OsRPM1 and its encoding protein and application

Abstract

This invention provides a novel gene, OsRPM1, that regulates rice panicle shape and promotes yield increase through mutation, along with its encoded protein and applications. This novel gene regulates rice panicle development. OsRPM1 The gene sequence number is Os03g0285100, and its CDS sequence is 378 bp long, encoding a protein of 125 amino acids. This invention is the first to discover and demonstrate this. OsRPM1 It is a novel gene that negatively regulates panicle development and yield increase in rice. It was knocked out using genetic engineering methods. OsRPM1 This invention can increase the number of rice branches and the yield of rice. It contributes to the study of the molecular mechanisms of rice panicle development and has great application potential for breeding high-yielding rice varieties with excellent plant structure. Furthermore, it accumulates valuable genetic resources and theoretical foundations for breeding new high-yielding rice varieties.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically involving the cloning, editing, and functional identification of a new gene OsRPM1 that regulates rice panicle shape and mutant yield increase. Background Technology

[0002] Rice (Oryza sativa L.) is one of the world's most important food crops, providing staple food for approximately 20% of the world's population. However, with the rapid growth of the world's population, there is an urgent need to increase rice production to meet people's food demands. Panicle development is an important inflorescence branching phenomenon during the reproductive growth and development of rice. The number of branches directly determines the number of grains per panicle and the seed setting rate, thus affecting rice yield. Therefore, cloning genes related to rice panicle development and studying its molecular mechanisms has always been a focus of scientific research.

[0003] Rice panicle development is regulated by genetic material, hormones, and environmental signals. Although some genes have been reported to play a role in panicle development, the discovery of genes regulating panicle development and rice yield is currently limited, and related patents are scarce. Therefore, cloning and identifying new genes regulating rice panicle development is crucial. The research results will not only reveal the molecular mechanisms regulating rice panicle development but also provide theoretical guidance for creating new rice varieties with ideal panicle shapes and high yields, and have significant practical application prospects. Summary of the Invention

[0004] The purpose of this invention is to provide a novel gene for regulating rice panicle shape and yield increase, namely OsRPM1, including cloning, editing, and functional analysis, thus providing a theoretical basis and important gene resources for constructing multi-branched rice and improving grain yield. To solve the above-mentioned technical problems, the technical solution adopted in this invention is as follows.

[0005] This invention proposes a novel gene, OsRPM1, for regulating rice panicle shape and increasing yield through mutation, which can be applied to improve rice yield. The nucleotide sequence length of OsRPM1 is 4264 bp. The amino acid sequence encoded by the gene OsRPM1, which regulates rice panicle development, is 125 AA in length.

[0006] The present invention also provides a gene editing vector containing the above-mentioned gene OsRPM1 that regulates rice panicle development, as well as a gene editing engineered bacterium.

[0007] This invention also provides a method for functional identification of the above-mentioned gene OsRPM1 that regulates rice panicle development, comprising the following steps:

[0008] S1: The three target sequences of the rice panicle shape gene OsRPM1 were cloned into CRISPR / Cas9 gene editing vectors to obtain the OsRPM1-CRISPR / Cas9-1 / 2 / 3 vectors;

[0009] S2: Gene-editing vectors were used to infect rice plants with Agrobacterium-mediated transformation to obtain gene-edited plants;

[0010] S3: Cultivate the seeds of gene-edited plants to maturity, observe, record, and analyze their agronomic traits, including the number of primary branches, the number of secondary branches, the number of spikelets, and the yield.

[0011] Furthermore, S1 specifically includes the following steps:

[0012] Three pairs of primers targeting the target sequences were designed: OsRPM1-1-cas9-F (as shown in SEQ ID NO.1); OsRPM1-1-cas9-R (as shown in SEQ ID NO.2); OsRPM1-2-cas9-F (as shown in SEQ ID NO.3); OsRPM1-2-cas9-R (as shown in SEQ ID NO.4); OsRPM1-3-cas9-F (as shown in SEQ ID NO.5); and OsRPM1-3-cas9-R (as shown in SEQ ID NO.6). After primer synthesis, primer annealing was performed. The annealed products were ligated into the q-sg digested vector using T4 ligase and transformed into *E. coli* Top10 using the heat shock method. Strains that tested positive by colony PCR were selected, cultured in a shaking culture to expand their propagation, and then sequenced. After sequencing, strains with correctly inserted q-sg at the target site were selected, and the q-sg plasmid was extracted. The q-Cas9 plasmid and q-sg plasmid were subjected to LR reaction. 2 µL of the LR reaction product was taken and transformed into Top 10 competent cells by heat shock method. After being identified as a positive strain by colony PCR, the cells were sent for sequencing after shaking. The sequencing results correctly obtained the OsRPM1-CRISPR / Cas9-1 / 2 / 3 vector strain.

[0013] Furthermore, the colony PCR primers include: U3F as shown in SEQ ID NO.7 and the R sequence of each target sequence.

[0014] The CRISP / Cas9 gene editing vector was transformed into Agrobacterium EHA105 using the heat shock method. The steps of Agrobacterium-mediated genetic transformation of rice seeds are as follows: callus induction – Agrobacterium activation – Agrobacterium infection of callus – sterilization and hygromycin (Hyg) resistance screening – differentiation – hardening and transplanting.

[0015] Furthermore, S2 also includes molecular identification of the gene-edited plants.

[0016] Molecular identification methods specifically include the following steps:

[0017] After initial screening with hygromycin (Hyg), genomic DNA was extracted from plants that showed potential positive results.

[0018] Specific amplification primers were designed within a 500 bp range upstream and downstream of the target site, and the amplified fragment containing the target site was sequenced.

[0019] The specific amplification primers designed for the different target sites are as follows: Target site 1: OsRPM1-1-DNA-F, as shown in SEQ ID NO. 8; OsRPM1-1-DNA-R, as shown in SEQ ID NO. 9. The identification primers for target sites 2 and 3 are the same: OsRPM1-2 / 3-DNA-F, as shown in SEQ ID NO. 10; OsRPM1-2 / 3-DNA-R, as shown in SEQ ID NO. 11.

[0020] The sequencing results were compared with the wild-type sequence using DNAMAN software, and the mutation type was analyzed using BioEdit software.

[0021] Furthermore, transgenic positive seedlings were cultured in S3 up to the T2 generation. Then, agronomic traits were observed, recorded, and analyzed, including the number of plant branches, the number of grains per ear, and yield. The specific steps were as follows:

[0022] Gene-edited rice plants with a Nipponbare background and wild-type Nipponbare plants, as well as gene-edited rice plants with a 3477 background and wild-type 3477 plants, were planted in containers and fields and cultured under the same conditions until maturity. The differences in agronomic traits between transgenic and wild-type plants were observed, photographed, and measured, including the number of rice branches and the yield.

[0023] The beneficial effects of the invention are:

[0024] The novel gene OsRPM1, which regulates rice panicle development, is the first gene identified in rice that can regulate panicle development and affect rice yield. Its gene number is Os03g0285100, and its CDS is 378 bp, encoding a 125-amino acid protein. Comparison between gene-edited rice plants and wild-type rice revealed that mutations in the OsRPM1 gene promote branch development, increase the number of grains per panicle, and thus increase rice yield. Its application in the field of rice genetic engineering has significant economic value and promising prospects. This novel mutant yield-increasing gene can be widely applied in rice breeding, creating new rice varieties with OsRPM1 gene mutations through gene editing or mutagenesis breeding. Specific application methods include, but are not limited to, constructing transgenic expression vectors, Agrobacterium-mediated transformation, and gene editing techniques for genetic improvement of rice. Attached Figure Description

[0025] Figure 1 The image shows the electrophoresis pattern of the PCR product of OsRPM1 in Example 1 of this invention on an agarose gel, clearly displaying the band characteristics of the amplified product and providing intuitive evidence of successful gene cloning.

[0026] Figure 2 This is a predicted diagram of the conserved domains of the OsRPM1 protein in Example 1 of the present invention. The transmembrane structure of OsCRP1 was analyzed using the SMART website to accurately delineate the functional domain architecture of the protein, which helps to analyze the molecular basis of gene function.

[0027] Figure 3 This is a flowchart of Agrobacterium-mediated rice genetic transformation in Example 3 of the present invention, which comprehensively summarizes the transformation process.

[0028] Figure 4-5 The image shows T0 positive plants from different backgrounds (Japonica rice Nipponbare and Indica rice 3477) in Example 3, visually displaying the editing sites and mutation details, laying a solid foundation for evaluating gene editing effects. The complex procedure provides a standard workflow guide for genetic transformation operations. Figure 4 China OsRPM1 A schematic diagram of the gene model and CRISPR / Cas9 editing sites 1 and 3. Red downward arrows indicate gRNA target sites, red letters indicate deleted and / or inserted nucleotides, and red upward arrows indicate changes in the amino acid sequence of the mutant. Figure 5 China OsRPM1 A schematic diagram of the gene model and CRISPR / Cas9 editing sites 2 and 3. Red downward arrows indicate gRNA target sites, red letters indicate deleted and / or inserted nucleotides, and red upward arrows indicate changes in the amino acid sequence of the mutant.

[0029] Figure 6-7 The images show a comparison of plant type (a) and panicle type (b) of OsRPM1 gene-edited plants and their corresponding wild-type plants under different backgrounds (Japonica rice Nipponbare and Indica rice 3477) in Example 4 of this invention. The morphological differences are clearly presented, highlighting the effect of OsRPM1 on shaping the appearance of rice panicles.

[0030] Figure 8-9 The comparative diagram of multiple agronomic traits (ear, branches, yield, etc.) in Example 4 of the present invention includes ear morphology (a), spikelet (b), ear length (c), number of primary branches (d), number of secondary branches (e), number of spikelets (f), and yield per plant (g), which quantitatively reveals the advantages of the edited plant and strongly confirms the yield-increasing potential of gene editing. Figure 8 for OsRPM1 Comparison of panicle type between gene-edited plants and their corresponding Nipponbare wild-type rice. (a) Panicle type and wild type Nip , OsRPM1 Spikelet corresponding to the mutant line (b). (a) Scale bar, 5 cm. (b) Scale bar, 2 cm. (c) to (g) Nip , osrpm1-1 and osrpm1-3a Comparison of spike length (c), number of primary branches (d), number of secondary branches (e), number of spikelets per spike (f), and yield per plant (g). Values ​​are expressed as mean ± SD (n=17). Different letters indicate statistically significant groups with p < 0.05. Figure 9 for OsRPM1 Comparison of the panicle type of gene-edited plants and their corresponding wild-type 3477 rice. (a) Panicle and spikelets corresponding to wild-type 3477 and OsRPM1 mutant lines (b). (a) Scale bar, 5 cm. (b) Scale bar, 2 cm. (c) to (g) 3477 , osrpm1-1 and osrpm1-3a Comparison of spike length (c), number of primary branches (d), number of secondary branches (e), number of spikelets per spike (f), and yield per plant (g). Values ​​are expressed as mean ± SD (n=17). Different letters indicate statistically significant groups with p < 0.05.

[0031] Figure 10 This is a diagram illustrating the regulation of inflorescence and related gene expression by the OsRPM1 gene in Example 5 of the present invention, providing in-depth analysis of the gene action mechanism and offering core evidence for elucidating the principle of yield increase. (a) 3477 and osrpm1-2 Comparison of SAM size of materials. The red line area represents the SAM region. Scale bar, 50 μm. (b) 3477 and osrpm1-2 The average SAM area (n = 9). (c) 3477 and osrpm1-2 Image of a paraffin section of the inflorescence. Red asterisks indicate primary branching meristems (PBMs). Scale bar, 100 µm. (d) 3477 and osrpm1-2 The average number of PBMs (n = 15). (ek) 3477 , osrpm1-2 and osrpm1-3b The relative expression levels of genes related to panicle development regulation in young panicles (1 mm) were determined. RT-qPCR analysis was performed on 1 mm young panicles from three biological replicates (n=3) using rice ACTIN1 as an internal control. Values ​​are expressed as mean ± SD. Different letters indicate p < 0.05 as statistically significant. Detailed Implementation

[0032] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0033] This invention provides a novel gene, OsRPM1, for regulating rice panicle development, with the gene sequence number Os03g0285100 and a nucleotide sequence length of 4264 bp. The CDS of OsRPM1, a novel gene for regulating rice panicle development, is 378 bp long and encodes a 125-amino acid protein. Studies have shown that mutations in this gene can promote rice shoot development and increase rice yield.

[0034] Its nucleotide sequence length is 4264 bp.

[0035] The novel gene OsRPM1, which negatively regulates rice panicle development, has a CDS length of 378 bp and encodes a protein of 125 amino acids.

[0036] This invention also provides a method for functional identification of OsRPM1, a novel gene regulating rice panicle development, comprising the following steps:

[0037] S1: The target sequence of OsRPM1, a novel gene negatively regulating rice panicle development, was cloned into a CRISR / Cas9 gene editing vector to obtain the OsRPM1-CRISR / Cas9 gene editing vector. The specific steps for constructing and transforming the gene editing vector included: designing a target sequence based on the CDS sequence of OsRPM1. The target site was defined as the first 20 bases of PAM. The forward primer for the target sequence was the target site sequence plus a BsaI restriction site, and the reverse primer was the reverse complement of the target site sequence plus a BsaI restriction site. The target sequence was ligated into the q-sg vector and transformed into *E. coli* Top10. The q-Cas9 plasmid and q-sg plasmid were subjected to a logarithmic reaction (LR) and transformed into Top10 competent cells using the heat shock method. After identification as a positive strain by colony PCR, the cells were shaken and sequenced. The sequencing results correctly yielded the OsRPM1-CRISPR / Cas9-1 / 2 / 3 vector strains.

[0038] The target sequence primer sequences mentioned above include: OsRPM1-1-cas9-F (SEQ ID NO.1): GGCAGCTGGGCTCCGGGAGATTCT; OsRPM1-1-cas9-R (SEQ ID NO.2): AAACAGAATCTCCCGGAGCCCAGC; OsRPM1-2-cas9-F (SEQ ID NO.3): GGCAAATGGATACTCGCTGCGTCG; OsRPM1-2-cas9-R (SEQ ID NO.4): AAACCGACGCAGCGAGTATCCATT; OsRPM1-3-cas9-F (SEQ ID NO.5): GGCATCGGACTTGTCCACAACATT; OsRPM1-3-cas9-R (SEQ ID NO.6): AAACAATGTTGTGGACAAGTCCGA.

[0039] The colony PCR primers include: U3F and the R sequence of each target sequence, 3F (SEQ ID NO.7): GGCGTCTTCTACTGGTGC.

[0040] S2: Rice is infected with a gene-editing vector using Agrobacterium-mediated transformation to obtain gene-edited transgenic plants (Agrobacterium-mediated transformation is Agrobacterium EHA105); then, the gene-edited transgenic plants are subjected to molecular identification; wherein, the molecular identification method includes the following steps:

[0041] A small piece of fresh plant leaf was cut and placed on a culture medium containing hygromycin. The plant was then placed in a tissue culture room. After three days, the leaves remained green; those turning yellow indicated potential positive plants. DNA was extracted from the potential positive plants and amplified by PCR. Specific amplification primers were designed within a 500 bp range upstream and downstream of the target site, and the amplified fragment containing the target site was sequenced.

[0042] The specific amplification primers designed for different target sites were as follows: Target site 1: OsRPM1-1-DNA-F (SEQ ID NO. 8): GCACGGGAGGCGATTT; OsRPM1-1-DNA-R (SEQ ID NO. 9): AACCACCGCTAAGGGCTA. The identification primers for target sites 2 and 3 were the same: OsRPM1-2 / 3-DNA-F (SEQ ID NO. 10): ATGTGGATTTATCTTGGGATC; OsRPM1-2 / 3-DNA-R (SEQ ID NO. 11): TTCTTCAGTTACTTGGGTGG. Sequencing results were compared with wild-type sequences using DNAMAN software, and mutation types were analyzed using BioEdit software.

[0043] S3: Take an appropriate amount of gene-edited plant seeds and wild-type seeds, culture them until they have four leaves and one heart, then transfer them to a large container to continue culturing until maturity. Observe, photograph, and measure the differences in agronomic traits between transgenic plants and wild-type plants, including the number of rice branches, the number of grains, and the yield.

[0044] The features and performance of the present invention will be further described in detail below with reference to embodiments.

[0045] Example 1

[0046] This embodiment provides a cloning method for OsRPM1, a novel gene that negatively regulates rice panicle development, including the following steps:

[0047] (1) Preparation of materials: rice varieties and Escherichia coli TOP10. The rice varieties were used for RNA extraction. The original strains of rice varieties and Escherichia coli TOP10 were provided by the Key Laboratory of Crop Sterile Germplasm Resources Innovation and Application in Hunan Province.

[0048] (2) Cloning and transformation of a new gene OsRPM1 that negatively regulates rice panicle development. According to the annotation information of OsRPM1 (NCBI Reference Sequence: XP_015627951.1), its CDS is 375 bp long and encodes 125 amino acids. A pair of specific primers, OsRPM1-F: ATGGATACTCTGCTGGGCTCC and OsRPM1-R: GGGTGGAACAACTATTGT, were designed using the NCBI online website.

[0049] Rice seedlings at the three-leaf-one-heart stage were used to extract total RNA using the TRIZOL method, which was then reverse transcribed into cDNA and used as a template for PCR reaction.

[0050] PCR products were detected and purified by 1.2% agarose gel electrophoresis (e.g., ...). Figure 1 (As shown).

[0051] The cloned novel gene OsRPM1, which negatively regulates rice branch development, has a CDS length of 375 bp and encodes a 125-amino acid protein. The OsRPM1 protein diagram, including transmembrane analysis and conserved domain predictions from the TMHMM and SMART websites, accurately delineates the protein's functional domain architecture, aiding in the analysis of the gene's functional molecular basis. The structure of the OsRPM1 protein was analyzed using the TMHMM and SMART websites, and its conserved domain prediction diagram is shown below. Figure 2 As shown. From Figure 2 It can be seen that the protein contains two low complexity domains (LCR) and one transmembrane domain.

[0052] PCR reaction system for amplifying the OsRPM1 gene (10 µL): ddH2O 4 µL; 2X Rapid Taq Master Mix 5 µL; F primer 0.5 µL; R primer 0.5 µL; cDNA template 1 µL.

[0053] The PCR cycling reaction was as follows: 95℃ (pre-denaturation), 5 min, 1 cycle; 95℃ (denaturation), 30 s, 32 cycles; 56℃ (annealing), 30 s, 32 cycles; 72℃ (extension), 30 s, 32 cycles; 72℃ (final extension), 10 min, 1 cycle; 4℃ (hold).

[0054] Example 2

[0055] This embodiment provides a method for constructing CRISR / Cas9 gene editing vectors, including the following steps:

[0056] (1) Design of target sequence primers: The target site refers to the first 20 bases of PAM. The OsCRP1 gene number or protein-coding sequence from the NCBI database is input into CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR / ). The system will prioritize the target sites of the gene and select the two highest priority target sites as candidate target sites. The conservation of the two candidate target sites is verified using Blast (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) in the NCBI database. The principle for selecting candidate target sites is to be as close as possible to the start codon and to ensure high conservation. After the target sites are determined, the forward primer for the target sequence is the target site sequence plus a BsaI restriction site, and the reverse primer is the reverse complement of the target site sequence plus a BsaI restriction site. The primers are synthesized by Qingke Company.

[0057] (2) Primer annealing: The primers were briefly separated, then ddH2O was added to dilute the primers to 10 µM. 5 µL of each of the diluted forward and reverse primers were added to a PCR tube and mixed thoroughly. The tubes were then placed in a PCR instrument for annealing. The annealing program was as follows: Lid 40℃, 37℃ 30 min, 95℃ 5 min, 85℃ 2 min, 75℃ 2 min, 65℃ 2 min, 55℃ 2 min, 45℃ 2 min, 35℃ 2 min, 25℃ 2 min, hold 25℃. The entire process took approximately 1 hour. All 10 µL of product was then diluted with 990 µL of ddH2O to 0.1 µM. The diluted product was stored at -20℃.

[0058] (3) Overnight digestion of q-sg vector. The digestion system is as follows: ddH2O 14 µL; q-sg vector 2 µL; 10X Buffer G 2 µL; BsaI 2 µL.

[0059] The above enzyme digestion system was incubated overnight at 37°C for 10-12 h. The digestion product was then mixed with 4 µL of 6X DNA loading buffer and placed in the wells of an agarose gel for electrophoresis (TAE electrophoresis buffer must be prepared fresh for use) at 120 V for 15 min. After electrophoresis, the nucleic acid bands were detected. If a band was greater than 3000 bp, the band was correct. The gel was then cut and the nucleic acid fragments were recovered using a gel recovery kit.

[0060] (4) Ligate the q-sg vector. The 10 µL ligation system is as follows: 6 µL ddH2O; 1 µL digested q-sg vector; 1 µL T4 Buffer; 1 µL T4 ligase; 1 µL annealing product. After mixing the ligation system, incubate in a 22℃ water bath for 6-8 h.

[0061] (5) Transformation of Top 10 (heat shock method): Top 10 competent cells taken from the -80℃ ultra-low temperature freezer were placed on ice for 10 min, then the ligation product was added, and the cells were incubated on ice for 30 min. They were then heat-shocked at 42℃ for 90 s, and then placed on ice for 2 min. 200 µL of LB liquid medium was added, and the cells were incubated at 37℃ and 180 rpm for 60 min. All the bacterial culture was spread on LB solid medium containing Kan and incubated upside down in a 37℃ constant temperature incubator for 10-12 h. After that, a single colony was taken and streaked on LB solid medium containing Kan and then incubated in a 37℃ constant temperature incubator to continue to expand the cell proliferation.

[0062] (6) Colony PCR identification of positive clones: The 0 µL colony PCR identification system is as follows: ddH2O 4 µL; 2X RapidTaq Master Mix 5 µL; F primer (U3F) 0.5 µL; R primer (target sequence R primer) 0.5 µL; colony template 1 µL. PCR cycling reaction: 95℃ (pre-denaturation), 5 min, 1 cycle; 95℃ (denaturation), 30 s, 32 cycles; 56℃ (annealing), 30 s, 32 cycles; 72℃ (extension), 30 s, 32 cycles; 72℃ (final extension), 10 min, 1 cycle; 4℃ (hold). Select strains that are positive by colony PCR, culture them in a shaker to expand their propagation, and then sequence them. After sequencing, select strains that correctly insert the target site into q-sg and extract the plasmid.

[0063] (7) LR reaction: 10 µL LR reaction system: 5 µL ddH2O; 1 µL q-sg plasmid; 2 µL LR Mix; 2 µL q-Cas9 plasmid. After mixing, incubate in a water bath at 25℃ for 1-2 h, add 1 µL Protein K to stop the reaction, incubate in a water bath at 37℃ for 20 min, and store the LR reaction product at -20℃.

[0064] (8) Transformation of Top 10: Take 2 µL of LR reaction product and transform Top 10 competent cells using the heat shock method. Spread the bacterial culture on LB solid medium containing Spec and incubate upside down at 37℃ for 10-12 h. Then, take a single colony and streak it on LB solid medium containing Spec and continue to expand the colony in a constant temperature incubator at 37℃. After identifying the positive strain by colony PCR, send the culture for sequencing after shaking. If the sequencing result is correct, extract the plasmid and transform Agrobacterium EHA105. Select positive clones and store them in a freezer at -80℃ for later use.

[0065] Example 3

[0066] The examples provide an Agrobacterium-mediated rice genetic transformation method (rice genetic transformation flowchart as shown in the figure). Figure 3 (As shown), including the following steps:

[0067] (1) Induction of callus: Select 100-200 healthy, plump seeds of Nipponbare or 3477 (the background material for gene editing is Nipponbare and 3477; the background material for GUS staining is Nipponbare; the background material for the genetic transformation of the pHB vector in the two overexpression vectors is 3477, and the background material for the genetic transformation of pCUbi1390 is Nipponbare), remove the glumes, and then disinfect with 75% alcohol for 2 min in a clean bench, and wash with sterile water 3 times, 2 min each time to remove residual alcohol. Add 3% sodium hypochlorite for disinfection for 30 min, and wash with sterile water 5 times, 2 min each time to remove residual sodium hypochlorite. Dry the seeds on sterile filter paper, inoculate them on induction medium, and culture at 28℃ for 10 days, followed by subculture for 7 days.

[0068] (2) Activation of Agrobacterium: Agrobacterium strain EHA105 with the corresponding vector was activated on YEB solid medium with its corresponding resistance added, and cultured in the dark at 30℃ for 24 h. Single colony Agrobacterium was taken for secondary activation and cultured in the dark at 30℃ for 72 h.

[0069] (3) Agrobacterium infection of callus: Select an appropriate amount of Agrobacterium and add it to AAM containing 100 μM acetylsuccinone, resuspend the bacterial cells, and culture at 30℃ and 180 rpm until OD. 600The concentration was approximately 0.1. One hundred healthy callus tissue samples were selected and immersed in AAM (Agrobacterium tumefaciens) infusion solution for 5 minutes, then the AAM solution was removed. The immersed callus tissue was then placed on sterile filter paper for 30 minutes to allow it to dry. After drying, it was inoculated onto a co-culture medium, with a layer of filter paper containing 800 μL of AAM solution (without AAM) placed on top of the co-culture medium. The medium was incubated in the dark at 25°C for 3 days.

[0070] (4) Sterilization and Hygromycin (Hyg) Resistance Screening: Callus tissue co-cultured for 3 days was transferred to a 100 mL sterile Erlenmeyer flask using sterile forceps and washed 6-7 times with sterile water for 2 min each time until the sterile water became clear. Then, 400 mg / L carbenicillin (Cb) was added to the sterile water and the flask was shaken at 30°C and 180 rpm for 15 min to inhibit Agrobacterium growth. The callus tissue was placed on sterile filter paper for 30 min to dry, and then inoculated onto the selection medium containing 30 mg / L Hyg and 400 mg / L Cb. After culturing at 28°C under light for 10 days, the selection medium was replaced, and the process was repeated 3-4 times.

[0071] (5) Differentiation: Transfer the newly grown callus to the differentiation medium, culture at 28°C for 10 days, then replace the differentiation medium. Repeat 2-3 times. After the green shoots differentiate, transfer them to the rooting bottle and culture at 28°C for 10-15 days.

[0072] (6) Hardening off and transplanting: Once the material in the rooting bottle has developed roots and leaves, and the leaves have grown to the mouth of the bottle, open the cap of the rooting bottle, add sterile water, and culture at 28°C under light for about a week. After the seedlings have grown strong, transplant them into the soil and manage them with normal water and fertilizer.

[0073] (7) Initial screening: When the T0 generation plants grow to 30-40 cm, take leaves about 1 cm in length, and take wild-type leaves as a control. Place them on the initial screening plate (with 30 mg / L Hyg added) for 3-5 days and observe the leaf condition. The leaves of wild-type and false positive plants show brown spots of varying degrees, while the leaves of potential positive plants are green.

[0074] (8) After initial screening, genomic DNA was extracted from plants showing potential positive results. Specific amplification primers were designed within a 500 bp range upstream and downstream of the target site, and the amplified fragment containing the target site was sequenced. The sequencing results were compared with wild-type sequences using DNAMAN software, and further analyzed using BioEdit software to determine the mutation type, such as... Figure 4 , Figure 5 As shown.

[0075] Example 4

[0076] This embodiment provides the determination of agronomic phenotypic data of CRISPR / Cas9 gene knockout plants and wild-type rice under the Nipponbare background of japonica rice and the 3477 background of indica rice, including the following steps:

[0077] (1) Take an appropriate amount of gene knockout material seeds from different backgrounds obtained in Example 3, as well as corresponding wild-type rice seeds, and germinate them for 2-3 days. Then, sow the germinated rice seeds in small flower pots (10cm in diameter) filled with soil, with 8-10 seeds per pot. Each treatment has 3 replicates. The rice seedlings are cultured in a greenhouse with a light intensity of 10000Lx, a photoperiod of 14h light / 10h darkness, and a temperature of 28℃ until the rice grows to the three-leaf stage and is then transplanted to large barrels and fields for further cultivation until maturity.

[0078] (2) Phenotypic data were recorded from mature wild-type rice and gene knockout transgenic rice. The measurement data were entered and analyzed using Excel software.

[0079] (3) After the rice is fully mature, the panicle length, number of primary branches, number of secondary branches, number of grains per panicle, seed setting rate, and yield per plant are investigated. For each agronomic trait, at least 15 individual plants are randomly selected for statistical analysis. Rice plants with similar growth are selected for individual harvesting, dried, threshed, and de-shriveled, and weighed to obtain the yield per plant. Plump seeds of similar size are selected for thousand-grain weight determination. Fifteen replicate samples are randomly selected, with 1000 seeds in each sample. The seeds are weighed using an electronic balance, with a weighing accuracy of 0.0001g for each replicate sample. The average weight of the 15 sets of data is then calculated as the thousand-grain weight.

[0080] Appendix Figure 6 This image shows a comparison of the morphology of the OsRPM1 gene knockout plant and the phenotype of a wild-type Nipponbare rice plant at maturity. (See attached image.) Figure 8 A comparative diagram of OsRPM1 gene-edited plants and their corresponding Nipponbare wild-type rice panicle types, including a comparison of panicle length, number of primary branches, number of secondary branches, number of spikelets per panicle, and yield per plant.

[0081] Appendix Figure 7 Comparative images of the OsRPM1 gene knockout plant from Example 4 of this invention and the mature plant morphology and single panicle phenotype of wild-type 3477 rice. (Attached) Figure 9 A comparative diagram of OsRPM1 gene-edited plants and their corresponding wild-type rice panicle types (3477), including comparisons of panicle length, number of primary branches, number of secondary branches, number of spikelets per panicle, and yield per plant.

[0082] Excel software was used to record and analyze agronomic traits of rice. (See attached document.) Figure 8 Appendix Figure 9As shown, compared with their corresponding wild-type rice, the OsRPM1 gene-edited transgenic rice in both indica and japonica rice varieties exhibits significantly higher panicle length, number of primary branches, number of secondary branches, and number of spikelets. Simultaneously, the yield per plant was measured. Figure 8 , Figure 9 As can be seen, the yield of gene-edited transgenic rice is significantly higher than that of wild-type rice. These results further confirm that knocking out the OsRPM1 gene in rice has the function of increasing the number of rice branches, thereby increasing the number of spikelets and ultimately improving rice yield.

[0083] Example 5

[0084] This embodiment provides a method for identifying inflorescences regulated by the OsRPM1 gene, including the following steps:

[0085] (1) Paraffin sections of inflorescences were obtained from young panicles at different developmental stages of the OsRPM1 gene-edited line and wild-type 3477 plants. The samples were fixed in FAA solution (formaldehyde: glacial acetic acid: ethanol = 1:1:18) at 4 ℃ for 12 hours, and dehydrated and removed in a fractionation series of ethanol and xylene. The samples were then embedded in paraffin and cut into sections with a thickness of 5 μm using a rotary microtome (Leica RM2015). The sections were stained with 0.5% toluidine blue for 30 minutes and observed under an optical microscope (Leica DM2500 LED).

[0086] Reference Appendix Figure 10 As shown, compared with the wild type, the gene-edited lines have larger SAMs and more primary branch primordia, indicating that OsRPM1 regulates the development of inflorescence primordia and ultimately controls the number of spikelets, thereby increasing the number of spikelets and improving yield.

[0087] Example 6

[0088] This embodiment provides a method for identifying genes that regulate spikelet development using the OsRPM1 gene, including the following steps:

[0089] (1) Take appropriate amounts of the gene-edited material from Example 4 and wild-type rice panicles. Extract total RNA according to the TRIzol method (Invitrogen, Shanghai, China). Treat 3 µg of RNA with RNase-free DNase I (Invitrogen). Subsequently, we synthesized first-strand cDNA using oligo(dT)18 primers (TaKaRa, Kyoto, Japan) and M-MLV reverse transcriptase (Invitrogen, Shanghai, China). The reverse-transcribed cDNA was stored at -20°C for later use.

[0090] (2) Design qPCR primers with the following sequences: Q-IPA1-F, TGCATTCCAAGGCTCCCCGC; Q-IPA1-R, TGCGGCAGCTGCGTTTTCCT; Q-OsDPE2-F, CAAGTACACCACAAGACCAGCAA; Q-OsDPE2-R, CGTCCAACAGCGAATCCAAT; Q-OsTB1-F, TGGATTTCTCCTACCCAAGG; Q-OsTB1-R, TGAGGAGCTACGTTCCTGTG; Q-OsDEPl-F, GCGACGAGCCAT GCTGTAAG; Q-OsDEPl-R, AGCTTGGACAGGAGCACGAG; Q-OsCKX2-F, TGTCCCTTCTACAATGGTGC; CAAGTTCCTCAAGGCGCAGGTC; Q-OsLAX1-R, CATCTCCAGCGTCGTCATCCC; Q-OsGI-F, ATCGTTCTGCAGGCCGAGA; Q-OsGI-R, TCACCAATGCTTCTGGGCTAT.

[0091] (3) Preparation of qPCR reaction system: Each sample needs to be replicated three times. The 10 µL reaction system is as follows: RNaseFree ddH2O 3.5 µL; F primer 0.5 µL; R primer 0.5 µL; cDNA (diluted 10 times) 0.5 µL; 2X SYBR Green Mix 5 µL.

[0092] (4) The qPCR reaction was performed on an Applied Biosystems Quant Studio 5 (Thermo Fisher Scientific) real-time quantitative PCR instrument.

[0093] (5) Data calculation: Using the CT values ​​of the target gene and the internal reference gene, the relative expression level of each sample is calculated by the ΔΔCT algorithm.

[0094] Reference Appendix Figure 10 ,from Figure 10As can be seen, the expression levels of IPA1 / OsSPL14 and DEP1, which are positive regulators of panicle development, were significantly higher in transgenic plants with OsRPM1 knockout than in wild-type plants, while the expression levels of OsCKX2 and OsGI, which are negative regulators of panicle development, were significantly lower in transgenic plants. This indicates that knockout of OsRPM1 can cause changes in the expression of genes related to panicle development, thereby increasing the number of branches in rice, which in turn leads to an increase in the number of spikelets and improves rice yield.

[0095] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. The use of knocking out OsRPM1 gene in increasing the number of tillers and spikelets in rice, characterized in that, The gene sequence number of the OsRPM1 gene is Os03g0285100.

2. Use according to claim 1, characterized in that, The OsRPM1 gene is knocked out in the plant by constructing a gene editing vector to increase the number of branches and spikelets of rice; specifically comprising the following steps: S1: three target sequences of the OsRPM1 gene are respectively cloned into a CRISPR / Cas9 gene editing vector by using specific primers of the target points to obtain OsRPM1-CRISPR / Cas9-1 / 2 / 3 vectors; S2: the gene editing vector is infected into rice by using an agrobacterium transformation method to obtain a gene editing plant; S3: the seeds of the gene editing plant are cultured to maturity, and the agronomic traits thereof are observed, recorded and analyzed, including the number of primary branches, the number of secondary branches and the number of spikelets.

3. Use according to claim 2, wherein the specific primers for the target points of step S1 comprise: The nucleotide sequence of OsRPM1-1-cas9-F is shown as SEQ ID NO. 1; the nucleotide sequence of OsRPM1-1-cas9-R is shown as SEQ ID NO. 2; the nucleotide sequence of OsRPM1-2-cas9-F is shown as SEQ ID NO. 3; the nucleotide sequence of OsRPM1-2-cas9-R is shown as SEQ ID NO. 4; the nucleotide sequence of OsRPM1-3-cas9-F is shown as SEQ ID NO. 5; and the nucleotide sequence of OsRPM1-3-cas9-R is shown as SEQ ID NO.

6.

4. The use according to claim 2, wherein step S2 further comprises molecular identification of the genetically edited plant; the method of molecular identification specifically comprises the following steps: After the initial screening by hygromycin (Hyg), the genomic DNA of the potential positive plants is extracted; the specific amplification primers are designed in the range of 500 bp upstream and downstream of the target site, the amplified fragments containing the target site are sequenced, the sequencing results are compared with the wild type sequence by using the DNAMAN software, and the mutation type is analyzed by using the BioEdit software; the specific amplification primers designed for three different target sites are as follows: target site 1: OsRPM1-1-DNA-F, shown as SEQ ID NO. 8; OsRPM1-1-DNA-R, shown as SEQ ID NO. 9; the identification primers of target site 2 and target site 3 are the same, which are OsRPM1-2 / 3-DNA-F, shown as SEQ ID NO. 10, and OsRPM1-2 / 3-DNA-R, shown as SEQ ID NO.

11. After the initial screening by hygromycin (Hyg), the genomic DNA of the potential positive plants is extracted; the specific amplification primers are designed in the range of 500 bp upstream and downstream of the target site, the amplified fragments containing the target site are sequenced, the sequencing results are compared with the wild type sequence by using the DNAMAN software, and the mutation type is analyzed by using the BioEdit software; the specific amplification primers designed for three different target sites are as follows: target site 1: OsRPM1-1-DNA-F, shown as SEQ ID NO. 8; OsRPM1-1-DNA-R, shown as SEQ ID NO. 9; the identification primers of target site 2 and target site 3 are the same, which are OsRPM1-2 / 3-DNA-F, shown as SEQ ID NO. 10, and OsRPM1-2 / 3-DNA-R, shown as SEQ ID NO. 11.

Images