A glucose-6-phosphate dehydrogenase mutant and its use in the production of l-tryptophan
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INNER MONGOLIA EPPEN BIOTECH CO LTD
- Filing Date
- 2025-11-28
- Publication Date
- 2026-05-01
AI Technical Summary
Existing technologies have low carbon metabolism flux redirection efficiency when breeding L-tryptophan-producing strains, resulting in low L-tryptophan production efficiency.
By mutating glucose-6-phosphate dehydrogenase, specifically replacing the glycine residue at position 132 with a cysteine residue, its expression and activity in E. coli were enhanced, and its expression and activity were optimized by introducing a specific expression cassette into E. coli using CRISPR-Cas9 gene editing technology.
The expression level and activity of glucose-6-phosphate dehydrogenase in Escherichia coli were increased, thereby increasing the fermentation production of L-tryptophan and achieving more cost-effective L-tryptophan production.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
A glucose-6-phosphate dehydrogenase mutant and its application in the production of L-tryptophan Technical Field
[0001] This invention relates to the field of genetic engineering technology, specifically to a glucose-6-phosphate dehydrogenase mutant and its application in the production of L-tryptophan. Background Technology
[0002] Tryptophan plays an important role in the growth, development, and metabolism of humans and animals. It is known as the second essential amino acid and is one of the important raw materials for protein synthesis.
[0003] L-Tryptophan can directly affect the physiological and biochemical processes of animals, such as growth and metabolism; it can also be metabolized in the animal body into nicotinamide, nicotinic acid and 5-hydroxytryptamine (5-HT), etc., and these transformation products play an important role in the body.
[0004] L-tryptophan is mainly produced by fermentation, and the selection of highly efficient strains capable of producing L-tryptophan is crucial for the industrial application of microbial fermentation. Currently, the selection of L-tryptophan-producing strains primarily utilizes efficient gene editing technology to systematically engineer the L-tryptophan synthesis, regulation, and transport networks in chassis microorganisms. This aims to maximize the redirection of carbon metabolic flux to the L-tryptophan synthesis pathway, and employs a semi-rational breeding strategy that combines non-rational methods with irrational approaches. Summary of the Invention
[0005] The purpose of this invention is to provide a glucose-6-phosphate dehydrogenase mutant and its application in the production of L-tryptophan. In some embodiments of this invention, the glucose-6-phosphate dehydrogenase is encoded by the zwf gene. The same applies below.
[0006] In a first aspect, the present invention claims protection for glucose-6-phosphate dehydrogenase mutants.
[0007] The glucose-6-phosphate dehydrogenase mutant claimed in this invention includes at least (or is) any of the following:
[0008] A1) A protein whose amino acid sequence contains a sequence obtained by mutating the amino acid residue at position 132 of the sequence shown in SEQ ID NO:3;
[0009] A2) is a protein that has more than 98% identity with the amino acid sequence of A1) and has the same function, obtained by substituting and / or deleting and / or adding amino acid residues of the amino acid sequence defined by A1).
[0010] A3) A fusion protein with the same function obtained by attaching a tag protein to the N-terminus and / or C-terminus of the protein defined in A1) and / or A2).
[0011] In the above-mentioned proteins, identity refers to the identity of the amino acid sequences. The identity of amino acid sequences can be determined using identity search sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastp as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, setting the Gap existence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, and performing an identity search on a pair of amino acid sequences to calculate the identity value (%), then the identity value can be obtained.
[0012] In the aforementioned proteins, the 98% or higher identity can be at least 98% or 99% or higher identity.
[0013] Further, in A1), the glycine residue (G) at position 132 of the sequence shown in SEQ ID NO:3 is replaced by a different amino acid residue; preferably, the glycine residue (G) at position 132 is replaced by a cysteine residue (C). In some embodiments of the present invention, the glucose-6-phosphate dehydrogenase mutant is a protein obtained by mutating the glycine residue (G) at position 132 of SEQ ID NO:3 to a cysteine residue (C).
[0014] Furthermore, the glucose-6-phosphate dehydrogenase mutant contains the amino acid sequence shown in SEQ ID NO:5. In some embodiments of the present invention, the amino acid sequence of the glucose-6-phosphate dehydrogenase mutant is shown in SEQ ID NO:5.
[0015] Secondly, this invention claims protection for biological materials.
[0016] The biological materials claimed in this invention include or are any of the following:
[0017] B1) The nucleic acid molecule encoding the glucose-6-phosphate dehydrogenase mutant described in the first aspect above;
[0018] B2) An expression cassette containing the nucleic acid molecule described in B1);
[0019] B3) A recombinant vector containing the nucleic acid molecule described in B1) or a recombinant vector containing the expression cassette described in B2);
[0020] B4) Recombinant microorganisms containing the nucleic acid molecules described in B1), or recombinant microorganisms containing the expression cassette described in B2), or recombinant microorganisms containing the recombinant vector described in B3);
[0021] B5) A whole-cell catalyst containing the nucleic acid molecule described in B1), or a whole-cell catalyst containing the expression cassette described in B2), or a whole-cell catalyst containing the recombinant vector described in B3), or a whole-cell catalyst containing the recombinant microorganism described in B4).
[0022] Furthermore, the nucleic acid molecule described in B1) includes or is as follows: (b11) or (b12) or (b13)
[0023] b11) The coding sequence contains or is a nucleic acid molecule of SEQ ID NO:6;
[0024] b12) The nucleic acid molecule described in b11) has more than 80% similarity to the nucleic acid molecule described in the first aspect above and encodes the nucleic acid molecule of the glucose-6-phosphate dehydrogenase mutant described in the first aspect above;
[0025] b13) hybridizes under strict conditions with the nucleic acid molecule defined by b11) or b12) and encodes the nucleic acid molecule of the glucose-6-phosphate dehydrogenase mutant described in the first aspect above.
[0026] The stringent conditions for the above nucleic acid molecules can be as follows: hybridization at 50°C in a mixed solution of 7% sodium dodecyl sulfate (SDS), 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 2×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 1×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.5×SSC and 0.1% SDS; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1 ...7% SDS, 0.5M Na3PO4, and 1mM EDTA; or hybridization at 50°C in a mixed solution of 7% SDS, 0.5M Na3PO4, and 1mM EDTA, followed by rinsing at 50°C in 0.1×SSC and 0.1% SDS. Hybridize in a mixed solution of SDS, 0.5 M Na3PO4 and 1 mM EDTA, and wash at 65 °C with 0.1 × SSC and 0.1% SDS; alternatively, hybridize in a solution of 6 × SSC and 0.5% SDS at 65 °C, and then wash once each with 2 × SSC and 0.1% SDS and 1 × SSC and 0.1% SDS.
[0027] For the aforementioned nucleic acid molecules, the identity of nucleotide sequences can be determined using identity retrieval sites on the Internet, such as the BLAST page on the NCBI homepage. For example, in Advanced BLAST 2.1, using blastn as the program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as the matrix, and setting the Gapexistence cost, Per residue gap cost, and Lambda ratio to 11, 1, and 0.85 (default values) respectively, the identity of a pair of nucleotide sequences can be retrieved and calculated, and then the identity value (%) can be obtained.
[0028] In the aforementioned nucleic acid molecules, the 80% or more identity can be at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity.
[0029] Thirdly, the present invention claims protection for recombinant Escherichia coli.
[0030] The recombinant Escherichia coli claimed in this invention exhibits enhanced expression and / or activity of glucose-6-phosphate dehydrogenase.
[0031] The enhanced expression level and / or activity includes: enhanced expression of a polynucleotide containing the amino acid sequence of SEQ ID NO:3 of glucose-6-phosphate dehydrogenase, and / or a polynucleotide encoding the amino acid sequence of SEQ ID NO:3 of glucose-6-phosphate dehydrogenase having a point mutation, and / or a polynucleotide encoding the amino acid sequence of SEQ ID NO:3 of glucose-6-phosphate dehydrogenase having a point mutation and enhanced expression.
[0032] Preferably, the enhanced expression level and / or activity comprises: enhanced expression of a polynucleotide containing the amino acid sequence of SEQ ID NO:3 of glucose-6-phosphate dehydrogenase, and / or a polynucleotide encoding the amino acid sequence of SEQ ID NO:3 of glucose-6-phosphate dehydrogenase having a point mutation that enhances its activity, and / or a polynucleotide encoding the amino acid sequence of SEQ ID NO:3 of glucose-6-phosphate dehydrogenase having a point mutation that enhances its activity and whose expression is enhanced.
[0033] Furthermore, the recombinant Escherichia coli includes or is obtained by overexpressing the gene encoding glucose-6-phosphate dehydrogenase encoding the amino acid sequence of SEQ ID NO:3.
[0034] Furthermore, the recombinant Escherichia coli includes or is a point mutation of a polynucleotide encoding the amino acid sequence of SEQ ID NO:3, such that the glycine residue (G) at position 132 of the amino acid sequence of SEQ ID NO:3 is replaced by a different amino acid residue; preferably, the glycine residue (G) at position 132 is replaced by a cysteine residue (C).
[0035] Furthermore, the recombinant Escherichia coli may be recombinant Escherichia coli 1, recombinant Escherichia coli 2, or recombinant Escherichia coli 3.
[0036] The recombinant Escherichia coli 1 was obtained by introducing the Escherichia coli-derived glucose-6-phosphate dehydrogenase encoding gene into the recipient Escherichia coli; the recipient Escherichia coli normally expresses its own glucose-6-phosphate dehydrogenase.
[0037] The recombinant Escherichia coli 2 was obtained by point mutation of the gene encoding endogenous glucose-6-phosphate dehydrogenase in the genome of the recipient Escherichia coli. The point mutation replaced amino acid G at position 132 of the endogenous glucose-6-phosphate dehydrogenase in Escherichia coli with amino acid C; other sequences in the genome remained unchanged.
[0038] The recombinant *E. coli* 3 was obtained by introducing the coding gene of a glucose-6-phosphate dehydrogenase mutant into the recipient *E. coli*; the glucose-6-phosphate dehydrogenase mutant was obtained by replacing amino acid G at position 132 of the endogenous glucose-6-phosphate dehydrogenase in *E. coli* with amino acid C. The recipient *E. coli* normally expresses its own glucose-6-phosphate dehydrogenase.
[0039] Furthermore, the recombinant *E. coli* 1 is obtained by inserting a specific expression cassette 1 into the adhE site of the recipient *E. coli* genome; the specific expression cassette 1 is an expression cassette for expressing glucose-6-phosphate dehydrogenase derived from *E. coli*; in the specific expression cassette 1, the promoter for initiating the expression of the gene encoding glucose-6-phosphate dehydrogenase derived from *E. coli* is the Ptrc promoter. The recombinant *E. coli* 3 is obtained by inserting a specific expression cassette 2 into the adhE site of the recipient *E. coli* genome; the specific expression cassette 2 is an expression cassette for expressing the glucose-6-phosphate dehydrogenase mutant; in the specific expression cassette 2, the promoter for initiating the expression of the gene encoding the glucose-6-phosphate dehydrogenase mutant is the Ptrc promoter.
[0040] The glucose-6-phosphate dehydrogenase comprises or is any one of the following:
[0041] (a1) A protein with the amino acid sequence SEQ ID NO:3;
[0042] (a2) A protein derived from Escherichia coli with the same function obtained by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:3;
[0043] (a3) has 99%, 95%, 90%, 85% or 80% or more identity with any of the amino acid sequences defined in (a1)-(a2) and is derived from Escherichia coli and has the same function;
[0044] (a4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (a1)-(a3).
[0045] The glucose-6-phosphate dehydrogenase mutant includes or is any one of the following:
[0046] (b1) A protein with the amino acid sequence SEQ ID NO:5;
[0047] (b2) A protein derived from Escherichia coli with the same function, having undergone substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence shown in SEQ ID NO:5;
[0048] (b3) A protein that has 99%, 95%, 90%, 85% or 80% identity with any of the amino acid sequences defined in (b1)-(b2) and is derived from Escherichia coli and has the same function;
[0049] (b4) A fusion protein obtained by attaching a tag to the N-terminus and / or C-terminus of any of the proteins defined in (b1)-(b3).
[0050] Accordingly, the gene encoding glucose-6-phosphate dehydrogenase includes or is any of the following:
[0051] (c1) The DNA molecule shown in SEQ ID NO:4;
[0052] (c2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined in (c1) and encodes the glucose-6-phosphate dehydrogenase described therein;
[0053] (c3) is 99%, 95%, 90%, 85% or 80% identical to the DNA sequence defined by (c1) or (c2) and encodes the glucose-6-phosphate dehydrogenase.
[0054] The gene encoding the glucose-6-phosphate dehydrogenase mutant includes or is any of the following:
[0055] (d1) The DNA molecule shown in SEQ ID NO:6;
[0056] (d2) A DNA molecule that hybridizes under stringent conditions with the DNA molecule defined in (d1) and encodes the glucose-6-phosphate dehydrogenase mutant;
[0057] (d3) has 99%, 95%, 90%, 85% or more identity with the DNA sequence defined by (d1) or (d2) and encodes the DNA molecule of the glucose-6-phosphate dehydrogenase mutant.
[0058] In some embodiments of the present invention, the nucleotide sequence of the Ptrc promoter is positions 1977-2050 of SEQ ID NO:7 (or positions 1977-2050 of SEQ ID NO:10). Accordingly, the sequence of the specific expression cassette 1 is the reverse complementary sequence of positions 501-2050 of SEQ ID NO:7. The sequence of the specific expression cassette 2 is the reverse complementary sequence of positions 501-2050 of SEQ ID NO:10.
[0059] In some embodiments of the present invention, the sequence of the adhE site is shown in SEQ ID NO:1. Accordingly, the recombinant Escherichia coli 1 is obtained by replacing the sequence shown in SEQ ID NO:1 in the genome of the recipient Escherichia coli with the sequence shown in positions 501-2050 of SEQ ID NO:7. The recombinant Escherichia coli 3 is obtained by replacing the sequence shown in SEQ ID NO:1 in the genome of the recipient Escherichia coli with the sequence shown in positions 501-2050 of SEQ ID NO:10.
[0060] In some embodiments of the present invention, the recombinant Escherichia coli 2 is obtained by replacing the G at position 394 of the gene encoding glucose-6-phosphate dehydrogenase as shown in SEQ ID NO:4 in the genome of the recipient Escherichia coli with T (that is, replacing SEQ ID NO:4 with SEQ ID NO:6), while keeping other sequences unchanged.
[0061] In some embodiments of the present invention, the recombinant Escherichia coli 1 is obtained by introducing pREDCas9 plasmid, adhE-pGRB plasmid and recombinant integrative frame Ptrc-zwf into the recipient Escherichia coli; the adhE-pGRB plasmid is a recombinant plasmid obtained by inserting the DNA fragment shown in SEQ ID NO:2 between tgacagctagctcagtcctaggtataatactagt (SEQ ID NO:15) and gttttagagctagaaatagcaagttaaaataagg (SEQ ID NO:16) of the pGRB plasmid; the nucleotide sequence of the recombinant integrative frame Ptrc-zwf is SEQ ID NO:7.
[0062] In some embodiments of the present invention, the recombinant Escherichia coli 2 is the introduction of pREDCas9 plasmid, zwf-pGRB plasmid and recombinant integration frame zwf into the recipient Escherichia coli. G132C The zwf-pGRB plasmid was obtained by inserting the DNA fragment shown in SEQ ID NO:8 between tgacagctagctcagtcctaggtataatactagt (SEQ ID NO:15) and gttttagagctagaaatagcaagttaaaataagg (SEQ ID NO:16) of the pGRB plasmid; the recombinant integrative frame zwf G132C The nucleotide sequence is SEQ ID NO:9.
[0063] In some embodiments of the present invention, the recombinant Escherichia coli 3 is the introduction of pREDCas9 plasmid, adhE-pGRB plasmid and recombinant integration frame Ptrc-zwf into the recipient Escherichia coli. G132C The adhE-pGRB plasmid was obtained by inserting the DNA fragment shown in SEQ ID NO:2 between tgacagctagctcagtcctaggtataatactagt (SEQ ID NO:15) and gttttagagctagaaatagcaagttaaaataagg (SEQ ID NO:16) of the pGRB plasmid; the recombination integration frame Ptrc-zwf G132C The nucleotide sequence is SEQ ID NO:10.
[0064] Fourthly, the present invention claims protection for the use of the glucose-6-phosphate dehydrogenase mutant described in the first aspect above, or the biological material described in the second aspect above, or the recombinant Escherichia coli described in the third aspect above, in the production of L-tryptophan.
[0065] Fifthly, the present invention claims a method for producing L-tryptophan.
[0066] The method for producing L-tryptophan claimed in this invention may include the following steps: fermenting and culturing the recombinant Escherichia coli described in the first aspect above to obtain L-tryptophan from the fermentation product.
[0067] The cultivation of the recombinant *E. coli* can be performed by methods known to those skilled in the art using existing techniques, and the fermentation method can be optimized and improved through routine experiments. The fermentation can be carried out under fermentation conditions known in the art in a suitable culture medium. The culture medium may contain: a carbon source, a nitrogen source, trace elements, and combinations thereof. During cultivation, the pH of the culture can be adjusted. During cultivation, the temperature of the culture can be controlled. During cultivation, the rotation speed can be controlled. During cultivation, the fermentation time can be controlled. During cultivation, dissolved oxygen can be controlled.
[0068] In some embodiments of the present invention, the specific culture medium formulation and fermentation process used are described in the relevant section of Example 4.
[0069] Sixthly, the present invention claims the use of glucose-6-phosphate dehydrogenase or its encoding gene, or an expression cassette or recombinant vector carrying the encoding gene, or a recombinant microorganism or recombinant cell in the preparation of Escherichia coli with increased L-tryptophan production through fermentation, as described in the third aspect above.
[0070] In a seventh aspect, the present invention claims a method for constructing engineered bacteria for the production of L-tryptophan.
[0071] The method for constructing engineered bacteria for L-tryptophan production claimed in this invention may include the following steps: increasing the expression level and / or activity of glucose-6-phosphate dehydrogenase in recipient bacteria, thereby obtaining engineered bacteria for L-tryptophan production.
[0072] In the aforementioned aspects, improving the activity of the glucose-6-phosphate dehydrogenase can be achieved by replacing amino acid G at position 132 of the glucose-6-phosphate dehydrogenase with amino acid C. The glucose-6-phosphate dehydrogenase can be any of those described in (a1)-(a4) above.
[0073] Furthermore, the recipient bacteria may be bacteria.
[0074] The bacteria are those capable of producing L-tryptophan.
[0075] "Bacteria capable of producing L-tryptophan" refers to bacteria that possess the following abilities: the ability to produce and accumulate L-tryptophan within the bacteria using external substances (such as culture medium), and may further include the ability to secrete L-tryptophan into the culture system. Thus, L-tryptophan can be collected when bacteria are cultured in a culture medium.
[0076] The bacteria can be naturally collected wild-type bacteria or modified bacteria.
[0077] "Modified bacteria" refers to bacteria that have been artificially mutated and / or induced to grow from naturally collected wild-type bacteria.
[0078] Furthermore, the bacteria may originate from, but are not limited to, species such as Escherichia sp., Erwinia sp., Agrobacterium sp., Flavobacterium sp., Alcaligenes sp., Pseudomonas sp., Bacillus sp., Brevibacterium sp., Corynebacterium sp., Aerobacterium sp., Enterobacteria sp., Micrococcus sp., Serratia sp., Salmonella sp., Streptomyces sp., and Providencia sp.
[0079] Furthermore, the bacteria may be Escherichia coli, Corynebacterium glutamicum, Brevibacterium lactofermentum, Brevibacterium flavum, Corynebacterium pekinense, Brevibacterium ammoniagenes, Corynebacterium crenatum, or Pantoea, but are not limited to these.
[0080] More specifically, the bacteria may be Escherichia coli.
[0081] In some embodiments of the present invention, the engineered bacteria are prepared by a method comprising the following steps: introducing pREDCas9 plasmid, adhE-pGRB plasmid and recombinant integrative frame Ptrc-zwf into recipient *Escherichia coli*, thereby obtaining the engineered bacteria; the adhE-pGRB plasmid is a recombinant plasmid obtained by inserting the DNA fragment shown in SEQ ID NO:2 between tgacagctagctcagtcctaggtataatactagt (SEQ ID NO:15) and gttttagagctagaaatagc aagttaaaatagg (SEQ ID NO:16) of the pGRB plasmid; the nucleotide sequence of the recombinant integrative frame Ptrc-zwf is SEQ ID NO:7.
[0082] In some embodiments of the present invention, the engineered bacteria are prepared by a method comprising the following steps: introducing pREDCas9 plasmid, zwf-pGRB plasmid and recombinant integration frame zwf into recipient *Escherichia coli*. G132C Thus, the engineered bacteria were obtained; the zwf-pGRB plasmid was a recombinant plasmid obtained by inserting the DNA fragment shown in SEQ ID NO:8 between tgacagctagctcagtcctaggtataatactagt (SEQ ID NO:15) and gttttagagctagaaatag caagttaaaataagg (SEQ ID NO:16) of the pGRB plasmid; the recombinant integrative frame zwf G132C The nucleotide sequence is SEQ ID NO:9.
[0083] In some embodiments of the present invention, the engineered bacteria are prepared by a method comprising the following steps: introducing pREDCas9 plasmid, adhE-pGRB plasmid, and recombination integration frame Ptrc-zwf into recipient *Escherichia coli*. G132C Thus, the engineered bacteria were obtained; the adhE-pGRB plasmid was a recombinant plasmid obtained by inserting the DNA fragment shown in SEQ ID NO:2 between tgacagctagctcagtcctaggtataatactagt (SEQ ID NO:15) and gtttt agagctagaaatagcaagttaaaataagg (SEQ ID NO:16) of the pGRB plasmid; the recombinant integration frame Ptrc-zwf G132C The nucleotide sequence is SEQ ID NO:10.
[0084] In some embodiments of the present invention, the *Escherichia coli* (or the recipient *Escherichia coli*) is *Escherichia coli* W3110 or *Escherichia coli* CGMCC No. 25403 (Classification: *Escherichia coli*; Reference biological material: YP006D; Depository institution: China General Microbiological Culture Collection Center; Abbreviation of depository institution: CGMCC; Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing; Deposit date: July 25, 2022; Depository center registration number: CGMCC No. 25403).
[0085] Accordingly, the recombinant *E. coli* (or the engineered bacteria) is *E. coli* W3110-Ptrc-zwf or *E. coli* YPTrp-Ptrc-zwf. *E. coli* W3110-Ptrc-zwf is a recombinant *E. coli* obtained by replacing the segment of the adhE gene shown in SEQ ID NO:1 in the genome of *E. coli* W3110 with nucleotides 501 to 2050 of SEQ ID NO:7, while keeping the other nucleotide sequences of the *E. coli* W3110 genome unchanged. *E. coli* YPTrp-Ptrc-zwf is a recombinant *E. coli* obtained by replacing the segment of the adhE gene shown in SEQ ID NO:1 in the genome of *E. coli* CGMCC No. 25403 with nucleotides 501 to 2050 of SEQ ID NO:7, while keeping the other nucleotide sequences of the *E. coli* CGMCC No. 25403 genome unchanged.
[0086] Accordingly, the recombinant Escherichia coli (or the engineered bacteria) is Escherichia coli W3110-zwf. G132C Or Escherichia coli YPTrp-zwf G132C The *Escherichia coli* W3110-zwf strain... G132C The recombinant *E. coli* strain YPTrp-zwf is obtained by replacing the G at position 394 of the zwf gene (SEQ ID NO:4) in the genome of *E. coli* W3110 with a T (i.e., replacing SEQ ID NO:4 with SEQ ID NO:6), while keeping the other nucleotide sequences of the *E. coli* W3110 genome unchanged. G132C The recombinant Escherichia coli is obtained by replacing the G at position 394 of the zwf gene shown in SEQ ID NO:4 in the genome of Escherichia coli CGMCC No.25403 with T (that is, replacing SEQ ID NO:4 with SEQ ID NO:6), while keeping the other nucleotide sequences of the genome sequence of Escherichia coli CGMCC No.25403 unchanged.
[0087] Accordingly, the recombinant Escherichia coli (or the engineered bacteria) is Escherichia coli W3110-Ptrc-zwf. G132C Or Escherichia coli YPTrp-Ptrc-zwf G132C The *E. coli* W3110-Ptrc-zwf strain... G132C The recombinant *E. coli* strain YPTrp-Ptrc-zwf is obtained by replacing the segment of the adhE gene shown in SEQ ID NO:1 in the genome of *E. coli* W3110 with nucleotides 501 to 2050 of SEQ ID NO:10, while keeping the other nucleotide sequences of the *E. coli* W3110 genome unchanged. G132C The recombinant Escherichia coli is obtained by replacing the segment shown in SEQ ID NO:1 of the adhE gene in the genome of Escherichia coli CGMCC No.25403 with nucleotide sequences from 501 to 2050 in SEQ ID NO:10, while keeping the other nucleotide sequences of the genome sequence of Escherichia coli CGMCC No.25403 unchanged.
[0088] Experiments have demonstrated that this invention enables the overexpression of the E. coli-derived glucose-6-phosphate dehydrogenase encoding gene zwf or its mutant zwf in recipient E. coli. G132G Alternatively, the endogenous zwf gene can be directly mutated to zwf. G132G All of these strains can produce more cost-effective L-tryptophan fermentation production strains. This invention is of great significance for improving the fermentation yield of L-tryptophan.
[0089] Preservation Instructions
[0090] Classification and nomenclature: Escherichia coli;
[0091] Biological material from ginseng: YP006D;
[0092] Preservation institution: China General Microbiological Culture Collection Center, China Committee on the Preservation and Management of Microbial Cultures;
[0093] The abbreviation for the depository institution is CGMCC.
[0094] Address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing;
[0095] Deposit date: July 25, 2022;
[0096] Registration number at the Preservation Center: CGMCC No. 25403.
[0097] In this invention, this strain is referred to simply as *Escherichia coli* CGMCC No. 25403. The deposit requester, Ningxia Yipin Biotechnology Co., Ltd., has authorized Inner Mongolia Yipin Biotechnology Co., Ltd. to use this strain. Detailed Implementation
[0098] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.
[0099] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.
[0100] The pREDCas9 plasmid used in the following examples is Addgene, catalog number #71541.
[0101] The pGRB plasmid used in the following examples is Addgene, catalog number #71539.
[0102] Example 1: Construction of genetically engineered bacteria YPTrp-Ptrc-zwf and W3110-Ptrc-zwf
[0103] This invention employs the CRISPR-Cas9 gene editing method to overexpress another copy of the *zwf* gene (nucleotide sequence shown in SEQ ID NO:4) encoding *E. coli* glucose-6-phosphate dehydrogenase (amino acid sequence shown in SEQ ID NO:3) into the *adhE* site (nucleotide sequence shown in SEQ ID NO:1) of the L-tryptophan-producing strain (i.e., *E. coli* CGMCC No. 25403), thereby constructing a high-yield L-tryptophan engineered strain. Details are as follows:
[0104] The two plasmids used in this method are pREDCas9 and pGRB. The pREDCas9 plasmid contains the Red recombination system of λ phage and the Cas9 protein expression system, is incubated with azithromycin resistance (working concentration: 100 mg / L), and is cultured at 32°C. The pGRB plasmid uses pUC18 as its backbone and includes the promoter J23119, the gRNA-Cas9 binding region sequence, and a terminator sequence, and is incubated with ampicillin resistance (working concentration: 100 mg / L), and is cultured at 37°C.
[0105] 1. Construction of adhE-pGRB plasmid
[0106] The purpose of constructing the adhE-pGRB plasmid is to transcribe the corresponding gRNA, thereby forming a complex with the Cas9 protein, and achieving a double-strand break in the target DNA through base pairing and PAM recognition of the target gene site. The adhE-pGRB plasmid is constructed by recombination of a DNA fragment containing the target sequence with a linearized pGRB vector fragment.
[0107] (1) Target sequence and primer design
[0108] The target sequence (PAM: 5'-NGG-3') was designed using CRISPR RGEN Tools, as follows:
[0109] 5'-GGAAAACTCACTTCGAAGAGC-3' (SEQ ID NO: 2).
[0110] Primers for amplifying sgRNA fragments were designed targeting the target sequence (forward primer F structure: 5' - linearized vector terminal sequence (34bp) - target sequence (excluding PAM sequence) - linearized vector terminal sequence (34bp) - 3'; reverse primer R structure: a primer that is inversely complementary to forward primer F), as detailed below:
[0111] gRNA-F: 5'-tgacagctagctcagtcctaggtataatactagtggaaactcacttcgaagagcgttttagagctagaaatagcaagttaaaataagg-3' (SEQ ID NO: 11);
[0112] gRNA-R: 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAACgctcttcgaagtgagtttccACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (SEQ ID NO: 12).
[0113] In the above primer gRNA-R, the lowercase letters represent the adhE target sequence.
[0114] (2) Preparation of DNA fragments containing target sequences
[0115] DNA fragments containing the target sequence were prepared by annealing single-stranded DNA. Reaction conditions: pre-denaturation 95℃, 5 min; annealing 50℃, 1 min. Annealing reaction mixture: 10 μL gRNA-F (10 μmol / L), 10 μL gRNA-R (10 μmol / L), yielding DNA fragments containing the target sequence.
[0116] (3) Preparation of linear carriers
[0117] The pGRB vector was linearized using reverse PCR amplification.
[0118] The amplification primers are as follows:
[0119] pGRB-F: 5'-actagtattatacctaggactgagc-3' (SEQ ID NO: 13);
[0120] pGRB-R: 5'-gttttagagctagaaatagcaagtt-3' (SEQ ID NO: 14).
[0121] The PCR reaction system (Takara Bio PrimeSTAR HS enzyme) is shown in Table 1.
[0122]
[0123] PCR reaction procedure: pre-denaturation (95℃) for 5 min; then 30 cycles: denaturation (98℃) for 10 s, annealing (58℃) for 15 s, extension at 72℃ for 2 min; extension at 72℃ for another 10 min; maintenance (4℃) to obtain the linearized cloning vector.
[0124] (4) Recombination reaction
[0125] The recombinant system is shown in Table 2. All recombinant enzymes used were from the ClonExpress II One Step Cloning Kit series. The recombinant conditions were 37℃ for 30 min to obtain the reaction solution.
[0126]
[0127] (5) Plasmid transformation
[0128] Take 10 μL of the reaction solution obtained in the previous step and add it to 100 mL of DH5α-transformed competent cells. After gently mixing, incubate on ice for 20 min, heat shock at 42℃ for 45-90 s, immediately incubate on ice for 2-3 min, add 900 μL of SOC, and revive at 37℃ for 1 h. Spread the solution onto a plate containing 100 mg / L ampicillin and invert the plate to incubate overnight at 37℃.
[0129] (6) Cloning identification
[0130] The above ampicillin-resistant colonies were inoculated into LB medium containing 100 mg / L ampicillin and cultured overnight. After preservation, plasmids were extracted and identified by enzyme digestion.
[0131] The plasmid identified as correctly inserted was named adhE-pGRB. The structure of plasmid adhE-pGRB is described as follows: a recombinant vector obtained by inserting the DNA fragment shown in SEQ ID NO:2 between tgacagctagctcagtcctaggtataatactagt (SEQ ID NO:15) and gttttagagctagaaatagcaagttaaaataagg (SEQ ID NO:16) of the pGRB plasmid while maintaining other nucleotide sequences. This adhE-pGRB plasmid can transcribe gRNA with the nucleotide sequence of SEQ ID NO:2, thereby forming a complex with the Cas9 protein, and achieving double-strand breaks in the target DNA through base pairing and PAM recognition of the target gene site.
[0132] 2. Preparation of the recombinant integrative framework Ptrc-zwf
[0133] The recombination integration frame for adhE site integration of zwf consists of an upstream homologous arm - Ptrc - zwf - a downstream homologous arm. Primers were designed using the primer design software Primer5 based on the Ptrc-zwf sequence and its upstream and downstream homologous arm sequences (i.e., SEQ ID NO:7), as follows:
[0134] Ptrc-zwf-up-F: 5'-agcgggtaacgcgggttag-3' (SEQ ID NO: 17);
[0135] Ptrc-zwf-up-R: 5'-cctggaatgagtttgagtaagaatatctgccagcgtcctac-3' (SEQ IDNO: 18);
[0136] Ptrc-zwf-F: 5'-gtaggacgctggcagatattcttactcaaactcattccagg-3' (SEQ ID NO: 19);
[0137] Ptrc-zwf-R: 5'-TGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCatggcggtaacgcaaacagc-3' (SEQ ID NO: 20);
[0138] Ptrc-zwf-down-F: 5'-TCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAatatcagccgctttgttggtg-3' (SEQ ID NO: 21);
[0139] Ptrc-zwf-down-R: 5'-agcagatgatttactaaaaaagtttaacattatcagg-3' (SEQ ID NO: 22).
[0140] Using genomic DNA from *Escherichia coli* CGMCC No. 25403 as a template, upstream and downstream homologous arms and Ptrc-zwf were amplified using primers Ptrc-zwf-up-F / Ptrc-zwf-up-R, Ptrc-zwf-down-F / Ptrc-zwf-down-R, and Ptrc-zwf-F / Ptrc-zwf-R. The PCR reaction system is shown in Table 1. The PCR reaction program was as follows: pre-denaturation (95℃) for 5 min; then 30 cycles of denaturation (98℃) for 10 s, annealing (58℃) for 15 s, extension at 72℃ for 1.5 min; further extension at 72℃ for 10 min; maintenance (4℃).
[0141] Using the obtained upstream and downstream homologous arms and Ptrc-zwf as amplification templates, overlap PCR was performed using the aforementioned primers Ptrc-zwf-up-F / Ptrc-zwf-down-R to prepare the recombinant integrative frame Ptrc-zwf.
[0142] The overlap PCR reaction system (Takara Bio PrimeSTAR HS enzyme) is shown in Table 3.
[0143]
[0144] Overlap PCR reaction conditions: pre-denaturation (95℃) for 5 min; then 30 cycles: denaturation (98℃) for 10 s, annealing (58℃) for 15 s, extension at 72℃ for 3 min; further extension at 72℃ for 10 min; maintenance (4℃).
[0145] The final nucleotide sequence of the recombinant integrative frame Ptrc-zwf is SEQ ID NO:7, where nucleotides 1 to 500 are the upstream homologous arm of Ptrc-zwf (500 bp), nucleotides 501 to 1976 are the reverse complementary sequence of the zwf gene (1476 bp, i.e., SEQ ID NO:4, encoding the amino acid sequence shown in SEQ ID NO:3), nucleotides 1977 to 2050 are the reverse complementary sequence of the Ptrc promoter (74 bp), and nucleotides 2051 to 2550 are the downstream homologous arm of Ptrc-zwf (500 bp).
[0146] 3. Transformation of pREDCas9 plasmid
[0147] The pREDCas9 plasmid carries the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage, and the Cas9 protein expression system. It is incubated with zirconia resistance (working concentration: 100 mg / L) at 32°C.
[0148] (1) Conversion of pREDCas9
[0149] The pREDCas9 plasmid was electroporated into the electroporation competent cells of L-tryptophan-producing strain (Escherichia coli CGMCC No. 25403). After cell resuscitation and culture, the cells were plated on LB agar plates containing zizomycin and incubated overnight at 32°C. Single colonies growing on the antibiotic-resistant plates were subjected to colony PCR using identification primers to screen for positive recombinants.
[0150] (2) Preparation of electrotransformation competent cells of target strain containing pREDCas9
[0151] The positive recombinants obtained in the previous step were cultured at 32°C until OD. 600nm When the concentration reaches 0.1-0.2, add 0.1M IPTG (to bring the final concentration to 0.1mM) and continue culturing until OD reaches 0.2. 600nm Competent cells were prepared when the pH was 0.6-0.7. The purpose of adding IPTG was to induce the expression of the recombinase on the pREDCas9 plasmid. The culture medium and preparation process for competent cells followed standard operating procedures to obtain electroporated competent cells containing pREDCas9.
[0152] 4. Transformation of adhE-pGRB plasmid and recombination integration frame Ptrc-zwf
[0153] The adhE-pGRB plasmid constructed in step 1 and the recombinant integration frame Ptrc-zwf (SEQ ID NO:7) obtained in step 2 were simultaneously electroporated into E. coli CGMCC No.25403 electroporated competent cells containing the pREDCas9 plasmid obtained in step 3. The electroporated and revived bacterial cells were plated on LB agar plates containing ampicillin and zithromycin and incubated overnight at 32°C. Colony PCR verification was performed using primers Ptrc-zwf-up-F / Ptrc-zwf-R and Ptrc-zwf-F / Ptrc-zwf-down-R (specific sequences are described above), positive recombinants were screened, and the cells were preserved.
[0154] 5. Plasmid elimination
[0155] (1) Elimination of adhE-pGRB plasmid
[0156] The obtained positive recombinants were cultured overnight in LB medium containing 0.2% arabinose. After appropriate dilution, they were spread onto LB agar plates containing zirconia-resistant bacteria and incubated overnight at 32°C. Single colonies were picked and streaked one-to-one onto LB agar plates containing ampicillin and zirconia-resistant bacteria, respectively. Single colonies that did not grow on ampicillin-resistant plates but grew on zirconia-resistant plates were selected and preserved to obtain positive recombinants.
[0157] (2) Elimination of pREDCas9 plasmid
[0158] The positive recombinants obtained by eliminating the adhE-pGRB plasmid were transferred to antibiotic-free LB broth and incubated overnight at 42°C. After appropriate dilution, they were plated onto antibiotic-free LB plates and incubated overnight at 37°C. Single colonies were picked and streaked one-to-one onto LB plates containing azithromycin resistance and those without resistance. Single colonies that did not grow on azithromycin-resistant plates and grew on antibiotic-free plates were selected and preserved to obtain positive single colonies.
[0159] The obtained positive monoclonal antibodies were sequenced, and the strain with correct sequencing results was named recombinant YPTrp-Ptrc-zwf. Recombinant YPTrp-Ptrc-zwf is a recombinant *E. coli* strain obtained by replacing the fragment shown in SEQ ID NO:1 of the adhE gene in the genome of *E. coli* CGMCC No. 25403 with nucleotides 501-2050 of SEQ ID NO:7, while maintaining the other nucleotide sequences of the *E. coli* CGMCC No. 25403 genome unchanged. The genome of recombinant YPTrp-Ptrc-zwf contains two copies: a wild-type zwf from the *E. coli* genome and a wild-type zwf from *E. coli* overexpressing the adhE site.
[0160] Following the aforementioned method, recombinant strain W3110-Ptrc-zwf was obtained using wild-type Escherichia coli strain W3110 as the starting strain. Recombinant strain W3110-Ptrc-zwf is obtained by replacing the fragment shown in SEQ ID NO:1 of the adhE gene in the genome of E. coli W3110 with nucleotides 501-2050 of SEQ ID NO:7, while maintaining the other nucleotide sequences of the E. coli W3110 genome unchanged. The genome of recombinant strain W3110-Ptrc-zwf contains two copies: a wild-type zwf naturally present in the E. coli genome and a wild-type zwf derived from E. coli overexpressing at the adhE site.
[0161] Example 2: Genetically engineered bacteria YPTrp-zwf G132C and W3110-zwf G132C Construction
[0162] This invention utilizes the CRISPR-Cas9 gene editing method to mutate the 394th base G to T of the gene zwf (nucleotide sequence shown in SEQ ID NO:4) encoding glucose-6-phosphate dehydrogenase (amino acid sequence shown in SEQ ID NO:3) from *E. coli* (resulting in the nucleotide sequence shown in SEQ ID NO:6, encoding the glucose-6-phosphate dehydrogenase mutant shown in SEQ ID NO:5, with a G132C mutation at the amino acid level), thereby constructing a high-L-tryptophan-producing *E. coli* engineered strain. Details are as follows:
[0163] 1. Construction of zwf-pGRB plasmid
[0164] The purpose of constructing the zwf-pGRB plasmid is to transcribe the corresponding gRNA, thereby forming a complex with the Cas9 protein, and achieving a double-strand break in the target DNA through base pairing and PAM recognition of the target gene site. The zwf-pGRB plasmid is constructed by recombination of a DNA fragment containing the target sequence with a linearized pGRB vector fragment.
[0165] (1) Target sequence and primer design
[0166] The target sequence (PAM: 5'-NGG-3') was designed using CRISPR RGEN Tools, as follows:
[0167] 5'-gtgccattctacctgcgtac-3' (SEQ ID NO: 8).
[0168] Primers for amplifying sgRNA fragments were designed targeting the target sequence (forward primer F structure: 5' - linearized vector terminal sequence (34bp) - target sequence (excluding PAM sequence) - linearized vector terminal sequence (34bp) - 3'; reverse primer R structure: a primer that is inversely complementary to forward primer F), as detailed below:
[0169] gRNA-F: 5'-tgacagctagctcagtcctaggtataatactagt gtgccattctacctgcgtac gttttagagctagaaatagcaagttaaaataagg-3' (SEQ ID NO: 23);
[0170] gRNA-R: 5'-CCTTATTTTAACTTGCTATTTCTAGCTCTAAAAC gtacgcaggtagaatggcac ACTAGTATTATACCTAGGACTGAGCTAGCTGTCA-3' (SEQ ID NO: 24).
[0171] In the above primer gRNA-R, the underlined part is the zwf target sequence.
[0172] (2) Preparation of DNA fragments containing target sequences
[0173] See step 1 (2) of Example 1.
[0174] (3) Preparation of linear carriers
[0175] See step 1 (3) of Example 1.
[0176] (4) Recombination reaction
[0177] See step 1 (4) of Example 1.
[0178] (5) Plasmid transformation
[0179] See step 1 (5) of Example 1.
[0180] (6) Cloning identification
[0181] See step 1 (6) of Example 1.
[0182] The plasmid identified as correctly inserted was named zwf-pGRB. The zwf-pGRB plasmid is described as follows: a recombinant vector obtained by inserting the DNA fragment shown in SEQ ID NO:8 between tgacagctagctcagtcctaggtataatactagt (SEQ ID NO:15) and gttttagagctagaaatagcaagttaaaataagg (SEQ ID NO:16) of the pGRB plasmid while maintaining other nucleotide sequences. This zwf-pGRB plasmid can transcribe gRNA with the nucleotide sequence of SEQ ID NO:8, thereby forming a complex with the Cas9 protein. It then recognizes the target gene site through base pairing and PAM, achieving a double-strand break in the target DNA.
[0183] 2. Reorganization and integration framework zwf G132C Preparation
[0184] For zwf G132C The recombination integration cassette of point mutations consists of an upstream homologous arm and a downstream homologous arm. Using the primer design software Primer5, based on zwf... G132C Primers were designed based on the upstream and downstream homologous arm sequences of the mutant (i.e., SEQ ID NO:9), as follows:
[0185] zwf-F: 5'-ttactcaaactcattccaggaacg-3' (SEQ ID NO: 25);
[0186] zwfG132C -R: 5'-atttgcaaagggcttTgcgaggcaaaactgaatg-3' (SEQ ID NO: 26);
[0187] zwf G132C -F: 5'-agttttgcctcgcAaagccctttgcaaattgc-3' (SEQ ID NO: 27);
[0188] zwf-R: 5'-atggcggtaacgcaaacag-3' (SEQ ID NO: 28).
[0189] Using the genomic DNA of Escherichia coli CGMCC No. 25403 as a template, and primers zwf-F / zwf G132C -R、zwf G132C -F / zwf-R amplification of upstream and downstream homologous arms. The PCR reaction system is shown in Table 1. PCR reaction program: pre-denaturation (95℃) for 5 min; then 30 cycles: denaturation (98℃) for 10 s, annealing (58℃) for 15 s, extension at 72℃ for 1 min; further extension at 72℃ for 10 min; maintenance (4℃).
[0190] Using the obtained upstream and downstream homologous arms as amplification templates, overlap PCR was performed using the aforementioned primers zwf-F / zwf-R to prepare the recombinant integrative frame zwf. G132C .
[0191] The overlap PCR reaction system (Takara Bio PrimeSTAR HS enzyme) is shown in Table 3.
[0192] Overlap PCR reaction conditions: pre-denaturation (95℃) for 5 min; then 30 cycles: denaturation (98℃) for 10 s, annealing (58℃) for 15 s, extension at 72℃ for 1.5 min; further extension at 72℃ for 10 min; maintenance (4℃).
[0193] The final reorganization and integration framework zwf G132C The nucleotide sequence is SEQ ID NO:9, where nucleotides 1 to 1098 are upstream homologous arms, nucleotides 1070 to 1476 are downstream homologous arms, and there is a 29bp overlapping sequence in between.
[0194] 3. Transformation of pREDCas9 plasmid
[0195] See step 3 of Example 1.
[0196] 4. zwf-pGRB plasmid and recombination integration frame zwf G132C transformation
[0197] The zwf-pGRB plasmid constructed in step 1 and the recombinant integration frame zwf obtained in step 2 were combined. G132C (SEQ ID NO:9) Simultaneously, the cells were electroporated into *E. coli* CGMCC No. 25403 electroporated competent cells containing the pREDCas9 plasmid obtained in step 3. The electroporated and revived bacterial cells were plated on LB agar plates containing ampicillin and zithromycin and incubated overnight at 32°C. Positive recombinants were screened by sequencing and the cells were preserved.
[0198] 5. Plasmid elimination
[0199] The zwf-pGRB and pREDCas9 plasmids were eliminated from the above-mentioned positive mutants using the plasmid elimination method in step 5 of Example 1, respectively. The positive recombinants were then sequenced and identified to obtain the recombinant strain YPTrp-zwf. G132C .
[0200] Recombinant strain YPTrp-zwf G132C This is a recombinant *E. coli* strain obtained by replacing the reverse complementary sequence of the zwf gene coding region (SEQ ID NO:4) of the *E. coli* genome of *E. coli* CGMCC No. 25403 with the nucleotide sequence shown in SEQ ID NO:9, while keeping the other nucleotide sequences of the *E. coli* CGMCC No. 25403 genome unchanged. SEQ ID NO:9 is the reverse complementary sequence of SEQ ID NO:6. Recombinant strain YPTrp-zwf G132C Only express zwf G132C The mutant does not express wild-type zwf.
[0201] Following the aforementioned method, using wild-type Escherichia coli strain W3110 as the starting strain, recombinant strain W3110-zwf was obtained. G132C Recombinant strain W3110-zwf G132C This is a recombinant *E. coli* strain obtained by replacing the reverse complementary sequence of the zwf gene coding region (SEQ ID NO:4) of the *E. coli* W3110 genome with the nucleotide sequence shown in SEQ ID NO:9, while keeping the other nucleotide sequences of the *E. coli* W3110 genome unchanged. SEQ ID NO:9 is the reverse complementary sequence of SEQ ID NO:6. Recombinant strain W3110-zwf G132C Only express zwf G132C The mutant does not express wild-type zwf.
[0202] Example 3: Genetically engineered bacteria YPTrp-PtrC-zwf G132C and W3110-PtrC-zwf G132C Construction
[0203] This invention uses the CRISPR-Cas9 gene editing method to edit the gene encoding the glucose-6-phosphate dehydrogenase mutant (amino acid sequence shown in SEQ ID NO:5) zwf. G132C (The nucleotide sequence is shown in SEQ ID NO:6) The adhE site (nucleotide sequence is shown in SEQ ID NO:1) of the L-tryptophan-producing strain (i.e., Escherichia coli CGMCC No. 25403) was overexpressed to construct a high-L-tryptophan-producing engineered strain of Escherichia coli. Details are as follows:
[0204] 1. Construction of adhE-pGRB plasmid
[0205] See step 1 of Example 1.
[0206] 2. Reorganization and Integration Framework PtrC-zwf G132C Preparation
[0207] zwf for overexpression at adhE sites G132C The recombination framework consists of upstream homologous arms -PtrC-zwf G132C - Downstream homologous arm composition. Using primer design software Primer5, based on PtrC-zwf... G132C Primers were designed based on the gene and its upstream and downstream homologous arm sequences (i.e., SEQ ID NO:10), as follows:
[0208] Ptrc-zwf-up-F: 5'-agcgggtaacgcgggttag-3' (SEQ ID NO: 17);
[0209] Ptrc-zwf-up-R: 5'-cctggaatgagtttgagtaagaatatctgccagcgtcctac-3' (SEQ IDNO: 18);
[0210] Ptrc-zwf-F: 5'-gtaggacgctggcagatattcttactcaaactcattccagg-3' (SEQ ID NO: 19);
[0211] Ptrc-zwf G132C -R: 5'-atttgcaaagggcttTgcgaggcaaaactgaatg-3' (SEQ ID NO: 29);
[0212] Ptrc-zwf G132C -F: 5'-agttttgcctcgcAaagccctttgcaaattgc-3' (SEQ ID NO: 30);
[0213] Ptrc-zwf-R: 5'-TGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGACCatggcggtaacgcaaacagc-3' (SEQ ID NO: 20);
[0214] Ptrc-zwf-down-F: 5'-TCCGCTCACAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAatatcagccgctttgttggtg-3' (SEQ ID NO: 21);
[0215] Ptrc-zwf-down-R: 5'-agcagatgatttactaaaaaagtttaacattatcagg-3' (SEQ ID NO: 22).
[0216] Using the genomic DNA of Escherichia coli CGMCC No. 25403 as a template, and primers Ptrc-zwf-up-F / Ptrc-zwf-up-R, Ptrc-zwf-down-F / Ptrc-zwf-down-R, and Ptrc-zwf-F / Ptrc-zwf G132C -R and Ptrc-zwf G132C -F / Ptrc-zwf-R amplify Ptrc-zwf respectively G132C Upstream and downstream homologous arms of the gene and Ptrc-zwf G132C Two mutant segments. The PCR reaction system is shown in Table 1. The PCR reaction procedure is as follows: pre-denaturation (95℃) for 5 min; then 30 cycles: denaturation (98℃) for 10 s, annealing (58℃) for 15 s, extension at 72℃ for 1 min; extension at 72℃ for another 10 min; maintenance (4℃).
[0217] The obtained upstream and downstream homologous arms and Ptrc-zwf G132C Using the two mutant segments as amplification templates, overlap PCR was performed using the aforementioned primers Ptrc-zwf-up-F / Ptrc-zwf-down-R to prepare the recombinant integration frame Ptrc-zwf. G132C .
[0218] The overlap PCR reaction system (Takara Bio PrimeSTAR HS enzyme) is shown in Table 3.
[0219] Overlap PCR reaction conditions: pre-denaturation (95℃) for 5 min; then 30 cycles: denaturation (98℃) for 10 s, annealing (58℃) for 15 s, extension at 72℃ (this enzyme activity extends by about 1 kb in 1.5 min); continue extension at 72℃ for 10 min; maintenance (4℃).
[0220] The final reorganization integration framework Ptrc-zwf G132C The nucleotide sequence is SEQ ID NO:10, where nucleotides 1 to 500 are Ptrc-zwf G132C The upstream homology arm (500 bp) contains nucleotides 501 to 1976 as zwf. G132C The reverse complementary sequence of the gene (1476 bp, i.e., SEQ ID NO:6, encoding the amino acid sequence shown in SEQ ID NO:5), nucleotides 1977 to 2050 are the reverse complementary sequence of the Ptrc promoter (74 bp), and nucleotides 2051 to 2550 are Ptrc-zwf. G132C Downstream homologous arm (500bp).
[0221] 3. Transformation of pREDCas9 plasmid
[0222] See step 3 of Example 1.
[0223] 4. adhE-pGRB plasmid and recombination integration frame Ptrc-zwf G132C transformation
[0224] The adhE-pGRB plasmid constructed in step 1 and the recombination integration frame Ptrc-zwf obtained in step 2 were combined. G132C (SEQ ID NO: 10) Simultaneously, the cells were electroporated into *E. coli* CGMCC No. 25403 competent cells containing the pREDCas9 plasmid obtained in step 3. The revived cells after electroporation were plated on LB agar plates containing ampicillin and zithromycin and incubated overnight at 32°C. The primers Ptrc-zwf-up-F / Ptrc-zwf were then used to... G132C -R and Ptrc-zwf G132C Colony PCR was performed using -F / Ptrc-zwf-down-R (see above for specific sequence) to screen for positive recombinants and preserve the bacteria.
[0225] 5. Plasmid elimination
[0226] The adhE-pGRB plasmid and pREDCas9 plasmid were eliminated from the above positive mutants using the plasmid elimination method in step 5 of Example 1, respectively. The positive recombinants were then sequenced and identified to obtain the recombinant strain YPTrp-Ptrc-zwf. G132C .
[0227] Recombinant strain YPTrp-Ptrc-zwf G132C Recombinant Escherichia coli (E. coli) was obtained by replacing the fragment shown in SEQ ID NO:1 of the adhE gene in the genome of E. coli CGMCC No.25403 with nucleotides 501 to 2050 of SEQ ID NO:10, while keeping the other nucleotide sequences of the E. coli CGMCC No.25403 genome unchanged. The recombinant strain is YPTrp-Ptrc-zwf. G132C The genome contains wild-type zwf naturally present in the E. coli genome and mutant zwf overexpressed at the adhE site. G132C Two copies.
[0228] Following the aforementioned method, using wild-type Escherichia coli strain W3110 as the starting strain, recombinant strain W3110-Ptrc-zwf was obtained. G132C Recombinant strain W3110-Ptrc-zwf G132C Recombinant Escherichia coli (E. coli) is obtained by replacing the fragment shown in SEQ ID NO:1 of the adhE gene in E. coli W3110 with nucleotides 501 to 2050 of SEQ ID NO:10, while keeping the other nucleotide sequences of the E. coli W3110 genome unchanged. Recombinant strain W3110-Ptrc-zwf G132C The genome contains wild-type zwf naturally present in the E. coli genome and mutant zwf overexpressed at the adhE site. G132C Two copies.
[0229] Example 4: L-Tryptophan Fermentation Experiment
[0230] Escherichia coli strain W3110, Escherichia coli strain CGMCC No. 25403, and the recombinant Escherichia coli strains prepared in Examples 1-3 were inoculated into 250 mL corner-baffled flasks containing 25 mL of seed culture medium (formula shown in Table 4) and cultured at 37°C and 220 rpm for 8 h. Then, 1 mL of the seed culture was transferred to a 500 mL corner-baffled flask containing 24 mL of fermentation medium (formula shown in Table 4) and cultured at 37°C and 220 rpm for another 36 h.
[0231] When the cultivation was completed, the concentration of L - tryptophan was determined by HPLC: An Agilent C18 chromatographic column (250 mm×4.6 mm, 5 μm, Agilent) was used. The mobile phase ratio was 0.3 g / L KH2PO4 (aqueous solution) mixed with methanol at a volume ratio of 9:1; the detection wavelength of the ultraviolet detector was 278 nm; the injection volume was 10 μL; the flow rate was 1.0 mL / min; the column temperature was 39 °C. The experiment was repeated three times, and the results are shown in Table 5.
[0232]
[0233]
[0234] Note: The annotation a represents the results of the significance analysis of the differences compared with Escherichia coli W3110; the annotation b represents the results of the significance analysis of the differences compared with Escherichia coli CGMCC No. 25403. The L - tryptophan yield (g / L) represents the yield of L - tryptophan in each liter of fermentation product.
[0235] The above fermentation results were analyzed by one - way analysis of variance. The results showed that: Whether for the industrial strain with high - yield L - tryptophan (Escherichia coli strain CGMCC No. 25403) or the model strain W3110, overexpressing another copy of the wild - type zwf gene or mutating the original wild - type zwf gene into zwf G132C mutant or overexpressing zwf G132C mutant all contributed to the increase in L - tryptophan yield. The industrial strain increased by 6.42%, 12.84% and 17.43% respectively, showing significant differences and highly significant differences.
[0236] The above has detailed the present invention. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need for unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations and conditions. Although the present invention gives specific embodiments, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by using conventional techniques known in the art that are outside the scope disclosed in this application.
Claims
1. A glucose-6-phosphate dehydrogenase mutant, characterized in that: The glucose-6-phosphate dehydrogenase mutant is any one of the following: A1) a protein obtained by replacing the 132nd amino acid residue in the sequence shown in SEQ ID NO:3 with a cysteine residue; A2) a fusion protein with the same function obtained by linking a tag protein to the N-terminus and / or C-terminus of the protein defined in A1).
2. The glucose-6-phosphate dehydrogenase mutant according to claim 1, characterized in that: The amino acid sequence of the glucose-6-phosphate dehydrogenase mutant is shown in SEQ ID NO:
5.
3. A biomaterial, characterized in that: The biological material is any one of the following: B1) a nucleic acid molecule encoding the glucose-6-phosphate dehydrogenase mutant of claim 1 or 2; B2) an expression cassette containing the nucleic acid molecule of B1); B3) a recombinant vector containing the nucleic acid molecule of B1) or a recombinant vector containing the expression cassette of B2); B4) a recombinant microorganism containing the nucleic acid molecule of B1), a recombinant microorganism containing the expression cassette of B2), or a recombinant microorganism containing the recombinant vector of B3); B5) A whole-cell catalyst containing the nucleic acid molecule described in B1), or a whole-cell catalyst containing the expression cassette described in B2), or a whole-cell catalyst containing the recombinant vector described in B3), or a whole-cell catalyst containing the recombinant microorganism described in B4).
4. The biomaterial according to claim 3, characterized in that: The nucleic acid molecule described in B1) is the nucleic acid molecule with the coding sequence SEQ ID NO:
6.
5. Recombinant Escherichia coli, characterized by: The expression level and / or activity of glucose-6-phosphate dehydrogenase in the recombinant Escherichia coli are enhanced; the enhanced expression level and / or activity is achieved by a point mutation of the polynucleotide encoding the amino acid sequence of glucose-6-phosphate dehydrogenase in SEQ ID NO:3; the point mutation causes the glycine residue at position 132 of the amino acid sequence of SEQ ID NO:3 to be replaced by a cysteine residue.
6. The use of the glucose-6-phosphate dehydrogenase mutant of claim 1 or 2, the biomaterial of claim 3 or 4, or the recombinant Escherichia coli of claim 5 in the production of L-tryptophan.
7. A method for producing L-tryptophan, comprising the following steps: fermenting and culturing the recombinant Escherichia coli according to claim 5, and obtaining L-tryptophan from the fermentation product.
Citation Information
Patent Citations
Recombinant microorganisms for increased production of organic acids
CN101128577A
Recombinant bacterium for producing L-tryptophan and method for increasing yield of L-tryptophan
CN118374425A