Aptamer biosensor for NGAL detection and screening method thereof

Through computational methods and specific applications, the high cost and complex operation of antibody-dependent NGAL detection in existing technologies have been solved. This has enabled the application of a computationally-based patent to biosensors, achieving high efficiency, stable specificity, wide linear range, and low detection limit. This is suitable for the early diagnosis of AKI and solves the problems of high efficiency and complex operation of antibody-dependent technologies in existing technologies. It also improves the specificity of the sensor signal and enhances the efficiency and specificity of aptamer screening.

CN121171341APending Publication Date: 2025-12-19ANHUI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511321145.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-16
Publication Date
2025-12-19

AI Technical Summary

Technical Problem

Existing NGAL detection methods rely on antibodies, resulting in high costs and complex operations. Traditional aptamer preparation is inefficient and lacks precise guidance, making it difficult to widely apply to the early diagnosis of AKI.

Method used

An engineering strategy guided by computational simulation was adopted to construct an electrochemical aptamer biosensor by screening NGAL aptamers. This included computer screening of original aptamers, rational truncation to explore the minimum active structure, computer virtual screening, and molecular docking to verify and optimize the aptamers. Detection was performed using polymethylene blue-modified screen-printed electrodes and aptamer functionalized layers.

Benefits of technology

It achieves low-cost, high-stability, and specific NGAL detection. The sensor has a wide linear range and low detection limit, making it suitable for the early diagnosis of AKI. It solves the problems of high cost and difficulty in promotion of existing methods, and improves the efficiency and specificity of aptamer screening.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121171341A_ABST
    Figure CN121171341A_ABST
Patent Text Reader

Abstract

The invention discloses an aptamer biosensor for NGAL detection and a screening method thereof. The screening method comprises the following steps: 1) screening an original aptamer; 2) rationally truncating and exploring a minimum active structure; 3) performing computer virtual screening; and 4) verifying and optimizing the aptamer through molecular docking. The electrochemical sensor constructed on the basis of the screened high-affinity aptamer 278A comprises a polymethylene blue modified screen-printed electrode and an aptamer functionalized layer, the detection limit is as low as 1.17 ng / mL, and the electrochemical sensor has excellent biological pollution resistance, specificity, batch consistency and stability. The cost of the NGAL aptamer obtained by screening is lower than that of an antibody, the stability is higher, and the defects of an antibody dependent detection method are overcome; the constructed electrochemical sensor is wide in linear range and low in detection limit, has excellent anti-interference capability, repeatability and stability, can realize rapid and accurate detection of NGAL, and provides a reliable tool for early diagnosis of AKI.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biological detection and sensor technology, in particular to an aptamer biosensor for NGAL detection and a screening method thereof. BACKGROUND

[0002] Acute kidney injury (AKI) is a common clinical critical illness with high incidence and mortality rate up to 50%. Early diagnosis and intervention are crucial for improving patient prognosis. Currently, serum creatinine is the commonly used AKI diagnostic biomarker in clinic, but this index only increases when kidney function is irreversibly damaged, and is affected by non-renal factors, which is not reliable enough, and an earlier and more specific biomarker is urgently needed.

[0003] Neutrophil gelatinase-associated lipocalin (NGAL) is an early non-invasive biomarker for AKI, which can be detected in urine 2 hours after kidney injury, and at this time the injury is reversible, thus becoming a key indicator for early diagnosis of AKI. Existing NGAL detection methods mainly rely on enzyme-linked immunosorbent assay (ELISA) and other immunoassay methods, but such methods rely on antibodies and have problems such as high cost, complex steps, poor reagent stability, and are difficult to be widely applied in clinic.

[0004] Aptamer, as a single-stranded DNA or RNA molecule, has high specificity and affinity for target binding, low cost, high stability, and strong designability, and shows significant advantages in biological detection. However, traditional aptamer preparation methods (such as SELEX) have problems such as low screening efficiency, lack of systematic guidance, and difficulty in precisely optimizing aptamer structure, which limits their application in NGAL detection.

[0005] Therefore, it is of great significance to develop an efficient and systematic aptamer screening strategy and construct a high-performance NGAL detection sensor based on the aptamer for early diagnosis of AKI. SUMMARY

[0006] The purpose of the present application is to solve the problems of high cost and complex operation caused by the dependence on antibodies in the existing NGAL detection methods, and the low efficiency and lack of precise guidance of traditional aptamer preparation, and to provide an engineering strategy based on computational simulation guided design for screening NGAL aptamer and an electrochemical biosensor based on the aptamer.

[0007] Specifically, the present application discloses a method for screening NGAL aptamer based on computational simulation guided design, comprising the following steps:

[0008] (1) Computer screening of original aptamer;

[0009] (2) rationally truncated to explore the minimum active structure, and truncated to obtain a core sequence;

[0010] (3) computer virtual screening to screen high-affinity candidate sequences;

[0011] (4) molecular docking to verify and optimize the aptamer.

[0012] Preferably, in step (1), computer simulation of the original aptamer, secondary structure prediction by UNAFold, three-dimensional structure construction by RNAComposer, and conversion to DNA form.

[0013] Preferably in any of the above schemes, the original aptamer comprises any one or several of 278A, 279A, 225B, 254B, 222B, 236A, 241A, 261A, 253A, 257A, Apt26, Apt540, Apt340, N53, the sequence of aptamer 278A is shown as SEQ ID NO. 1, the sequence of aptamer 279A is shown as SEQ ID NO. 2, the sequence of aptamer 225B is shown as SEQ ID NO. 3, the sequence of aptamer 254B is shown as SEQ ID NO. 4, the sequence of aptamer 222B is shown as SEQ ID NO. 5, the sequence of aptamer 236A is shown as SEQ ID NO. 6, the sequence of aptamer 241A is shown as SEQ ID NO. 7, the sequence of aptamer 261A is shown as SEQ ID NO. 8, the sequence of aptamer 253A is shown as SEQ ID NO. 9, the sequence of aptamer 257A is shown as SEQ ID NO. 10, the sequence of aptamer Apt26 is shown as SEQ ID NO. 11, the sequence of aptamer Apt540 is shown as SEQ ID NO. 12, the sequence of aptamer Apt340 is shown as SEQ ID NO. 13, and the sequence of aptamer N53 is shown as SEQ ID NO. 14.

[0014] Preferably in any of the above schemes, in step (2), the minimum active structure is rationally truncated to explore the minimum active structure, and the key binding region of the original aptamer is determined based on the molecular docking results, and the core sequence is truncated.

[0015] Preferably in any of the above schemes, in step (2), the HDOCK web server is used for molecular docking of known NGAL aptamer and NGAL, the binding site is analyzed by Discovery Studio Visualizer, the top stem loop structure of the known NGAL aptamer is determined as the key binding region, the known NGAL aptamer is truncated, and the core sequence is retained as a template for subsequent random sequence generation.

[0016] Preferably in any of the above solutions, in the step (3), a random aptamer library is generated based on the core sequence in MOE software, and high-affinity candidate sequences are screened by molecular docking scoring through the HDOCK server.

[0017] Preferably in any of the above solutions, in the step (4), molecular docking and verification, the interaction of the candidate aptamer and NGAL is analyzed by DiscoveryStudio Visualizer, and the optimal aptamer is determined by combining electrochemical methods.

[0018] The application also discloses a construction method of the electrochemical aptamer biosensor, and the high-affinity aptamer 278A obtained by the screening method is used to construct the electrochemical sensor.

[0019] Preferably, a screen-printed electrode (SPE) is used as a substrate, a PMB / SPE modified layer is formed by electro-polymerizing methylene blue (MB), the optimal aptamer (MB-Apt) labeled by MB is fixed, non-specific sites are blocked by bovine serum albumin (BSA), and the BSA / MB-Apt / PMB / SPE sensor is constructed.

[0020] The application also discloses a construction method of the electrochemical aptamer biosensor, and the high-affinity aptamer 278A obtained by the screening method is used to construct the electrochemical sensor.

[0021] (1) Electro-polymerizing a PMB modified layer: a PMB / SPE is formed on the surface of a SPE by CV method in 0.1M PBS containing 1mM MB;

[0022] (2) Aptamer fixation and blocking: a labeled aptamer solution is added to a working area of the PMB / SPE, and is fixed by CV method to form an Apt-MB / PMB / SPE; a BSA solution is added, non-specific sites are blocked after incubation, and the BSA / MB-Apt / PMB / SPE sensor is obtained after PBS flushing.

[0023] The application also discloses a detection method of NGAL by using the electrochemical aptamer biosensor, and the electrochemical aptamer biosensor is constructed by using the method.

[0024] (1) Different concentrations of NGAL standard solutions are added to a working area of the sensor, and are incubated at 37℃ for 60 minutes;

[0025] (2) After PBS flushing, DPV method is used for detection;

[0026] (3) A standard curve is drawn with NGAL concentration as the horizontal coordinate and DPV current value as the vertical coordinate.

[0027] Preferably, in step (2), when the DPV method is used for detection, the voltage range is 0.15V~0.85V, the pulse amplitude is 70mV, the pulse width is 50ms, and the pulse period is 200ms.

[0028] Beneficial effects:

[0029] (1) The application discloses a method for screening NGAL aptamer based on computational simulation guided design, construction of an electrochemical aptamer biosensor, and an engineering strategy based on computational simulation guided design for screening NGAL aptamer and construction of a sensor detection method. The screening method comprises the following steps: 1) screening of original aptamer; 2) rational truncation to explore the minimum active structure; 3) computer virtual screening; and 4) molecular docking verification and optimization of aptamer. Based on the screened high-affinity aptamer 278A (the sequence is shown in SEQ ID NO. 1, AAAGAAGACAAGAGCTACAATGTCACC), an electrochemical sensor is constructed, which comprises a polymethylene blue modified screen-printed electrode (PMB / SPE) and an aptamer functional layer (MB-Apt / PMB / SPE). The sensor has a linear detection range of 1.0-500.0 ng / mL, and a detection limit as low as 1.17 ng / mL, and has excellent anti-biological pollution, specificity, batch consistency and stability.

[0030] (2) The application solves the problems of high cost and difficult clinical popularization of existing NGAL detection, and is suitable for early diagnosis of acute kidney injury.

[0031] (3) The engineering strategy based on computational simulation guided design proposed in the application guides aptamer customization through a computer simulation system, significantly improves the aptamer screening efficiency and specificity, and has more rational design than the traditional SELEX method.

[0032] (4) The NGAL aptamer screened in the application has a lower cost and higher stability than antibodies, and overcomes the defects of antibody-dependent detection methods.

[0033] (5) The electrochemical sensor constructed in the application has a wide linear range (1.0-500.0 ng / mL), a low detection limit (1.17 ng / mL), and excellent anti-interference ability, repeatability and stability, and can realize rapid and accurate detection of NGAL, thereby providing a reliable tool for early diagnosis of AKI. BRIEF DESCRIPTION OF DRAWINGS

[0034] Figure 1 Flow chart of the engineering strategy based on computational simulation-guided design for screening NGAL aptamer and constructing sensor;

[0035] Figure 2 Figure (A) is the current map difference map during the recognition of different aptamers and NGAL by CV method; (B) is the current value after the recognition of different aptamers and NGAL by DPV method; (C) is the secondary structure prediction of Apt-278A; (D) and (E) are the overall and local molecular docking results between Apt-278A and NGAL; (F) is the affinity of 278A aptamer measured by UV-Vis method;

[0036] Figure 3 Figure (A), (B) and (C) show the SEM images of SPE, PMB / SPE and Apt-MB / PMB / SPE electrodes; (D), (E) and (F) respectively present the AFM images of SPE, PMB / SPE and Apt-MB / PMB / SPE electrodes;

[0037] Figure 4 Figure (A) CV and (B) are EIS characterization, including the following components with names: a represents SPE, b represents PMB / SPE, c represents Apt-MB / PMB / SPE, d represents BSA / Apt-MB / PMB / SPE, e represents NGAL / BSA / Apt-MB / PMB / SPE; (C) is the FT-IR spectrum of MB and PMB; (D) is the UV-vis spectrum of MB and PMB;

[0038] Figure 5 Figure (A) is the experimental parameter optimization of Apt-MB solution concentration, (B) is the cycle number of fixing Apt-MB using CV method, (C) is the incubation time of BSA, (D) is the incubation time of NGAL;

[0039] Figure 6 Figure (A) is the linear interval; (B) is the specificity; (C) is the anti-biocontamination performance; (D) is the batch consistency; (E) is the long-term stability; (F) is the reuse rate. DETAILED DESCRIPTION

[0040] The following examples are further illustrations of the contents of the present application and are set forth to aid in the understanding of the technical contents of the present application, but the substantial contents of the present application are not limited to the following examples only, and any simple change or replacement based on the substantial spirit of the present application should be understood and known by those skilled in the art as belonging to the protection scope required by the present application.

[0041] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. In case of conflict, the content of the present specification will control.

[0042] Example 1

[0043] The engineering strategy based on computational simulation guided design was used to screen NGAL aptamer, including the following steps:

[0044] Step 1: Computer simulation of original aptamer, secondary structure prediction by UNAFold, three-dimensional structure construction by RNAComposer, and conversion to DNA form;

[0045] Step 2: Reasonable truncation to explore the minimum active structure, based on the results of molecular docking to determine the key binding region of the original aptamer (Apt340) (top stem-loop structure), and to obtain the core sequence by truncation;

[0046] Step 3: Computer virtual screening, based on the core sequence to generate a random aptamer library in MOE software, and to screen high-affinity candidate sequences by HDOCK server for molecular docking scoring;

[0047] Step 4: Molecular docking and verification, analysis of the interaction between candidate aptamer and NGAL by Discovery Studio Visualizer, combined with electrochemical method verification to determine the optimal aptamer.

[0048] Screening of NGAL aptamer:

[0049] The engineering strategy based on computational simulation guided design was used to screen NGAL aptamer with high specificity and high affinity, and the sequence of the optimal aptamer 278A was "AAAGAAGACAAGAGCTACAATGTCACC", as shown in SEQ ID NO. 1, and its dissociation constant (Kd) with NGAL was 9.63 μM.

[0050] Construction of electrochemical aptamer biosensor: taking screen-printed electrode (SPE) as substrate, forming PMB / SPE modified layer by electro-polymerization of methylene blue (MB), fixing MB-labeled optimal aptamer (MB-Apt), blocking non-specific sites with bovine serum albumin (BSA), and constructing BSA / MB-Apt / PMB / SPE sensor. The sensor detects NGAL by differential pulse voltammetry (DPV), and realizes quantitative analysis based on current change.

[0051] Flow chart of engineering strategy based on computational simulation-guided design for screening NGAL aptamer and constructing sensor as shown in Figure 1

[0052] 1. Materials and reagents

[0053] Oligonucleotides (aptamer sequences as shown in Table 1 and Table 2) were synthesized by Shanghai Shengong Bioengineering Co., Ltd.

[0054] Table 1 Known NGAL aptamer

[0055]

[0056] Table 2 Top ten sequences with highest molecular docking scores screened by engineering strategy based on computational simulation-guided design

[0057]

[0058] The NGAL protein of this embodiment was purchased from Shanghai Jinan Protein Technology Co., Ltd., and the NGAL antibody was purchased from Shanghai Aibimaite Biological Technology Co., Ltd.; phosphate buffer solution (PBS), bovine serum albumin (BSA), methylene blue (MB), cystatin C (CysC), glutathione (GSH) and other reagents were all of analytical purity, and the experimental water was ultrapure water (18MΩ / cm);

[0059] The electrochemical workstation was CHI660E (Shanghai Chenhua Instrument Co., Ltd.), and a three-electrode system was used (SPE screen-printed electrode as working electrode, carbon electrode as counter electrode, and Ag / AgCl as reference electrode); the characterization instruments included Regulus8230 scanning electron microscope (SEM), Bruker Dimension Icon atomic force microscope (AFM), UV-1800 PC ultraviolet-visible spectrophotometer, and Bruker-Tensor Fourier transform infrared spectrometer.

[0060] 2. Specific implementation of engineering strategy based on computational simulation-guided design

[0061] 2.1 Computer simulation of original aptamer ​

[0062] A known NGAL aptamer (Apt340, sequence "CCACAGTAGGTGAGGTTCACTGAGTTATCCATTGTTGGCA", as shown in SEQ ID NO. 12) was selected from the literature; its secondary structure was predicted by the UNAFold web server (http: / / www.unafold.org / ); the three-dimensional structure was constructed using RNAComposer (http: / / mnacomposer.ibch.poznan.pl / ), and the RNA structure was converted to a DNA structure by Discovery Studio Visualizer.

[0063] 2.2 Exploration of the minimum active structure

[0064] Molecular docking of Apt340 and NGAL was performed using the HDOCK web server (http: / / hdock.phys.hust.edu.cn / ), and the binding site was analyzed by Discovery Studio Visualizer to determine that the top stem-loop structure of Apt340 was the key binding region; Apt340 was truncated, and the core sequence "ACAGTAGGTG" was retained as a template for subsequent random sequence generation.

[0065] 2.3 Computer virtual screening

[0066] A random aptamer library was generated based on the core sequence "ACAGTAGGTG" in MOE software; molecular docking of the sequences in the library with NGAL was performed using HDOCK, the docking scores were calculated, and the top 10 candidate sequences with the highest scores were selected and are shown in Table 2, including 278A, 279A, 225B, 254B, 222B, 236A, 241A, 261A, 253A, and 257A, the sequence of 278A is shown in SEQ ID NO. 1, the sequence of 225B is shown in SEQ ID NO. 2, the sequence of 225B is shown in SEQ ID NO. 3, the sequence of 254B is shown in SEQ ID NO. 4, the sequence of 222B is shown in SEQ ID NO. 5, the sequence of 236A is shown in SEQ ID NO. 6, the sequence of 241A is shown in SEQ ID NO. 7, the sequence of 261A is shown in SEQ ID NO. 8, the sequence of 253A is shown in SEQ ID NO. 9, and the sequence of 257A is shown in SEQ ID NO. 10.

[0067] 2.4 Verification of the optimal aptamer

[0068] The binding affinity of the candidate aptamer to NGAL was determined by cyclic voltammetry (CV) and differential pulse voltammetry (DPV). The aptamer was immobilized on the electrode surface, and after incubation with different concentrations of NGAL, the current change was detected to screen the aptamer with the strongest current response. As shown in Figure 2 Fig. 1, (A) is the current difference chart during the recognition process of different aptamers and NGAL determined by CV method; (B) is the current value after the recognition of different aptamers and NGAL determined by DPV method; (C) is the secondary structure prediction of Apt-278A; (D) and (E) are the overall and local molecular docking results between Apt-278A and NGAL; (F) is the affinity of 278A aptamer determined by UV-Vis method. The results show that the aptamer 278A (sequence "AAAGAAGACAAGAGCTACAATGTCACC") has the highest current response and the best stability, and is determined as the optimal aptamer.

[0069] Figure 2 In the above, A chart uses cyclic voltammetry (CV) to investigate the binding affinity between the aptamer and its target based on the change of current. The CV results show that the resistance increases and the current decreases. Each aptamer can specifically bind to NGAL, although the affinity is different. The differential pulse voltammetry (DPV) test results reveal the current change trend when various aptamers recognize NGAL, as shown in Figure 2 B. By comparing the current difference, it can be seen that the current response signals induced by the binding of aptamers with the same concentration to NGAL are different. The current response values are ranked from high to low as follows: 278A > 279A > 225B > 254B > 222B > 236A > 2410A > 261A > 253A > 257A > 340A. The ranking is consistent with the CV analysis results, and it is concluded that compared with other aptamers, aptamer 278A exhibits a more stable recognition mechanism and higher sensitivity. At the same time, the current change of the sensor prepared using NGAL monoclonal antibody and NGAL nanobody can further confirm that aptamer 278A has a more stable recognition mechanism and higher sensitivity than other aptamers.

[0070] Figure 2 In the above, (C) is the secondary structure prediction of Apt-278A; (D) and (E) are the overall and local molecular docking results between Apt-278A and NGAL; as shown in F chart, in order to study the binding affinity between the nucleic acid aptamer and the target protein, we used a series of experiments using ultraviolet spectrophotometer to measure the dissociation constant (Kd value) of Apt-278A, which is 9.63 μM.

[0071] 3. Preparation of electrochemical aptamer biosensor

[0072] 3.1 Electro-polymerization of PMB modified layer

[0073] PMB / SPE was formed by electro-polymerization on the surface of SPE in 0.1M PBS (pH 7.2) containing 1mM MB by CV method (potential range -0.5V~+1.2V, scan rate 50mV / s, 30 cycles), and stored at 4℃ after rinsing with ultrapure water.

[0074] 3.2 Aptamer immobilization and blocking

[0075] 50μL of MB-labeled 278A aptamer solution (4μM) was added to the working area of PMB / SPE, and immobilized by CV method (potential range -0.5V~+1.2V, scan rate 50mV / s, 8 cycles) to form Apt-MB / PMB / SPE.

[0076] 6μL of 1% BSA solution was added, and incubated at 37℃ for 40 minutes to block non-specific sites. After rinsing with 0.01M PBS (pH 7.4), the BSA / MB-Apt / PMB / SPE sensor was obtained and stored at 4℃ for standby.

[0077] Figure 5 For experimental parameter optimization, (A) is the optimization of Apt-MB solution concentration, (B) is the cycle number of Apt-MB immobilization by CV method, (C) is the incubation time of BSA, and (D) is the incubation time of NGAL. As shown in FIG. 5A, when the Apt-MB concentration is 4μM, the DPV response current change reaches the maximum value, so the optimal concentration of Apt-MB is determined to be 4μM. Subsequently, the cycle number of MB-labeled aptamer immobilization by CV method was optimized. As shown in FIG. 5B, when the cycle number is 8, the DPV response current change reaches the maximum, so 8 cycles are selected for Apt-MB immobilization. The blocking time of bovine serum albumin (BSA) has a significant effect on the performance of the sensor. We investigated the current change of the sensor under different blocking times (FIG. 5C), and finally selected 40 minutes as the blocking time of BSA. Generally speaking, the incubation time of NGAL will affect the performance of the whole reaction system. Figure 5 As shown in FIG. 5D, when the incubation time is extended from 30 minutes to 60 minutes, the current response difference increases rapidly; but after 60 minutes, the signal appears a slight decrease. Therefore, 60 minutes is selected as the optimal incubation time.

[0078] 4. Detection method of NGAL

[0079] Different concentrations of NGAL standard solution were added to the sensor working area, and incubated at 37℃ for 60 minutes;

[0080] After rinsing with 0.01M PBS (pH 7.4), DPV method was used for detection (voltage range 0.15V~ -0.85V, pulse amplitude 70mV, pulse width 50ms, pulse period 200ms); the standard curve was drawn with NGAL concentration as the abscissa and DPV current value as the ordinate, the linear equation was I=-0.039c+34.89 (R 2 =0.9912), the linear range was 1.0-500.0ng / mL, and the detection limit (LOD) was 1.17ng / mL.

[0081] 5. Sensor performance verification

[0082] Specificity: The response current of interfering substances such as BSA, CysC, AFP, VC, etc. was significantly lower than that of NGAL, proving good specificity;

[0083] Anti-interference: In biological fluids containing GSH and Cys, the signal suppression rate was low, and the interface stability was excellent.

[0084] Batch consistency: The relative standard deviation (RSD) of 3 parallel experiments was 4.78%;

[0085] Long-term stability: The current retention rate was > 95% after storage at 4℃ for 12 days;

[0086] In AFM technology, root mean square roughness (Rq) is considered an important indicator for surface evaluation. SEM and AFM were used to characterize the surface morphology of the biosensor, Figure 3 In the SEM images, Figures (A), (B) and (C) show the SEM images of the SPE, PMB / SPE and Apt-MB / PMB / SPE electrodes; Figures (D), (E) and (F) present the AFM images of the SPE, PMB / SPE and Apt-MB / PMB / SPE electrodes, respectively. In Figure 3A, a large number of carbon particles are distributed on the surface of the bare SPE electrode, and the Rq is 86.2 nm. Figure 3B shows that after the electrode is modified with PMB, a layer of blue film is observed to adhere to the surface, making the electrode surface smoother, and the measured Rq is 66.3 nm. However, when Apt-MB is immobilized on the electrode surface, aggregated polymers appear, and the surface roughness increases to 75.2 nm.

[0087] Cyclic voltammetry was used to detect the current-potential curves of different electrodes during the sensor fabrication process, as shown in Figure 4A. Curve a is the cyclic voltammetry curve of the bare SPE electrode, and curve b is the CV curve of the electrode surface after PMB modification. Clearly, the peak current increases, indicating that Apt-MB has a large specific surface area and excellent conductivity, and also suggesting that the electron transfer rate of the electrode after PMB modification is accelerated, thus improving electrode performance. Curve c is the CV curve of the Apt-MB / Apt-MB / SPE electrode obtained by fixing Apt-MB to the electrode surface. A further decrease in peak current can be observed, and this significant decrease in peak current is due to the connection of the aptamer [Fe(CN)6]. 3- / 4- The aptamer has difficulty reaching the electrode surface, resulting in a weakened electrical signal. Curve e is the CV curve after NGAL specifically binds to the aptamer, which shows that the peak current further decreases. This proves that the aptamer can specifically bind to NGAL, thus indicating that the sensor can detect NGAL.

[0088] AC impedance characterization results are as follows Figure 4 As shown in Figure B, the PMB-modified electrode exhibits significantly better conductivity compared to the bare SPE electrode. The conductivity of the organic conjugated polymer PMB lowers the electron transfer barrier on the SPE surface, enhancing its conductivity. When Apt-MB is modified onto the electrode, the electron transfer capability of the electrode surface weakens, and the semi-circle radius increases. After adding the target substance NGAL, the Apt-MB modified on the electrode surface binds to it, further reducing the electron transfer capability and further increasing the semi-circle radius. The results of the CV and EIS plots are consistent, indicating that each step of the electrode modification process is clearly distinguishable, and the constructed electrochemical sensor exhibits stable performance.

[0089] The successful electropolymerization of PMB was confirmed using Fourier transform infrared spectroscopy (FT-IR). As shown in Figure 4C, the infrared spectrum of free MB shows that its ring stretching vibration is located at 1593 cm⁻¹. -1 The CN symmetric stretching vibration is located at 1385 cm. -1 The CH3 symmetric deformation vibration is located at 1324 cm. -1 After polymerization of methylene blue, the concentration is 1200-1700 cm⁻¹. -1 The wavenumbers of most stretching and bending vibration bands within the range increased. The changes in the position and decrease in the number of out-of-plane bending vibration bands of the CH bond are related to the increase in resonance energy and the participation of the CH bond in the oxidative polymerization of methylene blue. (3414 cm⁻¹) -1 The peak at 1663 cm⁻¹ originates from the NH bond. -1The peak at 655 nm corresponds to the vibration of benzene ring. As shown in FIG. 4D, in the UV-Vis spectrum, the maximum absorption peak of methylene blue is at 655 nm, and there is a small absorption band at 610 nm, which is due to the molecular structure of the dye, i.e. the characteristic absorption peak of the dimer is at 610 nm. In the detection results of PMB, the characteristic peak of MB can still be clearly observed, but it is blue-shifted compared with MB.

[0090] Figure 6 In the present application, (A) is a linear interval; (B) is specificity; (C) is anti-biofouling performance; (D) is batch consistency; (E) is long-term stability; (F) is reusability. In the present application, differential pulse voltammetry (DPV) is used to explore the binding affinity of aptamer and target. As shown in FIG. 5A, under the optimized experimental conditions, the analysis performance of the biosensor is verified by investigating the relationship between the DPV response and the concentration of NGAL. The results show that the DPV response current (I) is linearly correlated with the concentration (c) of NGAL (FIG. 6A), and the linear equation is I = -0.039c + 34.89, and the correlation coefficient is 0.9912. The detection limit (LOD) of the constructed aptamer is calculated to be 1.37 ng / mL, and the linear range is wide, which is 1 ng / mL to 500 ng / mL. Figure 6 Aso shown in FIG. 5A, under the optimized experimental conditions, the analysis performance of the biosensor is verified by investigating the relationship between the DPV response and the concentration of NGAL. The results show that the DPV response current (I) is linearly correlated with the concentration (c) of NGAL (FIG. 6A), and the linear equation is I = -0.039c + 34.89, and the correlation coefficient is 0.9912. The detection limit (LOD) of the constructed aptamer is calculated to be 1.37 ng / mL, and the linear range is wide, which is 1 ng / mL to 500 ng / mL.

[0091] At the same time, in order to evaluate the response of the sensor to common interfering substances in urine samples, in FIG. 6B, the concentration of interfering substances such as bovine serum albumin (BSA), cystatin C (CysC), alpha-fetoprotein (AFP) and vitamin C (VC) is used as a variable for comparison. Subsequently, its anti-biofouling performance in different biological fluids is further evaluated. As shown in FIG. 6C, the modified electrode is immersed in a solution containing only 100.0 mg / mL BSA and a solution containing BSA and two different active biological thiols (5.0 mM glutathione and 5.0 mM cysteine), and the inhibition rate of DPV signal [(I0- I) / I0] during 24 hours of incubation reflects the degree of non-specific protein adsorption on the electrode surface before and after incubation. Among them, compared with self-assembly and traditional gold-thiol interface modification (Au-S), the signal inhibition rate of aptamer fixed by CV method is the lowest, and the sensor interface formed is more stable. The results show that the sensor shows specific response to the target analyte NGAL, and the interference of other substances can be ignored.

[0092] Figure 6DThe batch-to-batch consistency of the sensor was also evaluated, and the relative standard deviation (RSD) was calculated to be 4.78%, confirming the stability of the biosensor preparation process. In addition, as shown in FIG. 6E, the long-term stability of the biosensor was evaluated, and it was found that the DPV signal remained stable for 12 days of storage at 4°C, and only a significant decrease occurred until the 15th day, maintaining 95.3% of the initial current, indicating that the sensor still has good stability over time. As shown in FIG. 6F, in 10 consecutive DPV detections, the sensor fixed by the CV method has smaller current signal fluctuations and better stability compared to the sensor prepared by the self-assembly method.

[0093] The above-described embodiments are merely preferred modes of the present application and are not intended to limit the scope of the present application, and various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the scope of protection of the present application as defined by the claims.

[0094] The sequence listing is as follows:

[0095] SEQ ID NO. 1: AAAGAAGACAAGAGCTACAATGTCACC

[0096] SEQ ID NO. 2: AGGAAAAAGAAGTGTGACTACTGGATC

[0097] SEQ ID NO. 3: GATACACTGGTCGATTGGGACA

[0098] SEQ ID NO. 4: TTTATTTAGCAGACAAGGTGGGGCT

[0099] SEQ ID NO. 5: TATTTAGCAGACAAGGTGGGGC

[0100] SEQ ID NO. 6: AGGACTCCACCTCAGACCTGATC

[0101] SEQ ID NO. 7: AATTCCAGGGGAAGTGGTATGTGG

[0102] SEQ ID NO. 8: CCATCTATGAGCTGAAAGAAGACAAG

[0103] SEQ ID NO. 9: ACCATCTATGAGCTGAAAGAAGACA

[0104] SEQ ID NO. 10: ATGCAATTCTCAGAGAAGACAAAGACC

[0105] SEQ ID NO. 11 : GAGGATTTGGTGGATAGTAAATCCTC

[0106] SEQ ID NO. 12: CGGAGGGCGGAAGCAAAGCGTAACAGAAAGCCAACACGCG

[0107] SEQ ID NO. 13: CCACAGTAGGTGAGGTTCACTGAGTTATCCATTGTTGGCA

[0108] SEQ ID NO. 14: AGCAGCACAGAGGTCAGATGGCGCTGGATAGCAAGATCACGTTATCATCGTAAACCCTATGCGTGCTACCGTGAA

Claims

1. A method for screening aptamer biosensors for NGAL detection, characterized in that, Includes the following steps: (1) Computer screening of primitive aptamers; (2) Rationally truncate the exploration of the minimum active structure to obtain the core sequence; (3) Computer-based virtual screening to select high-affinity candidate sequences; (4) Molecular docking verification and optimization of aptamers.

2. The screening method for aptamer biosensors for NGAL detection as described in claim 1, characterized in that, In step (1), the computer simulation of the original aptamer predicts the secondary structure through UNAFold, the RNAComposer constructs the three-dimensional structure, and converts it into DNA form.

3. The screening method for aptamer biosensors for NGAL detection as described in claim 2, characterized in that, The original aptamers include any one or more of 278A, 279A, 225B, 254B, 222B, 236A, 241A, 261A, 253A, 257A, Apt26, Apt540, Apt340, and N53. The sequence of aptamer 278A is shown in SEQ ID NO.1, the sequence of aptamer 279A is shown in SEQ ID NO.2, the sequence of aptamer 225B is shown in SEQ ID NO.3, the sequence of aptamer 254B is shown in SEQ ID NO.4, the sequence of aptamer 222B is shown in SEQ ID NO.5, the sequence of aptamer 236A is shown in SEQ ID NO.6, the sequence of aptamer 241A is shown in SEQ ID NO.7, the sequence of aptamer 261A is shown in SEQ ID NO.8, the sequence of aptamer 253A is shown in SEQ ID NO.9, and the sequence of aptamer 257A is shown in SEQ ID NO.

9. As shown in NO.10, the sequence of aptor Apt26 is shown in SEQ ID NO.11, the sequence of aptor Apt540 is shown in SEQ ID NO.12, the sequence of aptor Apt340 is shown in SEQ ID NO.13, and the sequence of aptor N53 is shown in SEQ ID NO.

14.

4. The screening method for aptamer biosensors for NGAL detection as described in claim 1, characterized in that, In step (2), the HDOCK web server is used to perform molecular docking between the known NGAL aptamer and NGAL. The binding site is analyzed by Discovery Studio Visualizer to determine the top stem-loop structure of the known NGAL aptamer as the key binding region. The known NGAL aptamer is truncated, and the core sequence is retained as a template for subsequent random sequence generation.

5. The screening method for aptamer biosensors for NGAL detection as described in claim 1, characterized in that, In step (3), a random aptamer library is generated in the MOE software based on the core sequence, and molecular docking is scored through the HDOCK server to screen high-affinity candidate sequences.

6. The screening method for aptamer biosensors for NGAL detection as described in claim 1, characterized in that, In step (4), molecular docking and verification are performed by analyzing the interaction between candidate aptamers and NGAL using Discovery Studio Visualizer, and verifying the results using electrochemical methods to determine the optimal aptamer.

7. An aptamer biosensor for NGAL detection, characterized in that, The high-affinity aptamer 278A obtained by screening using any one of the screening methods in claims 1-6, and the sequence of aptamer 278A is shown in SEQ ID NO.1, is used to construct an electrochemical sensor comprising a polymethylene blue modified screen-printed electrode and an aptamer functionalized layer.

8. The aptamer biosensor for NGAL detection as described in claim 7, characterized in that, Using screen-printed electrodes as a substrate, a PMB / SPE modification layer was formed by electropolymerization of methylene blue to immobilize the optimal aptamer labeled with MB. Non-specific sites were blocked with bovine serum albumin to construct a BSA / MB-Apt / PMB / SPE sensor.

9. The method for constructing an aptamer biosensor as described in claim 8, characterized in that, Includes the following steps: (1) Electropolymerized PMB modification layer: PMB / SPE was formed on the surface of SPE by electropolymerization in 0.1M PBS containing 1 mM MB; (2) Aptamer immobilization and blocking: The labeled aptamer solution was added to the working area of ​​PMB / SPE and immobilized by CV method to form Apt-MB / PMB / SPE; BSA solution was added and incubated to block non-specific sites. After rinsing with PBS, the BSA / MB-Apt / PMB / SPE sensor was obtained.

10. A method for detecting NGAL using an electrochemical aptamer biosensor, wherein the electrochemical aptamer biosensor is constructed using the method described in any one of claims 7-9, and the detection method includes the following steps: (1) Add NGAL standard solutions of different concentrations to the sensor working area and incubate at 37°C for 60 minutes; (2) After rinsing with PBS, the DPV method was used for detection; (3) Plot a standard curve with NGAL concentration on the x-axis and DPV current value on the y-axis.