates, maintaining a cell count of approximately 1 × 10⁶ cells per well. 6Transfection was performed in 6-well plates when the cell-to-plate confluence reached 50% after 24 hours of culture. siRNA and Lipofectamine 2000 were mixed and incubated at room temperature for 15 minutes, then stored for later use. The original cell culture medium was replaced, and the siRNA and Lipofectamine 2000 mixture was added. The 6-well plates were transferred to a CO2 incubator and cultured for 6 hours. Then, serum-containing medium was used, and transfection was performed for 48 hours. After transfection, Western blotting was used to assess the downregulation of BMP2 protein expression by different groups using siRNA.

[0094] 2.3 Cell viability assay The conventional method was used.

[0095] 2.4 Data Processing Same as Example 1.

[0096] 3. Experimental Results 3.1 Analysis of Cellular Uptake Characteristics 3.1.1 SMMC-7721 cell uptake of siRNA according to Figure 12 It can be seen that siRNA FAM / SPNPs group and siRNA FAM The uptake of siRNA did not change significantly in the HSPNPs group. This is mainly because SPNPs have a stronger positive charge, which can better promote cellular uptake, while HSPNPs can more accurately target the HA receptor, thereby increasing the uptake rate of siRNA. There was no significant difference between the two groups. After 4 hours of uptake, the dual-targeting siRNA... FAM The fluorescence intensity of / HFSPNPs was significantly improved, reaching 1.82 and 1.34 times that of the siRNAFAM / SPNPs group and the siRNAFAM / HSPNPs group, respectively. This indicates that the application of self-assembled dual-target nanoparticles siRNAFAM / HFSPNPs can significantly enhance the uptake of siRNA by SMMC-7721 cells.

[0097] 3.1.2 Intracellular localization of siRNA Green fluorescence indicates the loading of siRNA. FAM Self-assembled nanoparticles can be delivered into LO2 cells. For example... Figure 13 As shown, siRNA FAM The cellular uptake of / HFSPNPs is time-dependent; as time progresses, the nanoparticles gradually accumulate in the cells, thereby exerting a therapeutic effect.

[0098] 3.1.3 Dual receptor inhibition status After incubation for 4 hours, if Figure 14 As shown, LO2 cells treated with different self-assembled nanoparticles exhibited significantly higher performance than those treated with free siRNA. FAM The intensity of green fluorescence in the treated cells, and siRNA FAM / The HFSPNPs group showed the deepest green fluorescence intensity. Similar results were observed in SMMC-7721 cells. More importantly, compared with siRNA... FAM SPNPs and siRNA FAM Compared to / HSPNPs, siRNA FAM / HFSPNPs have higher accumulation efficiency, which may be due to the high affinity of HFSPNPs for HA and FA.

[0099] 3.2 Evaluation of in vitro transfection efficiency 3.2.1 Valid sequence screening status according to Figure 15 The screening results showed that the expression level of BMP2 protein transfected with the S1 sequence was significantly reduced, with a silencing efficiency of up to 50%. Therefore, the S1 sequence (Sense: GGAUGACUGAGUACCUGAATT, Antisense: UUCAGGUACUCAGUCAUCCTT) was used in this experiment in order to obtain more effective tumor treatment results.

[0100] 3.2.2 Downregulation of BMP2 efficiency by different nanoparticles according to Figure 16 The results showed no significant difference in transfection efficiency between siBMP2 / HSPNPs and siBMP2 / SPNPs. However, the BMP2 protein level in the dual-target coating group was significantly reduced, indicating that dual-target coating can effectively improve the transfection efficiency of nanoparticles.

[0101] 3.2.3 siBMP2 downregulation of BMP2 protein expression according to Figure 17 The data show that the expression level of BMP2 protein in SMMC-7721 cells exhibits a certain downward trend, and this change is significantly dependent on the concentration. When the concentration is 200 nM, the protein silencing efficiency can reach 70.4%.

[0102] 3.3 Cell viability assay like Figure 18As shown, SMMC-7721 cells were divided into free siRNA and NPs groups and subjected to scratch treatment. After co-incubation with SMMC-7721 liver cancer cells for 24 h, the scratched cell coverage area of ​​the free siRNA group was significantly larger than that of the NPs group. Furthermore, the siRNA / HFSPNPs group still showed significant scratches compared to the siRNA / SPNPs and siRNA / HSPNPs groups, indicating that the self-assembled dual-target nanoparticles possess a strong ability to inhibit cell migration. Example 3: Study on the in vivo targeting and in vivo antitumor pharmacodynamics of nanoparticles 1. Main experimental materials The cells used in this embodiment are the same as those in Example 1.

[0103] The experimental animals used in this embodiment were SPF-grade 4-6 week old female C57BL / 6 mice, which were housed in the Animal Laboratory of Traditional Chinese Medicine at Heilongjiang University of Traditional Chinese Medicine.

[0104] 2. Main Experimental Methods 2.1 Establishment of a tumor-bearing mouse model A mouse xenograft model was established using SMMC-7721 cells following standard methods. The model establishment process is as follows: Figure 19 As shown.

[0105] 2.2 Evaluation of the in vivo targeting ability of nanoparticles 2.2.1 Preparation of Dir-nanoparticles with fluorescent labeling During the preparation of SPNPs, Dir was added and the probe was sonicated. After rotary evaporation of the organic solvent, the mixture was filtered to obtain Dir / SPNPs, with a Dir concentration of 1 mg / mL. Dir / HSPNPs and Dir / HFSPNPs were then obtained by coating with HA and HA-FA.

[0106] 2.2.2 In vivo targeting of nanoparticles using three-dimensional in vivo imaging technology in small animals 24 h and 48 h after drug administration, mice that had successfully modeled tumors were intravenously injected with 0.1 mL of Dir / SPNPs, Dir / HSPNPs, and Dir / HFSPNPs. Using three-dimensional in vivo imaging technology, the distribution of Dir-labeled nanoparticles in tumor-bearing mice was clearly captured.

[0107] 2.3 In vivo pharmacodynamic experiments of nanoparticles 2.3.1 Grouping and Administration The tumor volume increased to (100 ± 20) mm. 3As a signal for in vivo targeted experiments, after modeling was completed, C57BL / 6 mice were randomly divided into 4 groups of 5 mice each. The mice were further divided into a control group (CG), and groups receiving siBMP2 / SPNPs, siBMP2 / HSPNPs, and siBMP2 / HFSPNPs (each preparation diluted to 0.33 mg / mL with PBS for later use). Each mouse received 0.1 mL via tail vein injection. Administration was repeated every two days for 4 consecutive times. After the fourth administration, the mice were fasted for 8 hours and euthanized, and the CG mice were injected with an equal volume of PBS.

[0108] 2.3.2 General Information for Each Group Following injection of SMMC-7721 liver cancer cells, C57BL / 6 mice were weighed every two days. Successful modeling was achieved 6 days after cell injection. Subsequently, drugs were administered according to groupings, and tumor volume was measured and recorded every two days. After the fourth administration, detailed data analysis was performed on tumor volume, growth inhibition rate, and development trend to reveal their patterns. The tumor growth inhibition rate was calculated using the formula (1-TVt / TVc)×100%, where TVt represents the tumor volume in the treated group and TVc represents the tumor volume in the control group. After sacrifice, tumor tissue and major organs were dissected, and the separated tumor fragments were weighed and recorded. Other major organs and tumors were used for subsequent experiments.

[0109] 2.3.3 Western blotting was used to examine the expression of BMP2 protein in tumor tissue. Sufficient tumor samples were collected from mice and placed in EP tubes. PMSF cell lysis buffer was added, and the samples were cut into fragments using small scissors. The fragments were then sonicated for 30 seconds, separated on ice for 45 minutes, and finally centrifuged at 12000 rpm and 4 °C for 10 minutes. The supernatant was transferred to clean EP tubes to obtain the protein supernatant from the tumor samples. Western blotting was then used to conduct further research following the aforementioned experimental procedures.

[0110] 2.4 Immunogenicity Study of Nanoparticles Twenty-four hours after the first administration of medication, 0.5 mL of blood was drawn from a vein below the eye for later use. The whole blood sample was incubated at room temperature for 2 hours, then centrifuged at 1000 rpm for 20 minutes. The supernatant was collected in a new centrifuge tube. Next, using the instructions for the Mouse IL-12 and TNF-α Enzyme-Linked Immunosorbent Assay Kit, absorbance was measured at 450 nm using a microplate reader and compared with a standard curve to determine the concentration of inflammatory factors in the blood.

[0111] 2.5 HE staining of major organs and tumor tissues The conventional method was used.

[0112] 2.6 Data Processing Same as Example 1.

[0113] 3. Experimental Results 3.1 Results of in vivo targeting study according to Figure 20 As can be seen, Dir / HFSPNPs exhibit superior targeting compared to other self-assembled nanoparticles, enabling more precise localization to tumor tissue. Furthermore, significant fluorescence was observed at the tumor site after 24 hours, and the number of nanoparticles showed an increasing trend after 48 hours. This study demonstrates that HA-FA-coated dual-target self-assembled nanoparticles possess significant tumor targeting capabilities, effectively delivering more siBMP2 to tumor tissue, thereby achieving excellent therapeutic effects.

[0114] 3.2 Body weight results Mouse weight changes as follows Figure 21 As shown, body weight remained constant throughout the tumor modeling process. However, after administration, the rate of weight gain generally began to decline, except for CG. Tumor volume remained constant on day 7, but changed after the second administration. siBMP2 / HFSPNPs exhibited tumor inhibition before the completion of the entire administration process, suggesting that siBMP2 / HFSPNPs can more effectively prevent tumor growth.

[0115] 3.3 Changes in tumor quality like Figure 22As shown, the isolated tumor tissues were weighed. The CG tumor tissue was the heaviest, with an average weight of 2.30 g. Compared with the siBMP2 / HSPNPs group, the siBMP2 / SPNPs group was heavier, with an average weight of 1.69 g, while the siBMP2 / HSPNPs group had an average weight of 1.25 g. The siBMP2 / HFSPNPs group had the lightest tumor tissue, weighing 0.64 g. These results indicate that siBMP2 / HFSPNPs nanoparticles can significantly inhibit the proliferation of hepatocellular carcinoma SMMC-7721 cells in C57BL / 6 mice.

[0116] 3.4 BMP2 protein expression level in tumor tissue according to Figure 23 The HA-FA encapsulation of dual-target nanoparticles significantly enhanced the protein silencing performance of siBMP2, far exceeding that of single-target nanoparticles encapsulated solely by HA. Due to the stronger targeting ability of the dual-target gene vector, siBMP2 can be more effectively transported to tumor tissues, inhibiting BMP2 protein expression and thus exerting an anti-cancer effect.

[0117] 3.5 Nanoparticle Immunogenicity Study according to Figure 24 The experimental results showed that when siRNA was delivered to mice via HFSPNPs, its effect on the two immune factors TNF-α and IL-12 was very limited, indicating that it had no significant effect on the mouse immune system. Delivery to mice via SPNPs and HFSPNPs increased the expression levels of TNF-α and IL-12 in the blood compared to delivery via HFSPNPs, but no significant changes were observed, indicating that the immunogenicity of siRNA was not affected.

[0118] 3.6 HE staining results of major organs and tumor tissues like Figure 25 and Figure 26 As shown, different nano-formulations exhibited varying in vivo safety profiles. Tumor-bearing mice treated with siBMP2 / SPNPs, siBMP2 / HSPNPs, and siBMP2 / HFSPNPs did not show substantial damage to the heart, liver, spleen, lungs, or kidneys, except for tumor tissue, demonstrating the good in vivo safety of siBMP2 / HFSPNPs.

[0119] Obviously, the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make various modifications and variations to the present invention without departing from the spirit and scope of the invention. Therefore, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention also intends to include these modifications and variations.

Claims

1. A modified cationic safflower polysaccharide nanocarrier, characterized in that: The nanocarrier is a self-assembled nanoparticle prepared by combining a modified cationic safflower polysaccharide base carrier with a therapeutic gene through electrostatic adsorption. The nanoparticle has a particle size of 100-200 nm.

2. The nanocarrier according to claim 1, characterized in that: The modification is a dual-target modification of hyaluronic acid and folic acid, the therapeutic gene is siRNA-BMP2, and the cationic safflower polysaccharide is prepared by amination reaction of safflower polysaccharide and polyethyleneimine. Preferably, the mass ratio of safflower polysaccharide to polyethyleneimine is 1:

2.

3. The nanocarrier according to claim 2, characterized in that: Hyaluronic acid and folic acid are covalently bonded through an esterification reaction to form a polymer, which is then wrapped around the cationic safflower polysaccharide to obtain a modified cationic safflower polysaccharide-based carrier. Preferably, the mass ratio of hyaluronic acid to folic acid is 1:

2.

4. The nanocarrier according to claim 1, characterized in that: The P / N ratio of the therapeutic gene to the basic vector is 5:1-20:

1.

5. The method for preparing the nanocarrier according to any one of claims 1 to 4, characterized in that: The preparation method includes the following steps: Step 1: Preparation of hyaluronic acid-folic acid polymer: Hyaluronic acid and folic acid are covalently bonded through esterification reaction in the presence of dicyclohexylcarbodiimide and N-hydroxysuccinimide to form a polymer. Step 2: Preparation of the basic carrier: Cationic safflower polysaccharide was prepared by amination of safflower polysaccharide and polyethyleneimine. Under stirring conditions, the cationic safflower polysaccharide solution was slowly added to the hyaluronic acid-folic acid polymer solution prepared in Step 1. The basic carrier with high dispersibility was prepared by dialysis-ultrasonic treatment. Step 3: Preparation of modified cationic safflower polysaccharide nanocarrier: The therapeutic gene is added to the basic carrier solution, and the modified cationic safflower polysaccharide nanocarrier is prepared under electrostatic action.

6. The preparation method according to claim 5, characterized in that: Step 1 specifically includes the following steps: folic acid is added to an appropriate amount of DMSO solution and stirred at room temperature for 20-40 min to make it completely dissolved. Then, an appropriate amount of a mixture of dicyclohexylcarbodiimide and N-hydroxysuccinimide is added and placed in an environment of 25-35°C for continuous activation for 4-6 h to remove the precipitate generated during activation. Hyaluronic acid is added to an appropriate amount of formamide aqueous solution and stirred at 30-50°C to dissolve it. During this process, the activated folic acid solution is added dropwise to the hyaluronic acid solution and reacted in the dark for 40-55 h to remove the precipitate generated. The liquid from which the precipitate has been removed is dialyzed with deionized water in the dark and then freeze-dried to obtain the hyaluronic acid-folic acid polymer.

7. The preparation method according to claim 5, characterized in that: Step 2 specifically includes the following steps: preparing the hyaluronic acid-folic acid polymer into a solution, slowly adding the cationic safflower polysaccharide solution into the hyaluronic acid-folic acid polymer solution, and magnetically stirring for 10-20 min. Dissolving the prepared nanoparticles in DMSO and stirring continuously at room temperature and 800-1200 rpm for 1.5-2.5 h, then slowly adding them to deionized water, dialyzing with DMSO, and then sonicating for 2-5 min to prepare the basic carrier with high dispersibility.

8. The preparation method according to claim 5, characterized in that: Step 3 specifically includes the following steps: adding the therapeutic gene to the base carrier solution, obtaining self-assembled nanoparticles under electrostatic action, removing the free therapeutic gene by centrifugation at 2500-3500 rpm for 10-20 min, and freeze-drying to obtain the modified cationic safflower polysaccharide nanocarrier, wherein the P / N ratio of the therapeutic gene to the base carrier is 5:1-20:

1.

9. The use of the nanocarrier according to any one of claims 1 to 4, or the nanocarrier prepared by the preparation method according to any one of claims 5 to 8, in the preparation of a drug for treating cancer.

10. The use according to claim 9, characterized in that: The cancer in question is liver cancer.

Images