Collagen gel for injection, preparation method thereof and injection preparation

Abstract

The invention relates to the technical field of biological materials, in particular to collagen gel for injection, a preparation method of the collagen gel and an injection preparation. The method comprises the following steps: providing recombinant humanized collagen subjected to alkali resistance screening, and mixing the recombinant humanized collagen with a stabilizer to prepare a collagen dispersion liquid, which comprises the following steps: activating a cross-linking agent in an alkaline activating solution to obtain an activated cross-linking agent solution; wherein the cross-linking agent is a diepoxide compound; carrying out cross-linking reaction on the activated cross-linking agent solution and the collagen dispersion liquid to form gel; wherein the mass concentration of the collagen dispersion liquid is 5-10%, and the mass ratio of the cross-linking agent to the collagen is 5-10%; the total weight percentage of the collagen and the cross-linking agent is 5.5 to 10.5 percent. The gel with a stable structure can be effectively formed when the content of the cross-linking agent is within the content range, the residual amount of the cross-linking agent is low, and the storage modulus, the swelling degree and the pushing force of the gel are excellent.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of cosmetics, in particular, to a collagen gel for injection and a preparation method thereof and an injection preparation. BACKGROUND

[0002] Collagen (COL) is one of the most abundant proteins in the human body and is the main component of connective tissue. At present, collagen products on the domestic and foreign markets are widely used in clinical medical fields, covering the repair and reconstruction of skin, skeleton, cartilage, cardiovascular system, oral cavity and lumen tissue, and many other fields such as medical cosmetology and plastic surgery. Collagen is the main structural protein in the human body and plays an important role in cell adhesion, migration, proliferation, differentiation and survival. Collagen accounts for 70-80% of the dermal layer of the face. With age, the dermal collagen is lost or the structure changes, and the transformation of intact type I collagen into fibrous type III collagen produces fine lines and wrinkles. One of the advantages of collagen fillers over hyaluronic acid is that they have lower viscosity and are more effective in correcting fine lines and wrinkles because they fill the treatment site more evenly and naturally when injected on the surface. Another advantage of collagen fillers is that collagen is biocompatible, and the incidence of edema and hematoma after injection is lower than that of other types of products on the market. Collagen fillers have the advantages of high safety, no virus hidden danger, and the characteristics of large-scale industrial production, and have broad application prospects in the field of medical cosmetology.

[0003] At present, collagen is usually compounded with hyaluronic acid to form a composite hydrogel in the field; however, these mainly reflect the properties of sodium hyaluronate cross-linked gels.

[0004] Some other skilled in the art enhance the mechanical properties of collagen and prolong its degradation time in the body by cross-linking. However, for collagen injection products, the cross-linking agent used for cross-linking will eventually enter and exist in the human body for a long time with the collagen, and these cross-linking agents will be toxic to the human body. For example, the commonly used commercial cross-linking method of glutaraldehyde is highly toxic and has high product safety risks. SUMMARY

[0005] The purpose of the embodiments of the present application is to provide a collagen gel for injection and a preparation method thereof and an injection preparation.

[0006] In a first aspect, the present application provides a preparation method of a collagen gel for injection, comprising: providing a recombinant humanized collagen screened for alkali resistance, mixing the recombinant humanized collagen with a stabilizing agent to prepare a collagen dispersion liquid, comprising: The crosslinking agent is activated in the alkaline activation solution to obtain an activated crosslinking agent solution; wherein the crosslinking agent is a bis-epoxide compound. The activated crosslinking agent solution is subjected to a crosslinking reaction with a collagen dispersion solution to form a gel. The mass concentration of the collagen dispersion solution is 5%-10%, the mass ratio of the crosslinking agent to the collagen is 5%-10%, and the total weight percentage of the collagen and the crosslinking agent is 5.5%-10.5%.

[0007] The above technical solution selects the alkali-resistant recombinant collagen in advance, selects the alkali-resistant collagen for crosslinking, creates conditions for the crosslinking of collagen in an alkaline environment, and improves the crosslinking degree and crosslinking efficiency. The recombinant collagen is dissolved in a stabilizer in advance to provide a buffer environment for the strong alkaline environment during the crosslinking of the collagen, which can reduce the denaturation, inactivation, precipitation and degradation of the recombinant collagen caused by rapid pH change, thereby promoting crosslinking, improving the crosslinking degree and the elasticity of the gel, and obtaining a gel with stable structure. The aliphatic diglycidyl ether crosslinking agent has significantly reduced toxicity compared to the commonly used glutaraldehyde, and within the content range of the above application, it can effectively form a gel with stable structure, and the residual amount of the crosslinking agent is low, and the storage modulus, swelling degree and pushing force of the gel are excellent.

[0008] In other embodiments of the present application, the recombinant humanized collagen is mixed with a stabilizer to prepare a collagen dispersion solution, which includes: The recombinant humanized collagen is mixed with a buffer solution to prepare a collagen dispersion solution. Optionally, the pH of the buffer solution is 7.2-7.4. Optionally, the buffer solution includes at least one of a phosphate buffer solution or a tris-hydroxymethyl aminomethane hydrochloride buffer solution.

[0009] In other embodiments of the present application, the above-mentioned recombinant humanized collagen selected for alkali resistance includes: The recombinant humanized collagen with a collagen degradation degree within a preset range is selected by gel electrophoresis analysis under the condition of pH 10-12, as the recombinant humanized collagen selected for alkali resistance.

[0010] In other embodiments of the present application, the crosslinking agent includes any one of ethylene glycol diglycidyl ether, diethylene glycol diglycidyl ether, polyethylene glycol diglycidyl ether, polypropylene glycol diglycidyl ether or 1,6-hexanediol diglycidyl ether.

[0011] In other embodiments of the present application, the crosslinking agent is activated in the alkaline activation solution, which includes: The cross-linking agent is added to the alkaline activation solution, which is a sodium hydroxide or potassium hydroxide solution with a mass concentration of 0.5%-2%; Optionally, the volume ratio of the cross-linking agent to the alkaline activation solution is (1:5)-(1:15).

[0012] In other embodiments of the present application, the activated cross-linking agent solution is subjected to a cross-linking reaction with a collagen solution, including: The activated cross-linking agent solution is reacted with the recombinant collagen solution at 30-60°C for 3-24 hours.

[0013] In other embodiments of the present application, after the cross-linking reaction forms a stable gel, the pH is adjusted to neutral to terminate the reaction, and the gel is dialyzed in a phosphate buffered saline solution for 24-48 hours.

[0014] In other embodiments of the present application, the nucleotide sequence of the recombinant humanized collagen includes the sequence shown in SEQ ID NO: 1. The nucleotide sequence shown in SEQ ID NO: 1 is: atggggcctc aaggtattgc tggacagcgt ggtgtggtcg gcctgcctgg tcagagaggagagagaggct tccctggtct tcctggcccc tctggtgaac ctggcaaaca aggtccctct ggagcaagtggtgaacgtgg tccccctggt cccatgggcc cccctggatt ggctggaccc cctggtgaat ctggacgtgagggggctcct ggtgccgaag gttcccctgg acgagacggt tctcctggcg ccaagggtga ccgtggtgagaccggccccg ctggaccccc tggtgctcct ggtgctcctg gtgcccctgg ccccgttggc cctgctggcaagagtggtga tcgtggtgag actggtcctg ctggtcccgc cggagaacga ggtggccctg gaggacctggccctcagggt cctcctggaa agaatggtga aactggacct cagggacccc cagggcctac tgggcctggtggtgacaaag gagacacagg accccctggt ccacaaggat tacaaggctt gcctggtaca ggtggtcctccaggagaaaa tggaaaacct ggggaaccag gtccaaaggg tgatgccggt gcacctggag ctccaggaggcaagggtgat gctggtgccc ctggtgaacg tggacctcct ggattggcag gggccccagg acttagaggtggagctggtc cccctggtcc cgaaggagga aagggtgctg ctggtcctcc tgggccacct ggtgctgctggtactcctgg actacaagga atgcctggcc cgccaggtcc atgctgtgga ggtggataa.

[0015] In other embodiments of the present application, the recombinant humanized collagen has a molecular weight of 25 KD - 55 KD.

[0016] In a second aspect, the present application provides a collagen gel for injection prepared by the method for preparing the collagen gel for injection according to any one of the first aspect.

[0017] In other embodiments of the present application, the collagen gel for injection has a crosslinking agent residual amount of less than 2.0 μg / g.

[0018] In other embodiments of the present application, the collagen gel for injection has a storage modulus of 150 Pa to 250 Pa at a frequency of 0.1 Hz.

[0019] In other embodiments of the present application, the collagen gel for injection has a loss modulus of 14 Pa to 25 Pa at a frequency of 0.1 Hz.

[0020] In other embodiments of the present application, the collagen gel for injection has a push force of 10 N to 20 N.

[0021] In a third aspect, the present application provides an injection preparation comprising the collagen gel prepared by the method for preparing the collagen gel for injection according to any one of the first aspect; or the injection preparation comprises the collagen gel for injection according to any one of the second aspect. BRIEF DESCRIPTION OF DRAWINGS

[0022] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed in the embodiments will be briefly introduced as follows. It should be understood that the following drawings only show some embodiments of the present application, and therefore should not be regarded as a limitation on the scope. Other related drawings can also be obtained by those skilled in the art without creative labor.

[0023] Figure 1 Figure is a collagen alkali resistance screening result graph; Figure 2 Figure is a physical picture of the sample after high temperature sterilization according to the embodiments and comparative examples of the present application; wherein, Figure 2 From left to right, the physical pictures of the samples after high temperature sterilization of Comparative Example 1, Example 1, Example 2, and Example 3 are shown. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical solutions and advantages of the embodiments of the present application more clear, the technical solutions in the embodiments of the present application will be described clearly and completely below. Obviously, the described embodiments are only some of the embodiments of the present application, not all of the embodiments.

[0025] Therefore, the following detailed description of embodiments of the application is not intended to limit the scope of the application as claimed, but merely represents selected embodiments of the application. Based upon the embodiments in the present application, all other embodiments that a person of ordinary skill in the art obtains without creative labor are within the scope of protection of the present application.

[0026] After research, some cross-linking agents, such as BDDE (less toxic), need to be cross-linked under alkaline conditions, but alkaline conditions will make COL unstable and decompose. Most recombinant collagens are stable under acidic conditions, so collagen raw materials are stored in an acidic environment for a long time, and therefore the pH of the collagen cross-linking reaction solution needs to be adjusted. Generally, the pH of the collagen solution is 3-4.5; the suitable reaction pH of BDDE and other cross-linking agents is 8-12, and the pH adjustment span is large. The addition of alkaline solution will cause a large change in the conformation of collagen molecules, which may cause protein denaturation, inactivation and degradation; on the other hand, a large amount of salt will be introduced during the pH adjustment process, causing a change in the conductivity of the solution. The sharp change in conductivity will also cause protein molecules to degrade and the molecular weight to decrease, and the gel cannot be cross-linked.

[0027] Based on the above research, the present application provides a preparation method of collagen gel for injection, comprising: providing recombinant humanized collagen screened for alkali resistance, mixing the recombinant humanized collagen with a stabilizer to prepare a collagen dispersion liquid, comprising: activating the cross-linking agent in an alkaline activation solution to obtain an activated cross-linking agent solution; wherein the cross-linking agent is a bis-epoxide compound; cross-linking the activated cross-linking agent solution with the collagen solution to form a gel; wherein the mass concentration of the collagen solution is 5%-10%, the mass ratio of the cross-linking agent to the collagen is 5%-10%, and the total weight percentage of the collagen and the cross-linking agent is 5.5%-10.5%.

[0028] The above technical solution, by screening the alkali-resistant recombinant collagen in advance, selecting the alkali-resistant collagen for cross-linking, creating conditions for collagen cross-linking in an alkaline environment, and improving the cross-linking degree and cross-linking efficiency. The present application dissolves the recombinant collagen in the stabilizer in advance to provide a buffer environment for the strong alkaline environment during collagen cross-linking, which can reduce the denaturation and degradation of recombinant collagen caused by rapid PH change, thereby promoting cross-linking, improving cross-linking degree and gel elasticity. The aliphatic diglycidyl ether cross-linking agent has significantly reduced toxicity compared to the commonly used glutaraldehyde, and within the content range described above, it can effectively form a structure-stable gel with low residual cross-linking agent, excellent storage modulus, swelling degree, and pushing force.

[0029] Further, in some embodiments of the present application, the preparation method of the collagen gel for injection comprises the following steps: Step S1, providing an alkali-resistant screened recombinant humanized collagen, and preparing the recombinant humanized collagen into a collagen solution.

[0030] Further, in some embodiments of the present application, the alkali-resistant screened recombinant humanized collagen comprises: Under the condition of pH 10-12, the recombinant humanized collagen with a degradation degree within a preset range is screened by gel electrophoresis analysis, and is used as the alkali-resistant screened recombinant humanized collagen.

[0031] For example, in some embodiments of the present application, under the condition of pH 10, 10.5, 11, 11.5, 12 or a range between any two of the above values, the recombinant humanized collagen with a degradation degree within a preset range is screened by gel electrophoresis analysis, and is used as the alkali-resistant screened recombinant humanized collagen.

[0032] Further optionally, in some embodiments of the present application, the degradation of the recombinant humanized collagen is analyzed by SDS-PAGE gel electrophoresis to screen the recombinant collagen with a degradation degree within a preset range as the main raw material of the product.

[0033] Further optionally, in some embodiments of the present application, the above-mentioned preset range refers to that the degradation degree of the recombinant collagen does not exceed 5%. For example, the degradation degree of the recombinant collagen is screened to be within a range between 1%, 2%, 3%, 4% or any two of the above values.

[0034] Further, in other embodiments of the present application, the mixing of the recombinant humanized collagen with the stabilizer to prepare a collagen dispersion liquid comprises: The recombinant humanized collagen is mixed with a buffer solution to form a collagen dispersion liquid, and the pH of the buffer solution is 7.2-7.4. For example, the pH of the buffer solution is 7.2, 7.3, 7.4, or a range between any two of the aforementioned values.

[0035] Optionally, the buffer solution comprises at least one of a phosphate buffer solution or a tris-hydroxymethyl aminomethane hydrochloride buffer solution.

[0036] Further, in other embodiments of the present application, the mass concentration of the collagen dispersion liquid is 5%-10%.

[0037] For example, the mass concentration of the collagen dispersion liquid is 5%, 6%, 7%, 8%, 9%, 10%, or a range between any two of the aforementioned values.

[0038] For example, in some embodiments of the present application, the recombinant collagen is fully dissolved in a stabilizer to form a recombinant collagen solution. The collagen is a recombinant humanized collagen, such as type I, type III, and chimeric collagen. The mass concentration of the recombinant collagen solution is 5%-10%. The molecular weight is greater than 20KD, and the solvent is a phosphate buffer solution with a pH of 7.2-7.4.

[0039] Further, in some embodiments of the present application, the nucleotide sequence of the recombinant humanized collagen comprises the sequence shown in SEQ ID NO: 1. The nucleotide sequence shown in SEQ ID NO: 1 is: atggggcctc aaggtattgc tggacagcgt ggtgtggtcg gcctgcctgg tcagagaggagagagaggct tccctggtct tcctggcccc tctggtgaac ctggcaaaca aggtccctct ggagcaagtggtgaacgtgg tccccctggt cccatgggcc cccctggatt ggctggaccc cctggtgaat ctggacgtgagggggctcct ggtgccgaag gttcccctgg acgagacggt tctcctggcg ccaagggtga ccgtggtgagaccggccccg ctggaccccc tggtgctcct ggtgctcctg gtgcccctgg ccccgttggc cctgctggcaagagtggtga tcgtggtgag actggtcctg ctggtcccgc cggagaacga ggtggccctg gaggacctggccctcagggt cctcctggaa agaatggtga aactggacct cagggacccc cagggcctac tgggcctggtggtgacaaag gagacacagg accccctggt ccacaaggat tacaaggctt gcctggtaca ggtggtcctccaggagaaaa tggaaaacct ggggaaccag gtccaaaggg tgatgccggt gcacctggag ctccaggaggcaagggtgat gctggtgccc ctggtgaacg tggacctcct ggattggcag gggccccagg acttagaggtggagctggtc cccctggtcc cgaaggagga aagggtgctg ctggtcctcc tgggccacct ggtgctgctggtactcctgg actacaagga atgcctggcc cgccaggtcc atgctgtgga ggtggataa.

[0040] Further, in some embodiments of the present application, the recombinant humanized collagen has a molecular weight of 25 KD - 55 KD.

[0041] Exemplarily, in some embodiments of the present application, the molecular weight of the recombinant humanized collagen is 25 KD, 26 KD, 27 KD, 28 KD, 29 KD, 30 KD, 31 KD, 32 KD, 33 KD, 34 KD, 35 KD, 36 KD, 37 KD, 38 KD, 39 KD, 40 KD, 41 KD, 42 KD, 43 KD, 44 KD, 45 KD, 48 KD, 50 KD, 51 KD, 52 KD, 53 KD, 54 KD, 55 KD, or a range between any two of the aforementioned values.

[0042] In step S2, the crosslinking agent is activated in the alkaline activation solution to obtain an activated crosslinking agent solution; wherein the crosslinking agent is an aliphatic diglycidyl ether crosslinking agent.

[0043] Further optionally, in some embodiments of the present application, the crosslinking agent comprises any one of ethylene glycol diglycidyl ether, diethylene glycol diglycidyl ether, polyethylene glycol diglycidyl ether, polypropylene glycol diglycidyl ether, or 1,6-hexanediol diglycidyl ether.

[0044] Further optionally, in some embodiments of the present application, the activation treatment of the crosslinking agent in the alkaline activation solution comprises: The crosslinking agent is added to the alkaline activation solution, and the alkaline activation solution is a sodium hydroxide or potassium hydroxide solution with a mass concentration of 0.5%-2%.

[0045] Exemplarily, in some embodiments of the present application, the crosslinking agent is added to the alkaline activation solution, and the alkaline activation solution is a sodium hydroxide or potassium hydroxide solution with a mass concentration of 0.5%, 0.6%, 0.7%, 0.8%, 0.9%, 1.0%, 1.1%, 1.2%, 1.3%, 1.4%, 1.5%, 1.6%, 1.7%, 1.8%, 1.9%, 2%, or a range between any two of the aforementioned values.

[0046] Further optionally, in some embodiments of the present application, the volume ratio of the crosslinking agent to the alkaline activation solution is (1:5)-(1:15).

[0047] Exemplarily, in some embodiments of the present application, the volume ratio of the crosslinking agent to the alkaline activation solution is (1, 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, or a range between any two of the aforementioned values)-(1, 2, 3, 4, 5, 8, 10, 12, 13, 14, 15, or a range between any two of the aforementioned values).

[0048] Exemplarily, in some embodiments of the present application, the crosslinking agent is activated by being added to the crosslinking activation solution, and the volume ratio of the crosslinking agent to the activator is 1:5-1:15, preferably 1:10.

[0049] Exemplarily, in some embodiments of the present application, the purity of the crosslinking agent is 99% or above, and the activating solution is a 0.5-2% sodium / potassium hydroxide solution, preferably a 1% sodium / potassium hydroxide solution.

[0050] Step S3, crosslinking reaction between the activated crosslinking agent solution and the collagen dispersion solution, includes: The activated collagen dispersion solution is reacted with the recombinant collagen solution at 30-60°C for 3-24 hours.

[0051] Exemplarily, in some embodiments of the present application, the activated crosslinking agent solution is reacted with the collagen dispersion solution at 30°C, 32°C, 35°C, 38°C, 40°C, 42°C, 45°C, 48°C, 50°C, 52°C, 55°C, 58°C, 60°C, or a temperature range between any two of the foregoing temperatures, for 3, 4, 5, 8, 10, 12, 15, 18, 20, 21, 22, 23, 24 hours, or a time range between any two of the foregoing values.

[0052] Further, in some embodiments of the present application, the mass ratio of the crosslinking agent to the collagen is 5-10%.

[0053] Exemplarily, in some embodiments of the present application, the mass ratio of the crosslinking agent to the collagen is 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, 10%, or a range between any two of the foregoing values.

[0054] Exemplarily, in some embodiments of the present application, the amino acid sequence of the recombinant collagen is analyzed by software to calculate the proportion of active reaction sites in the crosslinking system. The active reaction site of the collagen is the primary amino group on the collagen. The primary amine (-NH2) in the collagen mainly comes from: (1) the N-terminal amino group of each peptide chain (1 from each peptide chain).

[0055] (2) the side chain amino group of lysine (Lys) and hydroxylysine (Hyl) (1 from each Lys / Hyl).

[0056] (3) Total primary amine number = Σ [ (number of Lys + Hyl in each chain) + 1 (N-terminus) ] - loss of primary amine caused by modification**. 4) Both lysine (Lys) and hydroxylysine (Hyl) in the sequence are represented as K, only need to count the number of K in each chain, then see the N-terminal amino group, if it is K, then no need to +1, if it is not K, then +1, recombinant humanized protein without triple helix structure is not considered modification. According to the above proportion, the proportion of active sites of collagen protein is calculated, the proportion of reaction groups is accurately calculated, the reaction conditions are optimized, the reaction efficiency is improved, the use of crosslinking agent is minimized under the premise of generating the same performance gel, and the product safety is improved.

[0057] Exemplarily, in some embodiments of the present application, the crosslinking agent is 1,4-butanediol glycidyl ether (BDDE), the ratio of crosslinking agent / collagen is 5-10%, and the total weight percentage of collagen and crosslinking agent is 5.5%-10.5%.

[0058] Based on the long-term research and use history of BDDE, the safety of BDDE has been studied a lot, and it is within the controllable range of safety. The present application uses BDDE as the crosslinking agent of recombinant collagen protein to obtain an injectable recombinant collagen protein gel through research on the reaction concentration of recombinant collagen protein, the proportion of crosslinking agent, the reaction temperature, the reaction PH, the reaction time, elution and dialysis, granulation and screening, and wet heat sterilization. The gel prepared by the present application has strong viscoelasticity, small residual amount of crosslinking agent, better tissue compatibility, simple preparation process, and is suitable for industrial production.

[0059] Further optionally, after the crosslinking reaction forms a stable gel, the pH is adjusted to neutral to terminate the reaction, and the gel is dialyzed in a phosphate buffer solution for 24-48 hours. Exemplarily, the gel is dialyzed in a phosphate buffer solution for 24 hours, 25 hours, 28 hours, 30 hours, 32 hours, 36 hours, 38 hours, 40 hours, 42 hours, 45 hours, 48 hours, or a range between any two of the foregoing values.

[0060] Exemplarily, in some embodiments of the present application, the activated crosslinking agent solution is added to the recombinant collagen protein solution, and the reaction is carried out at 30-60°C for 3-24 hours. The higher the reaction temperature, the shorter the required reaction time. After the reaction forms a stable gel, the pH is adjusted to neutral to terminate the reaction, and the gel is dialyzed in a phosphate buffer solution for 24-48 hours. The gel after dialysis is repeatedly screened with a 60-mesh screen for 3 times, and sterilized to obtain a crosslinked recombinant collagen protein gel.

[0061] Some embodiments of the present application provide an injectable collagen protein gel prepared by the preparation method of the injectable collagen protein gel provided by any of the foregoing embodiments.

[0062] Further, in some embodiments of the present application, the residual amount of crosslinking agent in the collagen gel for injection is less than 2.0 μg / g; illustratively, the residual amount of crosslinking agent in the collagen gel for injection is less than 1.5 μg / g, 1.0 μg / g, 0.8 μg / g, 0.5 μg / g, 0.2 μg / g, 0.1 μg / g, or a range between any two of the aforementioned values.

[0063] Further, in some embodiments of the present application, the storage modulus of the collagen gel for injection at a frequency of 0.1 Hz is between 150 Pa and 250 Pa; illustratively, the storage modulus of the collagen gel for injection at a frequency of 0.1 Hz is 150 Pa, 155 Pa, 160 Pa, 170 Pa, 180 Pa, 190 Pa, 200 Pa, 210 Pa, 220 Pa, 230 Pa, 240 Pa, 250 Pa, or a range between any two of the aforementioned values.

[0064] Further, in some embodiments of the present application, the loss modulus of the collagen gel for injection at a frequency of 0.1 Hz is between 14 Pa and 25 Pa; illustratively, the loss modulus of the collagen gel for injection at a frequency of 0.1 Hz is 14 Pa, 15 Pa, 18 Pa, 20 Pa, 21 Pa, 22 Pa, 23 Pa, 24 Pa, 25 Pa, or a range between any two of the aforementioned values.

[0065] Further, in some embodiments of the present application, the push force of the collagen gel for injection is between 10 N and 20 N. Illustratively, the push force of the collagen gel for injection is 10 N, 11 N, 12 N, 13 N, 14 N, 15 N, 16 N, 17 N, 18 N, 19 N, 20 N, or a range between any two of the aforementioned values.

[0066] Some embodiments of the present application provide an injection preparation comprising the collagen gel prepared by the method for preparing the collagen gel for injection according to any one of the preceding embodiments; or the injection preparation comprises the collagen gel for injection according to any one of the preceding embodiments.

[0067] The features and properties of the present application are further described in detail below in conjunction with the examples: Screening of raw materials for alkali resistance: Screening of recombinant humanized collagen with good alkali resistance under the condition of pH = 11, analyzing the degradation of recombinant humanized collagen by SDS-PAGE gel electrophoresis, and screening the recombinant collagen with the lowest degradation degree (degradation degree not more than 5%) as the raw material of collagen in each of the following examples and comparative examples; the screening results are shown in the attached Figure 1 ; according to Figure 1As a result, it can be seen that the collagen No. 3 is most stable in the alkaline environment, and therefore the collagen No. 3 is selected as the raw material for the following examples and comparative examples.

[0068] The nucleotide sequence of the recombinant collagen No. 3 includes the sequence as shown in SEQ ID NO: 1; The nucleotide sequence as shown in SEQ ID NO: 1 is: atggggcctc aaggtattgc tggacagcgt ggtgtggtcg gcctgcctgg tcagagaggagagagaggct tccctggtct tcctggcccc tctggtgaac ctggcaaaca aggtccctct ggagcaagtggtgaacgtgg tccccctggt cccatgggcc cccctggatt ggctggaccc cctggtgaat ctggacgtgagggggctcct ggtgccgaag gttcccctgg acgagacggt tctcctggcg ccaagggtga ccgtggtgagaccggccccg ctggaccccc tggtgctcct ggtgctcctg gtgcccctgg ccccgttggc cctgctggcaagagtggtga tcgtggtgag actggtcctg ctggtcccgc cggagaacga ggtggccctg gaggacctggccctcagggt cctcctggaa agaatggtga aactggacct cagggacccc cagggcctac tgggcctggtggtgacaaag gagacacagg accccctggt ccacaaggat tacaaggctt gcctggtaca ggtggtcctccaggagaaaa tggaaaacct ggggaaccag gtccaaaggg tgatgccggt gcacctggag ctccaggaggcaagggtgat gctggtgccc ctggtgaacg tggacctcct ggattggcag gggccccagg acttagaggtggagctggtc cccctggtcc cgaaggagga aagggtgctg ctggtcctcc tgggccacct ggtgctgctggtactcctgg actacaagga atgcctggcc cgccaggtcc atgctgtgga ggtggataa.

[0069] Example 1 A method for preparing a collagen gel for injection is provided, and a solution is prepared according to the proportions in Table 1. The method for preparing the collagen gel for injection includes the following steps: (1) Take the formula amount of collagen protein, add to 8 ml of phosphate buffer solution with pH = 7.2-7.4, stir slowly until clear and transparent, to obtain a cross-linked protein dispersion; (2) Add cross-linking agent 1,4-butanediol glycidyl ether (BDDE) to 1wt% sodium hydroxide solution according to the formula proportion, to obtain a cross-linking agent dispersion; (3) Add the cross-linking agent dispersion obtained in step (2) to the collagen protein dispersion obtained in step (1), adjust the pH to 12 with 1wt% sodium hydroxide solution, and make up water according to the collagen protein reaction concentration (weight percentage) in the formula, stir at 60r / min for 5min; (4) Then water bath heating according to the reaction temperature in the formula, according to the reaction time, observe the gelation result; (5) After the reaction is completed, adjust the pH to neutral, terminate the reaction with 0.5m / L hydrochloric acid, dialyze the gel obtained after dialysis for 24-48h with 20Mmph7.0 phosphate buffer solution, repeat sieving the gel through a 60 mesh sieve for 3 times, fill into pre-filled syringes, and sterilize at 121℃ for 10min, to obtain collagen protein gel for injection.

[0070] Examples 2-6 The preparation steps are the same as in Example 1, and the differences are shown in Table 1.

[0071] Comparative Examples 1-4 The preparation steps are the same as in Example 1, and the differences are shown in Table 1.

[0072] Comparative Example 5 A preparation method of collagen protein gel for injection is provided, according to the proportion in Table 1, the related solutions are prepared, and the preparation method comprises the following steps: (1) Take the formula amount of collagen protein, add to 8 ml of water, stir to obtain a collagen protein water mixture (clear solution); (2) Add cross-linking agent 1,4-butanediol glycidyl ether (BDDE) to 1wt% sodium hydroxide solution according to the formula proportion, to obtain a cross-linking agent dispersion; (3) Add the cross-linking agent dispersion obtained in step (2) to the collagen protein water mixture obtained in step (1), adjust the pH to 12 with 1wt% sodium hydroxide solution, and make up water according to the collagen protein reaction concentration (weight percentage) in the formula, stir at 60r / min for 5min; (4) Then water bath heating according to the reaction temperature in the formula, according to the reaction time, observe the gelation result; (4) After the reaction is completed, the pH is adjusted to neutral, the reaction is terminated with 0.5 m / L hydrochloric acid, and the gel after dialysis is repeatedly sieved three times with a 60-mesh sieve, filled into pre-sealed syringes, and sterilized at 121°C for 10 min to obtain collagen gel for injection.

[0073] Comparative Example 6 A preparation method of collagen gel for injection is provided. According to the proportion in Table 1, the relevant solutions are prepared, and the preparation method comprises the following steps: (1) A formula amount of collagen is added to 8 ml of a phosphate buffer solution with a pH of 7.2-7.4, and slowly stirred until clear and transparent to obtain a cross-linked protein dispersion; (2) A cross-linking agent, 1,4-butanediol glycidyl ether (BDDE), is added to the collagen dispersion obtained in step (1) according to the formula proportion, and a 1wt% sodium hydroxide solution is used to adjust the pH to 12, and water is added according to the collagen reaction concentration (weight percentage) in the formula, and stirred at 60 r / min for 5 min; (3) Water bath heating is performed according to the reaction temperature in the formula, and the gelation result is observed according to the reaction time; (4) After the reaction is completed, the pH is adjusted to neutral, the reaction is terminated with 0.5 m / L hydrochloric acid, and the gel after dialysis is repeatedly sieved three times with a 60-mesh sieve, filled into pre-sealed syringes, and sterilized at 121°C for 10 min to obtain collagen gel for injection.

[0074] Comparative Example 7 A preparation method of collagen gel for injection is provided. According to the proportion in Table 1, the relevant solutions are prepared, and the preparation method comprises the following steps: (1) A formula amount of a mixture of collagen and sodium hyaluronate is added to 8 ml of a phosphate buffer solution with a pH of 7.2-7.4, and slowly stirred until clear and transparent to obtain a cross-linked protein sodium hyaluronate dispersion; (2) A cross-linking agent, 1,4-butanediol glycidyl ether (BDDE), is added to a 1wt% sodium hydroxide solution according to the formula proportion to obtain a cross-linking agent dispersion; (3) The cross-linking agent dispersion obtained in step (2) is added to the collagen sodium hyaluronate dispersion obtained in step (1), and a 1wt% sodium hydroxide solution is used to adjust the pH to 12, and water is added according to the collagen reaction concentration (weight percentage) in the formula, and stirred at 60 r / min for 5 min; (4) According to the reaction temperature in the formula, water bath heating is performed, and the gelation result is observed according to the reaction time; (5) After the reaction is completed, the pH is adjusted to neutral, the reaction is terminated with 0.5 m / L hydrochloric acid, dialysis is performed for 24-48 h with 20 M pH 7.0 phosphate buffer salt solution, the gel after dialysis is repeatedly screened with a 60-mesh screen three times, filled into pre-filled syringes, and subjected to moist heat sterilization at 121°C for 10 min to obtain collagen gel for injection.

[0075] Table 1

[0076] The properties of the products obtained in each of the above examples and comparative examples are tested. I. Gelation reaction The gelation reaction results of each example and comparative example are shown in Table 1 and the accompanying drawings of the specification. Figure 2 .

[0077] From the above results, it can be seen that: It can be seen from Examples 1-6 and Comparative Examples 1-4 that when the reaction concentration of collagen is 5%-10%, the ratio of crosslinking agent / collagen is 5%-10%, and the total weight percentage of collagen and crosslinking agent is 5.5%-10.5%, effective gelation can occur. This shows that the crosslinked recombinant collagen gel prepared according to the process of the examples meets the requirements for implantation.

[0078] Further, when the concentration of collagen is less than 5% in Comparative Example 1 compared with Example 1, the concentration of collagen in the reaction system is too low, the distance between molecules is too large, and the crosslinking agent cannot connect the molecular chains to form a stable interpenetrating network gel.

[0079] Further, when the ratio of crosslinking agent / recombinant collagen is less than 5% in Comparative Example 2 compared with Example 1, the proportion of crosslinking agent in the reaction system is low, which reduces the connection efficiency of the crosslinking agent between the molecular chains of collagen, resulting in an unstable gel structure, and the gel structure is destroyed after high-temperature sterilization.

[0080] Further, Comparative Example 3 and Example 6, and Comparative Example 4 and Example 1 can be compared to see that the gel properties are close, indicating that increasing the proportion of collagen or crosslinking agent to some extent cannot improve the gel properties, but only increases the production cost.

[0081] Further, Comparative Examples 5-6 and Example 3 can be compared to see that if the collagen is not dissolved in advance with a stabilizing agent and the crosslinking agent is not activated in advance with an activating solution, the crosslinking efficiency will be greatly reduced, and the prepared gel structure is destroyed after high-temperature sterilization.

[0082] accompanying drawings of the specification.Figure 2 From left to right, respectively, the sample high temperature sterilization of Comparative Example 1, Example 1, Example 2, Example 3; it can be seen that after high temperature sterilization, Comparative Example 1 is not in a gel state, while Examples 1, 2 and 3 are in a gel state after high temperature sterilization.

[0083] II. Test the viscoelasticity, swelling degree, push force, and BDDE residue evaluation of the gels of each example and comparative example before moist heat sterilization.

[0084] 1. Viscoelasticity test: the gels prepared in each example and comparative example were tested for viscoelasticity using an Anton Paar M302 rotational rheometer, with the following conditions: rotor: P20Ti; temperature: 25°C; Gap value: 1.00 mm; measurement mode: oscillation frequency sweep CD; stress: 1%; frequency range: 0.01-1 Hz. The storage modulus (G') and loss modulus (G") at 0.1 Hz frequency were recorded. The test results of each example and comparative example are shown in Table 2.

[0085] 2. Swelling degree test: according to the state of the crosslinked gel, it can be seen that the amount of crosslinking agent added, reaction temperature and reaction time are the main factors affecting the crosslinking strength of the recombinant collagen gel. It is the main performance index to characterize the crosslinking degree of the recombinant collagen gel, which changes the swelling degree of the polymer by affecting the diffusion and adsorption behavior of solvent molecules in the polymer network. The test was carried out according to the method for measuring the swelling degree of the crosslinked sodium hyaluronate gel in Appendix B of YY / T 0962-2021. A 500-mesh screen (8 cm x 8 cm square, folded into a 4 cm x 4 cm x 2 cm square groove) was placed in a drying oven, and the constant weight was recorded as m0 at 80°C. 0.2-0.5 g of gel sample of each example and comparative example was precisely weighed and placed on the 500-mesh screen. The screen was placed in an evaporating dish, and 30 mL of 0.9% sodium chloride solution was added at one time to make it completely wet the sample. After the test sample was fully swollen (at least 30 min), the screen and test sample were taken out, and the liquid at the bottom and periphery of the screen was absorbed with filter paper until there was no wet mark on the filter paper. The mass was recorded as m1. Then the screen was placed in a drying oven, and the constant weight was recorded as m2 at 80°C. According to the formula: In the formula: Q is the swelling degree of the test sample; m1 is the mass of the screen plus the test sample, in grams (g); m2 is the mass of the screen plus the test sample after drying, in grams (g); m0 is the mass of the screen after constant weight, in grams (g), and the swelling degree Q is calculated. The test results of each example and comparative example are shown in Table 2.

[0086] 3. Push force test The test was performed according to YY / T 0962-2021 Appendix A push force determination method for cross-linked sodium hyaluronate gel for plastic surgery with a 27G sterile disposable injection needle. The test results of each example and comparative example are shown in Table 2.

[0087] 4. BDDE residual test 0.08 g of BDDE was weighed into a 1,000 mL volumetric flask, mixed with PBS buffer, and prepared into an 80 μg / g stock solution, then gradient diluted to prepare BDDE standard solutions with concentrations of 8.0, 4.0, 2.0, 1.0, 0.5, 0.25, and 0 μg / g. 0.2 mL of each concentration standard solution was taken, 0.1 mL of nicotinamide solution with a concentration of 125 mmol / L was added, mixed well, and placed in a 37°C water bath for 2 h; then 1 mL of 15% acetophenone solution and 1 mL of 1 mol / L potassium hydroxide solution were added in turn, mixed well, and placed in an ice bath for 10 min, and 5 mL of formic acid was added, 60°C water bath for 5 min, ice bath cooling; finally, the fluorescence value was measured by fluorescence spectrophotometer, the excitation and emission wavelengths were 380 nm and 435 nm respectively, and the BDDE standard curve was drawn. Collagenase was used to degrade the cross-linked recombinant collagen gel injection to prepare a degradation solution. The specific operation is as follows: 1 g of cross-linked gel was taken, 1 mL of 3 mg / mL collagenase PBS solution was added, mixed well, and incubated at 37°C for 24 h to obtain the degradation solution. 0.2 mL of the degradation solution was taken, 0.1 mL of nicotinamide solution with a concentration of 125 mmol / L was added, mixed well, and placed in a 37°C water bath for 2 h; then 1 mL of 15% acetophenone solution and 1 mL of 1 mol / L potassium hydroxide solution were added in turn, mixed well, and placed in an ice bath for 10 min, and 5 mL of formic acid was added, 60°C water bath for 5 min, ice bath cooling; finally, the fluorescence value was measured by fluorescence spectrophotometer, the excitation and emission wavelengths were 380 nm and 435 nm respectively, and the fluorescence value was obtained. The fluorescence value was substituted into the standard curve to obtain the concentration of BDDE. The test results of each example and comparative example are shown in Table 2.

[0088] Table 2

[0089] According to the above test results, the following conclusions can be drawn: The results of Examples 1-6 and Comparative Examples 1-4 are compared, and when the reaction concentration of collagen is 5%-10%, the ratio of crosslinking agent / collagen is 5-10%, and the total weight percentage of collagen and crosslinking agent is 5.5%-10.5%, the crosslinked recombinant collagen gel prepared according to the process of the examples of the present application meets the requirements for implantation, and the swelling degree, pushing force and crosslinking agent residue all meet the requirements. The residual amount of crosslinking agent in the collagen gel for injection obtained by the examples of the present application is less than 2.0 μg / g; the storage modulus of the collagen gel for injection at a frequency of 0.1 Hz is between 150 Pa and 250 Pa; the loss modulus of the collagen gel for injection at a frequency of 0.1 Hz is between 14 Pa and 25 Pa; and the pushing force of the collagen gel for injection is 10 N-20 N. The swelling degree of the collagen gel for injection is less than 20.61, and is between 16.84-20.61.

[0090] Further, by comparing Comparative Example 2 with Example 1, it can be seen that when the ratio of crosslinking agent in Comparative Example 2 is less than 5%, the ratio of crosslinking agent in the reaction system is low, which reduces the efficiency of crosslinking agent in connecting the molecular chains of collagen, resulting in unstable gel structure, low crosslinking degree and high swelling degree of the formed gel.

[0091] Further, by comparing Comparative Example 4 with Example 1, it can be seen that the gel performance is similar, but the crosslinking agent residue in Comparative Example 4 is greatly increased, which has a great safety hazard.

[0092] III. Cell proliferation experiment The gels prepared in Example 4 and Comparative Example 7 were subjected to a cell proliferation experiment.

[0093] The specific steps of the cell proliferation experiment are as follows: Logarithmic growth phase BJ cells (human fibroblasts) were inoculated into a 96-well plate at a density of 5*10 4 Each sample was diluted to 4 concentrations with serum-free medium and added to the 96-well plate. Three replicate wells were set up, and a blank control group (2% FBS) and a positive control group (10% FBS) were also set up. Incubation was continued for 24 h, and the cell morphology and number were observed periodically under a microscope. After 48 h, CCK-8 was diluted 10-fold with serum-free medium, 100 μL of the CCK-8 diluent was added to each well, and then incubation was carried out in a 37°C incubator for 0.5 h. The absorbance value was detected using a microplate reader at a detection wavelength of 450 nm. Test sample group: the sample was diluted to 0.5%, 2.0%, 5.0% and 10.0% with medium containing 2% serum. Blank control group: medium containing 2% serum.

[0094] Test result calculation: Cell survival rate (%) = OD test / OD blank x 100% In the formula: OD test - the absorbance of the test hole or the solvent control hole; OD blank - the absorbance of the blank hole.

[0095] The test results of the cell proliferation experiment are shown in Table 3.

[0096] Table 3

[0097] From the test results of Table 3 above, it can be seen that: Example 4 has a significant effect of promoting cell proliferation, but Comparative Example 7 has no significant effect on cell proliferation, indicating that the introduction of sodium hyaluronate can weaken the cell proliferation effect of the gel and affect the clinical effect after gel injection.

[0098] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Those skilled in the art can make various modifications and changes to the present application. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. A method for preparing a collagen gel for injection, characterized by, The application relates to a preparation method of collagen gel for injection. The application provides a recombinant humanized collagen which is resistant to alkaline, and the collagen is mixed with a stabilizer to prepare a collagen dispersion liquid; The crosslinking agent is activated in an alkaline activation solution to obtain an activated crosslinking agent solution; wherein the crosslinking agent is a bisepoxide compound; The activated crosslinking agent solution is crosslinked with the collagen dispersion liquid to form a gel; The mass concentration of the collagen dispersion liquid is 5%-10%, the mass ratio of the crosslinking agent to the collagen is 5%-10%, and the total weight percentage of the collagen and the crosslinking agent is 5.5%-10.5%.

2. The preparation method of the collagen gel for injection according to claim 1, wherein the mixing of the recombinant humanized collagen with the stabilizer to prepare the collagen dispersion liquid comprises the following steps: The recombinant humanized collagen is mixed with a buffer solution to prepare the collagen dispersion liquid, and optionally, the pH of the buffer solution is 7.2-7.4; and optionally, the buffer solution comprises at least one of a phosphate buffer solution or a tris-hydroxymethyl aminomethane hydrochloride buffer solution. Optionally, the provision of the recombinant humanized collagen which is resistant to alkaline comprises the following steps: The recombinant humanized collagen which is resistant to alkaline is obtained by gel electrophoresis analysis under the condition that the pH is 10-12 and the degradation degree of the collagen is within a preset range.

3. The preparation method of the collagen gel for injection according to claim 1, wherein the crosslinking agent comprises any one of ethylene glycol diglycidyl ether, diethylene glycol diglycidyl ether, polyethylene glycol diglycidyl ether, polypropylene glycol diglycidyl ether or 1,6-hexanediol diglycidyl ether.

4. The preparation method of the collagen gel for injection according to claim 1, wherein the activation treatment of the crosslinking agent in the alkaline activation solution comprises the following steps: The crosslinking agent is added into the alkaline activation solution, and the alkaline activation solution is a sodium hydroxide or potassium hydroxide solution with a mass concentration of 0.5%-2%. Optionally, the volume ratio of the crosslinking agent to the alkaline activation solution is (1:5)-(1:15).

5. The preparation method of the collagen gel for injection according to claim 1, wherein the crosslinking reaction of the activated crosslinking agent solution with the collagen dispersion liquid comprises the following steps: The activated crosslinking agent solution is reacted with the collagen dispersion liquid at 30-60 DEG C for 3-24 hours. Optionally, after the crosslinking reaction forms a stable gel, the pH is adjusted to neutral to terminate the reaction, and the gel is dialyzed in a phosphate buffer solution for 24-48 hours.

6. The preparation method of the collagen gel for injection according to claim 1, wherein the nucleotide sequence of the recombinant humanized collagen comprises the sequence shown in SEQ ID NO:1; and the nucleotide sequence shown in SEQ ID NO:1 is as follows: ​ ​ ​ ​ ​ ​ atggggcctc aaggtattgc tggacagcgt ggtgtggtcg gcctgcctgg tcagagaggagagagaggct tccctggtct tcctggcccc tctggtgaac ctggcaaaca aggtccctct ggagcaagtggtgaacgtgg tccccctggt cccatgggcc cccctggatt ggctggaccc cctggtgaat ctggacgtgagggggctcct ggtgccgaag gttcccctgg acgagacggt tctcctggcg ccaagggtga ccgtggtgagaccggccccg ctggaccccc tggtgctcct ggtgctcctg gtgcccctgg ccccgttggc cctgctggcaagagtggtga tcgtggtgag actggtcctg ctggtcccgc cggagaacga ggtggccctg gaggacctggccctcagggt cctcctggaa agaatggtga aactggacct cagggacccc cagggcctac tgggcctggtggtgacaaag gagacacagg accccctggt ccacaaggat tacaaggctt gcctggtaca ggtggtcctccaggagaaaa tggaaaacct ggggaaccag gtccaaaggg tgatgccggt gcacctggag ctccaggaggcaagggtgat gctggtgccc ctggtgaacg tggacctcct ggattggcag gggccccagg acttagaggtggagctggtc cccctggtcc cgaaggagga aagggtgctg ctggtcctcc tgggccacct ggtgctgctggtactcctgg actacaagga atgcctggcc cgccaggtcc atgctgtgga ggtggataa.

7. The method of claim 1, wherein the recombinant humanized collagen has a molecular weight of 25 KD - 55 KD.

7. The method of claim 1, wherein the recombinant humanized collagen has a molecular weight of 25 KD - 55 KD.

8. A collagen gel for injection, characterized by, 7. The method of claim 1, wherein the recombinant humanized collagen has a molecular weight of 25 KD - 55 KD.

9. The collagen gel for injection according to claim 8, wherein, a residual amount of the cross-linking agent in the collagen gel for injection is less than 2.0 μg / g; optionally, a storage modulus of the collagen gel for injection at a frequency of 0.1 Hz is between 150 Pa and 250 Pa; optionally, a loss modulus of the collagen gel for injection at a frequency of 0.1 Hz is between 14 Pa and 25 Pa; optionally, a push force of the collagen gel for injection is between 10 N and 20 N; optionally, a swelling degree of the collagen gel for injection is less than 20.

61.

10. An injectable formulation characterized in that, a collagen gel for injection prepared by the method according to any one of claims 1 to 7; or the injection preparation comprising the collagen gel for injection according to any one of claims 8 to 9.

Images