Use of OSA3 genes

Abstract

The application discloses application of an OSA3 gene, relates to the technical field of genetic engineering, and the nucleotide sequence of the OSA3 gene is shown as SEQ ID NO. 3. The application research proves that the OSA3 gene has the ability of regulating the deep root ratio of rice, and by using the ability, drought-resistant transgenic rice can be developed for arid regions. Meanwhile, the OSA3 gene knockout mutant osa3-1 / osa3-2 constructed by the application has the increased number of shallow root systems, and can be used for developing transgenic rice resistant to poor soil for poor soil regions, and enhancing the adaptability of rice germplasm to the environment.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically to the application of the OSA3 gene. Background Technology

[0002] Drought and water scarcity are major factors contributing to global food production decline. Drought stress severely impacts plant growth and development, even causing plant death. Rice is a crucial food crop, requiring 65% of agricultural irrigation water. Utilizing modern biological techniques to study the physiological and biochemical responses of plants to drought resistance, cloning important drought-resistant genes, and then transferring them into plants to cultivate new crop varieties with enhanced stress resistance, especially water-saving and drought-resistant rice varieties, is an effective way to alleviate the pressure on food production caused by global drought and water scarcity, as well as population growth.

[0003] Plants have developed a series of adaptive mechanisms to cope with abiotic stresses such as drought over a long period of evolution. Under drought stress, plants reduce water transpiration by regulating stomatal closure and increase water absorption by promoting root growth, thereby effectively avoiding damage from drought stress. Among these, root growth regulation plays a crucial role in the drought resistance of rice. When surface water is scarce, plants can enhance their ability to cope with drought stress by promoting downward root growth to absorb water from deeper soil layers. In research on gramineous crops, the ratio of the number of roots growing downward (at an angle of 50-90° to the horizontal) to the number of roots growing laterally (at an angle of 0-50° to the horizontal) is called the deep root ratio. Generally, plants with a larger deep root ratio have a stronger ability to absorb deep water and therefore stronger drought resistance (CN118460554A, CN118291487A).

[0004] Deep roots can enhance a plant's drought resistance, while shallow roots can improve its ability to absorb phosphorus fertilizer from the shallow soil layer (Journal of Experimental Botany, 2020, 71, 5752–5763). However, research on these regulatory genes is still relatively scarce. Therefore, discovering more functional genes that control root morphology is an urgent problem to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides the application of the OSA3 gene.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] The application of the OSA3 gene is to regulate the deep root ratio and / or the number of rice roots, and the nucleotide sequence of the OSA3 gene is shown in SEQ ID NO.3.

[0008] As a preferred technical solution, the application increases the expression level of the OSA3 gene, increases the deep root ratio and / or the number of deep roots in rice, and improves drought resistance.

[0009] Knocking out the OSA3 gene reduces the ratio of deep roots and / or increases the number of shallow roots in rice, thereby improving its resistance to nutrient deficiency.

[0010] Another object of the present invention is to provide a biomaterial, wherein the biomaterial is any one of the following:

[0011] A: An expression cassette capable of overexpressing or knocking out the OSA3 gene with a nucleotide sequence as shown in SEQ ID NO: 3;

[0012] B: A recombinant vector containing the expression cassette described in A;

[0013] C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

[0014] Another object of the present invention is to provide an application of the above-mentioned biomaterial, said application being the regulation of the deep root ratio and / or the number of rice roots.

[0015] Another objective of this invention is to provide a method for increasing the deep root ratio of rice by using transgenic means to increase the expression level of the OSA3 gene; wherein the nucleotide sequence of the OSA3 gene is shown in SEQ ID NO.3.

[0016] Another objective of this invention is to provide a method for improving the drought resistance of rice by using transgenic means to increase the expression level of the OSA3 gene; wherein the nucleotide sequence of the OSA3 gene is shown in SEQ ID NO.3.

[0017] Another objective of this invention is to provide a method for improving the resistance of rice to nutrient deficiency by using gene editing techniques to knock out the expression level of the OSA3 gene; wherein the nucleotide sequence of the OSA3 gene is shown in SEQ ID NO.3.

[0018] Another object of the present invention is to provide a mutant gene of the OSA3 gene, wherein the mutant gene is formed by inserting C between positions 881-882 of the nucleotide sequence SEQ ID NO.3, or by deleting CAACAG between positions 880-885 of the nucleotide sequence SEQ ID NO.3.

[0019] Another object of the present invention is to provide a biological material containing the above-mentioned mutated gene, wherein the biological material is an expression cassette, a recombinant vector and / or a recombinant microorganism.

[0020] Another object of the present invention is to provide the application of the above-mentioned mutant gene or the above-mentioned biological material, said application being to increase the number of shallow roots in rice, and / or to increase the amount of phosphorus fertilizer absorbed by the roots, and / or to construct a model for reducing the ratio of deep roots in rice.

[0021] Beneficial Effects: This invention demonstrates that the OSA3 gene has the ability to regulate the deep root ratio in rice. Overexpression of this gene increases both the number and ratio of deep roots. Utilizing this ability, drought-resistant transgenic rice can be developed for arid regions. Simultaneously, the OSA3 gene knockout mutants osa3-1 / osa3-2 constructed in this invention exhibit an increased number of shallow roots, enabling the development of soil-poor-resistant transgenic rice for areas with poor soil conditions, thereby enhancing the adaptability of rice germplasm to the environment. Attached Figure Description

[0022] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0023] Figure 1 This is the result of comparing the conserved domains of the OSA3 protein with some rice OSAs member protein sequences using MEGA7 software in this invention.

[0024] Figure 2 This refers to the expression level of the OSA3 gene in various rice tissues according to the present invention.

[0025] Figure 3 The detection of the OSA3 gene sequence in rice plants transformed with the CRISPR / Cas9 gene editing vector of the present invention; ZH11: wild-type rice (Zhonghua 11), osa3-1 and osa3-2 are gene knockout transgenic rice;

[0026] Figure 4 The expression level of the target gene in transgenic rice overexpressing the OSA3 gene of this invention;

[0027] Figure 5 The results show the root changes of rice and wild-type rice transformed by the OSA3 gene CRISPR / Cas9 gene editing vector of this invention. ZH11: wild-type rice (Zhonghua 11), osa3-1 and osa3-2 are gene knockout transgenic rice.

[0028] Figure 6The results of root changes in transgenic rice overexpressing the OSA3 gene and wild-type rice of the present invention are shown. ZH11: wild-type rice (Zhonghua 11), OE1, OE2 and OE3 are transgenic rice overexpressing the OSA3 gene. Detailed Implementation

[0029] To facilitate understanding of the present invention, a more complete description of the invention will be provided below with reference to embodiments, of which preferred embodiments are given below. However, the invention can be implemented in many different forms and is not limited to the embodiments described herein. These embodiments are provided to provide a thorough and complete understanding of the disclosure of the invention. It should be understood that experimental methods not specifically described in the following embodiments are generally performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer. All commonly used reagents used in the embodiments are commercially available products.

[0030] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. The term "and / or" as used herein includes any and all combinations of one or more of the associated listed items.

[0031] In this invention, the term "expression cassette" refers to DNA capable of expressing a target gene in a host cell. This DNA may include not only promoters that initiate transcription of a protein-coding gene, but also terminators that terminate transcription of a protein-coding gene. Preferably, the expression cassette may further include an enhancer sequence.

[0032] In this invention, the term "carrier" refers to any carrier known in the art, such as commercially available carriers, including plasmids, granules, etc.

[0033] Example 1

[0034] Cloning of the rice OSA3 gene

[0035] The predicted coding region cDNA sequence of the rice OSA3 gene LOC_Os12g44150 was obtained by searching the rice genome and full-length gene database. Upstream and downstream primers were designed based on the predicted information.

[0036] OSA3F (5'-ATGGCTGAGAAGGAGGGCAA-3', SEQ ID NO.1) and

[0037] OSA3R(5'-TCACACGGTGTAAGACTGCT-3',SEQ ID NO.2),

[0038] The OSA3 gene was directly cloned from cDNA, recovered via gel electrophoresis, ligated into the pEASY-Blunt vector, identified, and sequenced. The sequencing results were confirmed by BLAST alignment. The results showed that the length of the rice OSA3 coding region cDNA in this invention is 2871 bp, and the detailed sequence is shown in SEQ ID NO.3.

[0039]

[0040] Example 2

[0041] Rice OSA3 protein sequence information and homology analysis

[0042] Based on the ORF of the rice OSA3 gene according to this invention, the amino acid sequence of rice OSA3 was deduced, consisting of 956 amino acids (SEQ ID NO. 4) with a molecular weight of 105.44 kDa. Alignment using the BLASTP program on the NCBI website (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) showed that the OSA3-encoded protein has an H2O region located on the plasma membrane (PM). + -ATPase-specific domains belong to PM H + -ATPase family. Sequence alignment of conserved domains of OSA3 with some PM H+-ATPase-encoded proteins in rice (see appendix). Figure 1 We found that this protein has high homology with its family of proteins, all of which contain conserved transmembrane domains TM1-TM10 and a self-inhibitory domain at the C-terminus.

[0043] MAEKEGNLDAVLKEAVDLENIPLEEVFENLRCSREGLTTQQAQQRLEIFGPNKLEEKEESKFLKFLGFMWNPLSWVMEAAAIMAIALANGGGKPPDWQDFVGIITLLVINSTISFIEENNAGNAAAALMARLAPKAKVLRDGRWTEEEAAILVPGDIVSIKLGDIIPADARLLEGDPLKIDQSALTGESLPVTKGPGDGVYSGSTVKQGEIEAIVIATGVHTFFGKAAHLVDSTNQVGHFQKVLTAIGNFCICSIAVGMFVEIIVMYPIQHRAYRPGIDNLLVLLIGGIPIAMPTVLSVTMAIGSHRLSQQGAITKRMTAIEEMAGMDVLCSDKTGTLTLNKLTVDKNLIDVFERGITQDQVILMAARASRTENQDAIDTAIVGMLADPKEARAGIQEVHFLPFNPTDKRTALTYIDGDGKMYRVSKGAPEQILHLAHNKPEIERRVHAVIDKFAERGLRSLAVAYQEVPEGTKESPGGPWHFVGLMPLFDPPRHDSAETIRRALNLGVNVKMITGDQLAIGKETGRRLGMGTNMYPSSALLGQNKDESIAALPVDDLIEKADGFAGVFPEHKYEIVKRLQARKHICGMTGDGVNDAPALKKADIGIAVADATDAARSASDIVLTEPGLSVIISAVLTSRAIFQRMKNYTIYAVSITIRIVLGFMLLALIWKFDFPPFMVLIIAILNDGTIMTISKDRVKPSPLPDSWKLAEIFTTGVVLGGYLAMMTVIFFWAAYKTDFFPRIFHVESLEKTAQDDFQKLASAVYLQVSTISQALIFVTRSRSWSFVERPGFLLVFAFLVAQLIATLIAVYADWAFTSIKGIGWGWAGIVWLYNLIFYFPLDIIKFLIRYALSGKAWDLVIEQRIAFTRKKDFGKEERELKWAHAQRTLHGLQPPDAKMFSEKAGYNELNQMAEEAKRRAEIARLRELHTLKGHVESVVKLKGLDIETIQQSYTV*, SEQ ID NO.4。

[0044] Example 3

[0045] Expression analysis of rice OSA3 gene in various tissues and organs

[0046] 1. Seedling cultivation

[0047] Seedling stage: Select plump Japonica rice seeds of Zhonghua 11, disinfect them with 2.5% NaClO for 20 minutes, clean them, and place them at 30℃ to germinate. After the seeds show white sprouts, place them in a germination box for hydroponic growth. After the three-leaf stage, apply nutrient solution (standard nutrient solution of the International Rice Research Institute). After the four-leaf stage, take new leaves and roots to prepare for RNA extraction.

[0048] Mature stage: After the four-leaf stage of the japonica rice 'Zhonghua 11', transplant it into the paddy field. During the booting stage, take leaves, leaf sheaths, roots, tillers and spikelets from the plant to prepare for RNA extraction.

[0049] 2. RNA extraction

[0050] RNA extraction: The sample was frozen in liquid nitrogen in a mortar and then ground into powder. The powder was added to a 2 mL EP tube containing 1 mL of TRNzol-A+ reagent (Tiangen Biotech Co., Ltd.), shaken thoroughly, and incubated at room temperature for 5 min. Then, 0.2 mL of chloroform was added, shaken vigorously for 15 s, and incubated at room temperature for 3 min. The mixture was then centrifuged at 12000 rpm for 10 min at 4 °C. The supernatant was transferred to a new 2 mL EP tube, and an equal volume of isopropanol was added to precipitate the RNA. The RNA was dissolved in 100 μL of N-methyl-N-ethylase-free ddH2O. The total RNA mass was identified by electrophoresis, and the RNA content was then determined using a spectrophotometer.

[0051] 3. First-strand cDNA synthesis

[0052] (1) Before reverse transcription, the extracted RNA sample needs to be digested with DNase I. The reaction system is shown in Table 1:

[0053] Table 1

[0054]

[0055] (2) Incubate the above reaction system at 42℃ for 30 min; then heat at 85℃ for 5 min to inactivate the reverse transcriptase and prevent it from binding to DNA; place at 4℃ or on ice for 5 min. The prepared cDNA can be used immediately or stored at -20℃ for later use.

[0056] 4. Quantitative PCR analysis

[0057] (1) The quantitative system for gene transcription using cDNA obtained from reverse transcription as a template is shown in Table 2:

[0058] Table 2

[0059]

[0060] Forward primer: AATTCGGCGGGCACTTAATC, SEQ ID NO. 5, Reverse primer: TTTGTTCGTCCCAGCAAAGC, SEQ ID NO. 6.

[0061] (2) Using a Bio-Rad CFX96 Real-Time PCR instrument, the reaction program was: 94℃ for 30 s; 94℃ for 5 s, 55℃ for 15 s, 72℃ for 10 s, 40 cycles; 72℃ for 1 min; the melting curve was set from 95.0℃ to 65.0℃, 5 s, with an interval of 0.5℃. Each reaction was repeated in triplicate. The rice OsUbi5 gene was used as an internal reference gene, and data analysis was performed using 2... -△Ct Law or 2 -△△Ct Law.

[0062] Quantitative analysis results show (see appendix) Figure 2 The OSA3 gene is mainly expressed in leaves, with higher expression levels in leaf blades and leaf sheaths. It is also expressed in nodes and tillers.

[0063] Example 4

[0064] Construction and transformation of rice OSA3 gene CRISPR / Cas9 knockout vector and overexpression vector

[0065] 1. Constructing a vector for OSA3 gene editing using the CRISPR / Cas9 system:

[0066] Based on the genomic information of OSA3, and combined with the CRISPR-P 2.0 (MolecularPlant.2017,10(3):530-532) of Huazhong Agricultural University, a target was designed. Among the predicted sgRNAs, fragments with low off-target efficiency, good specificity, and located in the exon region were selected. Finally, sgRNA:5'-CCATGCCAACAGTCTTATCTGTG-3' (SEQ ID NO.7) was selected as the target. Then, using the CRISPR / Cas9 gene editing system vector provided by Professor Liu Yaoguang of South China Agricultural University, the pYLsgRNA-OsU6A / LacZ vector was mainly used to amplify the U6 promoter and sgRNA expression cassette. Using the pYLgRNA-OsU6a / LacZ plasmid as a template, PCR amplification was performed in two systems, gR-R and OSA3-U6a (CACAGATAAGACTGTTGGCATGGCGGCAGCCAAGCCAGCA, SEQ ID NO.7) were amplified. NO.8) Amplify the U6a-target fragment, and amplify the gRNA-target fragment using UF and OSA3-gRT (CCATGCCAACAGTCTTATCTGTGGTTTTAGAGCTAGAAAT, SEQ ID NO.9). A second round of overlapping PCR was performed using U-GAL and Pgs-GAR to fuse the U6 promoter and sgRNA cassette together, yielding the OSA3-sgRNA expression cassette. The pYLCRISPR / Cas9-MH vector was digested with BsaI, and the resulting linearized vector was recombined with the fused sgRNA expression cassette. The Ub and sgRNA expression cassette were integrated into the pYLCRISPR / Cas9-MH editing vector containing the Cas9 protein. This vector was used for expression in plants.

[0067] 2. Construction of plant expression vectors overexpressing the OSA3 gene

[0068] Using the pEASY-Blunt vector containing the OSA3 gene obtained in Example 1 as a template, PCR amplification was performed using the front primer osa3f: 5'-GAGAACACGGGGACTCTAGAATGGCTGAG AAGGAGGGCAA-3' (SEQ ID NO.10) and the back primer osa3r: 5'-GCCCT TGCTCACCATTTCGAACACGGTGTAAGACTGCT-3' (SEQ ID NO.11). After the amplification product was recovered and purified, the fragment was cloned into the plant overexpression vector p35S2 (using the commercial plasmid pCAM BIA1300 as the chassis, the overexpression element CaMV35S promoter-GFP tag protein-NOSR terminator was chemically synthesized, and this fragment was recombined into the pCAMBIA1300 vector using recombination. Positive clones were screened and sequenced for confirmation, thus obtaining the plant expression vector with a GFP tag driven by the CaMV promoter, named p35S2). Positive clones were screened. The specific process is as follows:

[0069] (1) PCR amplification

[0070] The 50 μL reaction system is as follows:

[0071] Table 3

[0072]

[0073] Amplification program: 98℃ pre-denaturation for 2 min, 98℃ for 10 s, 60℃ for 5 s, 68℃ for 20 s, 30 cycles.

[0074] The PCR products were purified and recovered using a standard agarose gel DNA recovery kit (Beijing TransGen Biotech Co., Ltd.).

[0075] (2) Recombination reaction

[0076] The purpose of the recombination reaction is to recombine PCR products containing adapters with sequences identical to those at both ends of the vector's restriction enzyme sites into the p35S2 vector to generate a CaMV35S promoter-driven overexpression vector. The recombination reaction can be performed at room temperature in 0.5 mL centrifuge tubes after thorough mixing. The reaction system is as follows:

[0077] Table 4

[0078]

[0079] The reaction solution was incubated at 35℃ for approximately 30 minutes, and then transformed into competent E. coli cells. The transformed E. coli culture was then plated on a plate containing kanamycin for growth. Single colonies were then picked for PCR verification, followed by sequencing. The sequencing results were compared with the cDNA sequence of the gene to confirm sequence accuracy. Finally, the plasmid was extracted and transformed into Agrobacterium EHA105.

[0080] 3. Agrobacterium-mediated transformation

[0081] (1) Preparation of Agrobacterium tumefaciens (EHA105) competent cells:

[0082] Agrobacterium tumefaciens culture was incubated at 28°C until OD 600 When the concentration of the bacterial cell was 0.5, the cells were collected by centrifugation at 4°C, resuspended in 500 μL of 0.1 mol / L ice-bath CaCl2, centrifuged for 30 min, the supernatant was discarded, and the cells were resuspended in 100 μL of 0.1 mol / L ice-bath CaCl2 and stored at 4°C.

[0083] (2) Agrobacterium-mediated transformation was performed using the freeze-thaw method:

[0084] Add 5 μL of plant expression vector plasmid DNA to 100 μL of Agrobacterium competent cells, mix gently, incubate in an ice-water bath for 30 min, and then freeze-shock in liquid nitrogen for 2 min. Add 400-800 μL of YEP culture medium (containing kanamycin, Kan). Incubate at 28℃ with shaking at 200 rpm for 3-5 h. Centrifuge at room temperature (5000 rpm, 5 min), retain 100 μL of supernatant to resuspend the cells, spread on LB solid medium (containing Kan), and incubate upside down at 28℃ for 2 days until colonies of suitable size grow. Pick single clones for PCR detection to obtain positive strains.

[0085] 4. Callus induction: Rinse seeds with sterile water for 15-20 minutes, then disinfect with 75% ethanol for 1 minute, followed by sterilization with 1.5% sodium hypochlorite solution by shaking for 20 minutes. Finally, rinse five times with sterile water. Pat the washed seeds dry with absorbent paper and inoculate them into callus induction medium. Incubate in the dark at 25°C for 2 weeks.

[0086] Callus induction medium: The induction medium in Table 5 was used. 0.3g proline, 0.6g hydrolyzed casein, 30g sucrose and 2.5mL 2,4-D (concentration 1mg / mL) were added to prepare a 1L solution. The pH was adjusted to 5.9, 7g agar powder was added, and the solution was sterilized by high temperature and high pressure.

[0087] 5. Subculture: Cut off the embryogenic callus tissue, inoculate it into the subculture medium, and culture it in the dark at 25°C for 2 weeks.

[0088] Subculture medium: The subculture medium in Table 5 was used. 0.5 g proline, 0.6 g hydrolyzed casein, 30 g sucrose and 2 mL 2,4-D (concentration 1 mg / mL) were added to prepare a 1 L solution. The pH was adjusted to 5.9, 7 g agar powder was added, and the solution was autoclaved at high temperature.

[0089] 6. Agrobacterium infection and callus co-culture: Culture Agrobacterium, pick positive single colonies, and incubate overnight at 28°C in 1 mL of Agrobacterium culture medium (containing antibiotics); take the above culture and add it to 50 mL of Agrobacterium culture medium (containing antibiotics), and incubate at 28°C until OD reaches 100°C. 600 =0.6-1.0. Centrifuge the obtained Agrobacterium tumefaciens bacterial suspension, add the collected bacterial cells to the suspension culture medium, and incubate with shaking for 30 min until OD reaches 0.6-1.0. 600 =0.6-1.0. Then, the callus tissue was placed in a suspension culture medium containing Agrobacterium tumefaciens and cultured with shaking for about 20 minutes. The callus tissue was then dried on sterile filter paper and transferred to a co-culture medium, and cultured in the dark at 25°C for 5 days.

[0090] Suspension culture medium: Using the suspension culture medium in Table 5, add 0.08 g hydrolyzed casein, 2 g sucrose, and 0.2 mL 2,4-D (concentration 1 mg / mL) to prepare a 100 mL solution. Adjust the pH to 5.4, divide into two bottles (50 mL each), and autoclave. Before use, add 1 mL of 50% glucose and 100 μL of AS (100 mM).

[0091] Co-culture medium: Use the co-culture medium in Table 5, add 0.8 g hydrolyzed casein, 20 g sucrose and 3.0 mL 2,4-D (concentration 1 mg / mL) to prepare a 1 L solution, adjust the pH to 5.6, add 7 g agar powder, and autoclave. Before use, add 20 mL 50% glucose and 1 mL AS (100 mM).

[0092] 7. Screening culture: After co-culturing for 3 days, select good callus tissues, transfer them to screening culture medium, and incubate in the dark at 25℃ for 2 weeks, and screen twice.

[0093] Screening medium: Using the screening medium in Table 6, add 0.6 g hydrolyzed casein, 30 g sucrose, and 2.5 mL 2,4-D (concentration 1 mg / mL) to prepare a 1 L solution. Adjust the pH to 6.0, add 7 g agar powder, and autoclave. Before use, add 1 mL Hn and 1 mL Cn (100 ppm).

[0094] 8. Differentiation culture: Embryogenic callus tissue was picked and inoculated into differentiation medium, and induced to differentiate into shoots at 24℃ for 16h / 8h light and dark (4-6 weeks).

[0095] Differentiation medium: The differentiation medium in Table 6 was prepared by adding 2.0 mg / L 6-BA, 2.0 mg / L KT, 0.2 mg / L NAA, 0.2 mg / L IAA, 1.0 g hydrolyzed casein and 30 g sucrose to make a 1 L solution. The pH was adjusted to 6.0, 7 g agar powder was added, and the solution was autoclaved at high temperature.

[0096] 9. Rooting culture: When the bud grows to about 2cm, cut off the bud and insert it into the rooting culture medium. Induce rooting by culturing at about 25℃ for 16h / 8h in light and dark.

[0097] Rooting medium: Use the rooting medium in Table 6, add 30g of sucrose to make 1L solution, adjust the pH to 5.8, add 7g of agar powder, and autoclave.

[0098] 10. Transformation of plantlets: After the root system has developed, open the test tube, add sterile water to harden the seedlings for 2-3 days, then take out the plants, wash off the attached solid culture medium with sterile water, and transfer them into the soil. Initially, provide shade and shelter from the wind. After the plants are strong, carry out conventional field or greenhouse management and cultivation.

[0099] Table 5. Basic Culture Medium Components 1

[0100]

[0101] Table 6. Basic Culture Medium Components 2

[0102]

[0103] 11. Detection of target site sequences and identification of mutation types in CRISPR knockout-positive plants

[0104] DNA was extracted from leaves of transgenic T2 generation plants. Primers (CGGCTATTGGGAATTTCTGC, SEQ ID NO.12; TGAGGTTCTTGTCCACGGTG, SEQ ID NO.13) were designed approximately 500 bp upstream and downstream of the sgRNA target site for PCR amplification. First-generation sequencing of the amplified fragments identified two homozygous mutation types: a 1 bp insertion (C inserted between positions 881-882 of SEQ ID NO.3) and a 6 bp deletion (CAACAG deleted between positions 880-885 of SEQ ID NO.3). After translation into amino acid sequences, these mutations resulted in premature termination of OSA3 translation and a deletion of two amino acids in the coding region, respectively (see Appendix). Figure 3 ).

[0105] 12. Detection of target gene expression level in transgenic rice overexpressing OSA3 gene

[0106] RNA was extracted from leaves of transgenic T2 generation plants, and the expression level of the target gene in OSA3-overexpressing plants was detected using the quantitative PCR method described in Example 3. The results are attached. Figure 4 As shown, in the three transgenic lines tested, the expression level of OSA3 was significantly higher than that of the wild-type plants, increasing by 32 to 59 times.

[0107] Example 5

[0108] Phenotypic determination of transgenic rice

[0109] After disinfecting the identified Osa3 knockout mutant seeds (2.5% NaClO for 20 minutes), rinse them thoroughly and place them at 30℃ to germinate. Once the seeds show white sprouts, place them in a germination box for hydroponic growth. When they reach the three-leaf-one-heart stage, transplant them into baskets containing soil and place them in a water tank for planting. After 45 days of growth, remove the baskets from the water tank. Count the number of roots on the sides of the basket as shallow roots and the number of roots at the bottom of the basket as deep roots. Calculate the total number of roots and use the percentage of deep roots to the total number of roots as the deep root ratio (see Appendix). Figure 5 ).

[0110] The experimental results show that the deep root ratio of the osa3 knockout mutant is significantly lower than that of the wild-type plant, while the number of shallow roots is increased.

[0111] Seeds from OSA3 overexpressing transgenic families were dehulled and sterilized (treated with 75% alcohol for 1 min, 1.5% NaClO for 20 min, and washed 5 times with sterile water). Germination was carried out on 1 / 2 MS medium containing 50 mg / L hygromycin, while the wild-type control was grown on 1 / 2 MS medium without hygromycin. After 2-3 days of germination, well-germinated and uniformly growing seeds were selected and transferred to baskets containing soil, which were then placed in a water tank filled with nutrient solution for planting. After approximately 50 days of growth, the baskets were removed, and the root length of the taproot was measured. The number of roots on the sides and bottom of the basket was counted, and the total number of roots and the root depth ratio were calculated.

[0112] The experimental results show that the number of shallow roots in OSA3 transgenic rice is similar to that of wild-type rice, but its root length, number of deep roots, and deep root ratio are all significantly higher than those of wild-type rice. Figure 6 This result indicates that overexpression of OSA3 improves the deep root system of rice.

[0113] The above results indicate that the OSA3 gene positively regulates the deep root ratio of plants, and its overexpression can increase the deep root ratio of plants, which can be applied to the development of drought-resistant transgenic rice. The number of shallow roots increased in mutants with the gene knocked out, indicating that the gene knockout mutants have a potentially stronger ability to absorb nutrients (phosphate fertilizer) from shallow soil.

[0114] The various embodiments in this specification are described in a progressive manner, with each embodiment focusing on the differences from other embodiments. The same or similar parts between the various embodiments can be referred to each other.

[0115] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. OSA3 The use of a gene, characterized in that The application is for regulating the deep root ratio and / or the number of rice roots, and the OSA3 The nucleotide sequence of the gene is shown as SEQ ID NO.

3.

2. The method of claim 1 OSA3 The use of a gene, characterized in that increasing OSA3 the expression of the gene, increasing the deep root ratio and / or the number of deep roots of the rice plant, and increasing the drought resistance.

3. Use of a biomaterial, characterized in that, The application is to regulate the deep root ratio and / or the number of rice roots of rice; The biological material is any one of the following: A: capable of enabling the nucleotide sequence as shown in SEQ ID NO: 3 OSA3 expression cassette for gene overexpression or knockout; B: a recombinant vector containing the expression cassette of A; C: a recombinant microorganism containing the expression cassette of A or the recombinant vector of B.

4. A method for increasing the deep root ratio of rice, characterized by, Using genetic engineering to improve OSA3 Gene expression levels; wherein, the... OSA3 The nucleotide sequence of the gene is shown in SEQ ID NO.

3.

5. A method for improving drought tolerance in rice, the method comprising introducing into a rice plant a nucleic acid molecule encoding a protein having the amino acid sequence of SEQ ID NO:

2. Using genetic engineering to improve OSA3 Gene expression levels; wherein, the... OSA3 The nucleotide sequence of the gene is shown in SEQ ID NO.3.

Images