The reagent for detecting the expression level of ETV4 in a sample is applied in the preparation of a product for evaluating or judging the therapeutic effect of MTA on inflammatory eye diseases

Abstract

The application provides application of a reagent for detecting an ETV4 expression level in a sample in preparation of a product for evaluating or judging a treatment effect of MTA on an inflammatory eye disease, and belongs to the field of biological medicine. The treatment effect of MTA on inflammation of a patient from which a sample is derived is evaluated or judged by detecting the expression level of ETV4 in the sample, a new research tool is provided for personalized precision medicine, and the application has a wide clinical application prospect.

Description

Technical Field

[0001] This invention relates to the application of reagents for detecting ETV4 expression levels in samples in the preparation of products for evaluating or determining the therapeutic effect of MTA on inflammatory eye diseases, and belongs to the field of biomedicine. Background Technology

[0002] In the medical field, inflammatory eye diseases are a group of diseases that seriously threaten patients' visual health and quality of life. Their pathogenesis is complex, involving the abnormal activation of multiple biological processes and molecular pathways. Inflammatory eye diseases not only cause uncomfortable symptoms such as eye pain, redness, and decreased vision, but if not treated promptly and effectively, they may also lead to serious complications and even blindness, causing great suffering to patients and a heavy social burden.

[0003] Currently, treatments for inflammatory eye diseases mainly include medication and surgery. Medication is the most commonly used method, employing anti-inflammatory drugs and immunosuppressants to suppress the inflammatory response and reduce damage to ocular tissues. However, due to individual differences in the etiology and pathogenesis of inflammatory eye diseases, different patients respond differently to the same treatment regimen.

[0004] In current clinical practice, the evaluation of treatment efficacy for inflammatory eye diseases mainly relies on the observation of clinical symptoms and signs, as well as some routine laboratory test indicators. However, these evaluation methods have limitations such as strong subjectivity and lack of specificity. For example, laboratory test indicators are difficult to distinguish between the eye and other parts of the body, which may lead to untimely or overtreatment due to inaccurate evaluation. Therefore, achieving personalized precision medicine is crucial for improving the treatment efficacy of inflammatory eye diseases and reducing adverse reactions. Summary of the Invention

[0005] To address the above problems, this invention provides a method for evaluating the therapeutic effect of MTA on inflammation based on ETV4 expression.

[0006] To achieve the above objectives, the specific technical solution provided by the present invention is as follows:

[0007] The first aspect of this invention provides the application of a reagent for detecting the expression level of ETV4 in a sample in the preparation of a product for evaluating or judging the therapeutic effect of MTA on inflammatory eye diseases. The evaluation or judgment of the therapeutic effect of MTA on inflammatory eye diseases is achieved by detecting the expression level of ETV4 before and after MTA administration.

[0008] ETV4 is also known as E1AF, PEA3, E1A-F, and PEAS3. In this invention, the term includes wild-type, mutant, or fragments thereof. The term covers full-length, unprocessed ETV4, as well as any form of ETV4 derived from cells and processed. The term covers naturally occurring variants of ETV4 (e.g., splice variants or allelic variants). The term covers, for example, the ETV4 gene, human ETV4, and ETV4 from any other vertebrate source, including mammals such as primates and rodents (e.g., mice and rats). As a preferred embodiment, in this invention, ETV4 is a human gene with gene ID 2118.

[0009] In this invention, the term "expression level" refers to the amount, accumulation, or rate of ETV4 molecules. Expression level can be expressed as: the amount or rate of synthesis of messenger RNA (mRNA) encoded by a gene, the amount or rate of synthesis of a polypeptide or protein encoded by a gene, or the amount or rate of synthesis of a biomolecule accumulated in a cell or biological fluid.

[0010] MTA (5'-Methylthioadenosine), molecular formula C 11 H 15 N5O3S, generated by the metabolism of S-adenosylmethionine (SAM), is a key node in intracellular methylation reactions and nucleoside metabolism.

[0011] In some embodiments, the reagents used to detect the ETV4 expression level in the sample include reagents for detecting protein expression levels and / or mRNA expression levels.

[0012] In some embodiments, the reagents for detecting protein expression levels include reagents used in any of the following methods: Western blotting, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay, sandwich assay, immunohistochemistry, mass spectrometry, immunoprecipitation analysis, complement fixation analysis, flow cytometry with fluorescence separation technology, and protein chip method.

[0013] Furthermore, the reagent used to detect protein expression levels is the same reagent used in Western blotting.

[0014] Furthermore, the reagent for detecting protein expression levels includes a specific antibody or a fragment thereof, which can specifically bind to the protein of ETV4.

[0015] Furthermore, the antibodies include monoclonal antibodies and polyclonal antibodies.

[0016] Furthermore, the reagent for detecting protein expression levels also includes a secondary antibody, which can bind to the aforementioned antibody.

[0017] Furthermore, a detectable biomarker may be attached to the specific antibody or its fragment, or to the secondary antibody.

[0018] As used herein, the term "detectable marker" means any composition that can be detected by fluorescent, spectroscopic, photochemical, biochemical, immunological, electrical, optical, or chemical means, and the detection of the detectable marker indicates that the protein is expressed.

[0019] Furthermore, the detectable markers include peroxidase.

[0020] Furthermore, the peroxidase is horseradish peroxidase (HRP).

[0021] In some embodiments, the reagents for detecting mRNA expression levels include reagents used in any of the following methods: PCR-based detection methods, Southern hybridization methods, Northern hybridization methods, dot hybridization methods, fluorescence in situ hybridization methods, DNA microarray methods, ASO methods, and high-throughput sequencing platform methods.

[0022] Furthermore, the reagents for detecting mRNA expression levels include specific primers and / or probes.

[0023] Furthermore, the probe can be DNA, RNA, a DNA-RNA chimera, PNA, or other derivatives. There is no limitation on the length of the probe; any length is acceptable as long as specific hybridization and binding to the target nucleotide sequence are achieved. The probe length can be as short as 25, 20, 15, 13, or 10 base pairs. Similarly, the probe length can be as long as 60, 80, 100, 150, 300 base pairs or longer, even the entire gene. Since different probe lengths have different effects on hybridization efficiency and signal specificity, the probe length is typically at least 14 base pairs, and generally does not exceed 30 base pairs. The optimal length for complementarity with the target nucleotide sequence is 15-25 base pairs. The probe's own complementary sequence should preferably be less than 4 base pairs to avoid affecting hybridization efficiency.

[0024] In some embodiments, the inflammation is an inflammatory eye disease.

[0025] In this invention, inflammatory eye disease is a class of diseases involving inflammatory reactions in ocular tissues, which can affect multiple sites such as the eyelids, conjunctiva, cornea, sclera, uvea, retina, and optic nerve.

[0026] In some embodiments, a decrease in ETV4 expression level indicates that the treatment is effective, while an increase or no change in ETV4 expression level indicates that the treatment is ineffective.

[0027] Furthermore, the treatment effect includes the effect observed in patients from 3 days to 6 months or longer after treatment.

[0028] In the context of this invention, the term "sample" as used refers to a composition obtained from or derived from a subject (e.g., an individual of interest) that contains cells and / or other molecular entities to be characterized and / or identified based on, for example, physical, biochemical, chemical, and / or physiological characteristics. For example, a sample refers to any sample derived from a subject of interest that is expected or known to contain cells and / or molecular entities to be characterized. Samples include, but are not limited to, tissue samples, primary or cultured cells or cell lines, cell cultures, cell supernatants, cell lysates, platelets, serum, plasma, vitreous fluid, lymph, synovial fluid, follicular fluid, semen, amniotic fluid, milk, whole blood, blood-derived cells, urine, cerebrospinal fluid, saliva, sputum, tears, sweat, mucus, tissue culture fluid, tissue extracts, homogenized tissue, cell extracts, and combinations thereof.

[0029] In the context of this invention, a subject refers to any individual of interest, preferably a living organism suffering from or suspected of suffering from inflammation, including humans, other mammals, preferably primates, and particularly preferably humans.

[0030] In some embodiments, the sample is selected from whole blood, serum, plasma, and retinal pigment epithelial cells.

[0031] A second aspect of the present invention provides a product for evaluating or judging the efficacy of MTA in treating inflammation based on ETV4 expression levels, the product comprising reagents for detecting ETV4 expression levels, the reagents comprising primers, probes, antibodies or markers.

[0032] The products are selected from reagent kits, chips, and membrane strips.

[0033] In some embodiments, the kit also includes the aforementioned instruments used for detecting mRNA and / or protein expression levels.

[0034] Furthermore, the kit may also include mRNA expression level auxiliary detection reagents, protein expression level auxiliary detection reagents, mRNA expression level auxiliary detection instruments, and protein expression level auxiliary detection instruments.

[0035] Furthermore, the mRNA expression level auxiliary detection reagents include, but are not limited to: reaction reagents that visualize the amplicon corresponding to the primer, such as reagents that visualize the amplicon by agarose gel electrophoresis, enzyme-linked gel electrophoresis, chemiluminescence, in situ hybridization, fluorescence detection, etc.; RNA extraction reagents; reverse transcription reagents; cDNA amplification reagents; standards used to prepare standard curves; positive controls; and negative controls.

[0036] Furthermore, the auxiliary reagents for detecting protein expression levels include, but are not limited to: blocking solution, antibody dilution solution, washing buffer, colorimetric termination solution, and standards for preparing standard curves.

[0037] Furthermore, the kit also includes a container, a positive control, a negative control, a buffer, an auxiliary agent, a solvent, and an instruction manual with instructions on how to use the kit for detection and how to interpret the results.

[0038] A third aspect of the present invention provides the use of ETV4 inhibitors in the preparation of drugs for treating inflammatory eye diseases, wherein the ETV4 inhibitors include small molecule inhibitors, antibody drugs, and / or RNA interference drugs.

[0039] Furthermore, the small molecule inhibitor is MTA.

[0040] Furthermore, the RNA interference drug is siRNA, and the sequence of the siRNA is shown in any one of SEQ ID NO:3-5.

[0041] Furthermore, the ETV4 inhibitor treats inflammatory eye diseases by inhibiting the NF-κB and MAPK pathways.

[0042] Advantages and benefits of the present invention: The present invention provides a method and product for evaluating the therapeutic effect of MTA on inflammation based on gene marker levels. By detecting the expression level of ETV4, the results can be used to judge the therapeutic effect of inflammation, providing a new research direction and clinical testing tool for personalized precision medicine. Attached Figure Description

[0043] Figure 1 The figure shows the results of MTA downregulating ETV4 expression in RPE cells in an inflammatory eye disease model. A represents the ETV4 protein level in ARPE-19 cells as detected by Western blot; B represents the changes in ETV4 protein expression in EIU mouse RPE tissue; C represents the changes in ETV4 localization and expression in ARPE-19 cells as detected by immunofluorescence; and DE represent the changes in ETV4 mRNA expression in the LPS-induced group (D) and the EIU model group (E) as shown by qPCR.

[0044] Figure 2 The diagram shows the results of ETV4 regulating the inflammatory signaling pathway in RPE cells. A and B represent Western blot (A) and qPCR (B) validations of ETV4 knockdown lentivirus (ETV4). sh1–sh3Transfection effect in ARPE-19 cells; C represents GFP signal indicating viral infection efficiency and cell morphology; DE represents LPS-induced downregulation of NF-κB and MAPK signaling pathways by ETV4 knockdown; FG represents Western blotting to verify inflammatory ETV4 overexpression lentivirus (ETV4). OE Effect protein bands (F) and quantitative statistics (G); H indicates high transfection efficiency of overexpressing virus by GFP signal; IJ indicates that ETV4 overexpression enhances LPS-induced NF-κB / MAPK signaling activation. Detailed Implementation

[0045] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0046] Example

[0047] I. Reagents and Materials

[0048]

[0049] II. Experimental Methods

[0050] 1. Cell Culture and Processing

[0051] ARPE-19 cells (human retinal pigment epithelial cells, RPE source) were cultured in DMEM / F12 medium (Gibco, 11330-032) containing 10% fetal bovine serum (FBS, Gibco) and 1% penicillin-streptomycin (100 U / mL).

[0052] Cells were cultured at 37°C and 5% CO2, and grouped as follows:

[0053] Control group: Not processed;

[0054] LPS group: Stimulated with 10 μg / mL LPS for 24 h;

[0055] MTA+LPS group: Pretreatment with 250 μM MTA for 1 h followed by LPS stimulation for 24 h.

[0056] 2. Western blot

[0057] Total protein was extracted from ARPE-19 cells or mouse RPE tissue using RIPA lysis buffer (Beyotime) + PMSF.

[0058] Quantification was performed using the BCA method. 30 μg of protein was loaded, separated by SDS-PAGE, and transferred to a PVDF membrane (Millipore).

[0059] Blocked with 5% skim milk powder for 1 h, incubated with primary antibody at 4°C overnight, and then ECL developed after 1 h with secondary antibody.

[0060] Use ImageJ to analyze relative gray values ​​(normalized to GAPDH).

[0061] 3. Immunofluorescence staining

[0062] Cells were fixed (4% PFA for 15 min), permeabilized with 0.2% Triton X-100 for 10 min, and blocked with 5% BSA for 1 h.

[0063] Add ETV4 antibody (1:200) and incubate overnight at 4°C. The next day, add secondary antibody (Alexa Fluor 488, 1:500) and incubate for 1 hour.

[0064] After DAPI staining, the nuclei were imaged using a Leica TCS SP8 confocal microscope.

[0065] 4. RNA extraction and qPCR

[0066] Total RNA was extracted with Trizol (Invitrogen), purity was determined by NanoDrop (A260 / A280 = 1.8–2.0), and libraries were constructed with RIN ≥ 8.0.

[0067] Reverse transcription (Vazyme R223), qPCR (Bio-Rad CFX96).

[0068] qPCR primer sequences:

[0069] ETV4-F: 5′-GGACTGCTTTGGAAGAGCAG-3′ (SEQ ID NO: 1).

[0070] ETV4-R: 5′-CTGGGCTCTTGTTCTTCACC-3′ (SEQ ID NO: 2).

[0071] GAPDH is an internal reference.

[0072] 5. Lentiviral construction and infection

[0073] ETV4 knockout lentivirus sequence:

[0074] ETV4 sh1:LV-ETV4-RNAi(PSC60213-1) CTGCGTTGTCCCTGAGAAATT(SEQ ID NO:3)。

[0075] ETV4 sh2 :LV-ETV4-RNAi(PSC60214-1) GTCCCTTTGTCCCACTTGGAT(SEQ ID NO:4)。

[0076] ETV4 sh3 :LV-ETV4-RNAi(PSC60215-1) CCGCTCGCTCCGATACTATTA(SEQ ID NO:5)。

[0077]

[0078] Packaging was performed using 293T cells (psPAX2 / pMD2.G system), and the supernatant was collected after 48 h.

[0079] ARPE-19 was infected with MOI=20, and the infection efficiency was confirmed by GFP signal after 48 h.

[0080] Stable strains were screened and used in downstream experiments.

[0081] (6) Animal experiments

[0082] Male C57BL / 6J mice (8 weeks old, 22–25 g) were used.

[0083] Establishment of EIU (endotoxin-induced uveitis) model: LPS (80 μg / animal) was injected intraperitoneally, and RPE tissue was collected 24 h later.

[0084] MTA intervention: Intraperitoneal injection of MTA (25 mg / kg) 1 hour before modeling.

[0085] RPE tissue was dissected under a microscope and used for protein and mRNA detection.

[0086] III. Experimental Results

[0087] 1. MTA downregulates ETV4 expression in RPE cells in an inflammatory eye disease model.

[0088] ETV4 is a major regulator of inflammatory pathways such as NF-κB and MAPK. Figure 1 The results showed that the mRNA and protein levels of ETV4 were increased in both the in vivo and in vitro models induced by LPS, while the expression of ETV4 in ARPE-19 cells was significantly downregulated after the addition of MTA. This indicates that MTA has a direct regulatory effect on ETV4 and can significantly inhibit LPS-induced overexpression of ETV4 in RPE cells.

[0089] 2. ETV4 regulates the inflammatory signaling pathway in RPE cells.

[0090] The effects of ETV4 knockdown and overexpression on the inflammatory pathway in RPE cells were investigated. Results are as follows: Figure 2As shown, under LPS-induced conditions, ETV4 knockdown significantly inhibited the phosphorylation levels of key nodes in the NF-κB and MAPK signaling pathways, including p-p65, p-IκB, pc-Jun, and p-p38, suggesting that the NF-κB and MAPK signaling pathways were downregulated. Overexpression enhanced LPS-induced NF-κB / MAPK signaling activation, and MTA could partially reverse this effect. This indicates that ETV4 is a key target for MTA in regulating the inflammatory response, and that MTA exerts its anti-inflammatory effect by inhibiting ETV4, providing a new strategy and tool for the treatment and efficacy evaluation of RPE-related inflammatory eye diseases.

[0091] The above description of the embodiments is only for understanding the method and core ideas of the present invention. It should be noted that those skilled in the art can make various improvements and modifications to the present invention without departing from the principles of the invention, and these improvements and modifications will also fall within the protection scope of the claims of the present invention.

Claims

1. Use of an ETV4 inhibitor for the manufacture of a medicament for the treatment of uveitis, characterized in that, The ETV4 inhibitor comprises an RNA interference drug; The RNA interference drug is siRNA, and a sequence of the siRNA is shown in any one of SEQ ID NOs: 3-5; The ETV4 inhibitor treats uveitis by inhibiting the NF-κB and MAPK pathways.

Images