Primer group of HLA (human leukocyte antigen) gene, detection kit and detection method
By designing an HLA gene primer set compatible with uniform PCR reaction conditions, the problems of incomplete regional detection and complex operation in existing HLA typing detection are solved, realizing efficient and accurate HLA typing detection with full coverage, which is suitable for large-scale, high-throughput detection.
Patent Information
- Application Number
- CN202511321675.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-16
- Publication Date
- 2025-12-26
AI Technical Summary
Existing HLA typing methods suffer from incomplete detection areas, cumbersome operation, and low resolution. Furthermore, long-distance PCR amplification makes it difficult to achieve efficient and accurate HLA gene detection.
A primer set for HLA genes is provided, containing 9 primers designed to be compatible with uniform PCR reaction conditions. It can amplify 11 gene classes, including HLA-A, HLA-B, HLA-C, HLA-DPA1, HLA-DPB1, HLA-DQA1, HLA-DQB1, HLA-DRB1, HLA-DRB3, HLA-DRB4, and HLA-DRB5, covering all their subtypes. It can be used for high-throughput detection by combining sequencing adapters and next-generation sequencers.
It achieves full-domain HLA genotyping, simplifies the operation process, and improves the sensitivity and success rate of detection, making it suitable for large-scale, high-throughput HLA genotyping.
Smart Images

Figure CN121204221A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biomedical detection technology, specifically relating to a... HLA Primer sets for genes, as well as detection kits and detection methods. Background Technology
[0002] Human leukocyte antigen (HLA) HLA The gene is a highly polymorphic gene cluster located on the short arm (6p21.3) of chromosome 6, encoding the major histocompatibility complex (MHC) protein in the immune system. HLA Genes play a decisive role in T-cell antigen-specific responses, organ transplant matching, risk assessment of autoimmune diseases, and tumor immunotherapy. HLA Genes are divided into three categories, including category I (including HLA-A , HLA-B and HLA-C ) and class II HLA molecules (mainly including HLA-DPA1 , HLA-DPB1 , HLA-DQA1 , HLA-DQB1 , HLA-DRB1 , HLA-DRB3 , HLA-DRB4 and HLA- DRB5 It plays a major role in the aforementioned biological events.
[0003] Currently, the World Health Organization recommends testing. HLA The gold standard for genotyping is PCR-SBT (sequence-based typing). This method involves... HLA Amplicon from a fixed region was obtained by Sanger sequencing. HLA The sequence was determined by comparison with a database. HLA The method has the characteristics of high accuracy and ability to identify new subtypes. However, the method has the following drawbacks: (1) The detection area is incomplete, usually for... HLA-A and HLA-B The detection is limited to exons 2-4, missing information about other exons; (2) The operation is cumbersome, requiring the use of multiple pairs of primers to detect a single exon. HLA Different exons of genes; (3) Low resolution, does not detect the diversity of introns.
[0004] Detection methods based on second- and third-generation sequencing first use DNA or cDNA as a template to amplify the full-length DNA using PCR. HLA The sequence is then processed through a series of steps, including enzyme digestion, end repair, and adapter ligation, to prepare a second-generation sequencing library, or by directly ligating relevant sequencing adapters for third-generation sequencing. These two methods are used in amplification... HLAEach gene only needs a pair of primers, reducing the number of PCR reactions; high-throughput can be achieved by adding barcodes to different samples HLA detection, which can overcome the limitations of PCR-SBT method. However, since HLA The length of the molecule can reach 10 kb, far exceeding the effective amplification limit of conventional PCR, so it is necessary to carefully optimize the primer sequence and PCR reaction system to realize efficient and accurate long distance PCR (Long range PCR, LR-PCR) amplification. The existing amplification method needs to set up independent thermal cycle program for different target genes, or additional extension factor, the lack of system compatibility leads to the fragmentation of the operation process, increases the complexity of the experiment. SUMMARY
[0005] In view of the above prior art, the present application provides a kind of HLA The primer set of the gene and the detection kit and detection method, compatible unified PCR reaction condition, with long distance amplification success rate is high, sensitivity is high, the advantages of amplification product covers intron, can analyze HLA The entire four domains of the gene, suitable for large-scale, high-throughput HLA Genotyping detection.
[0006] In order to achieve the above purpose, the technical scheme adopted by the present application is to provide a kind of HLA The primer set of the gene is composed of the following 9 groups of primers, and the sequence information is as follows: The nucleotide sequence of the forward primer HLA-A-F is shown in SEQ ID No.1 in the sequence table; The nucleotide sequence of the reverse primer HLA-A-R is shown in SEQ ID No.2 in the sequence table; The nucleotide sequence of the forward primer HLA-B-F is shown in SEQ ID No.3 in the sequence table; The nucleotide sequence of the reverse primer HLA-B-R is shown in SEQ ID No.4 in the sequence table; The nucleotide sequence of the forward primer HLA-C-F is shown in SEQ ID No.5 in the sequence table; The nucleotide sequence of the reverse primer HLA-C-R is shown in SEQ ID No.6 in the sequence table; The nucleotide sequence of the forward primer HLA-DPA1-F is shown in SEQ ID No.7 in the sequence table; The nucleotide sequence of the reverse primer HLA-DPA1-R is shown in SEQ ID No.8 in the sequence table; The nucleotide sequence of the forward primer HLA-DPB1-F is shown in SEQ ID No.9 in the sequence table; The nucleotide sequence of the reverse primer HLA-DPB1-R is shown in SEQ ID No. 10 in the sequence listing; The nucleotide sequence of the forward primer HLA-DQA1-F is shown in SEQ ID No. 11 in the sequence listing; The nucleotide sequence of the reverse primer HLA-DQA1-R is shown in SEQ ID No. 12 in the sequence listing; The nucleotide sequence of the forward primer HLA-DQB1-F is shown in SEQ ID No. 13 in the sequence listing; The nucleotide sequence of the reverse primer HLA-DQB1-R is shown in SEQ ID No. 14 in the sequence listing; The nucleotide sequence of the forward primer HLA-DRB1-F is shown in SEQ ID No. 15 in the sequence listing; The nucleotide sequence of the reverse primer HLA-DRB1-R is shown in SEQ ID No. 16 in the sequence listing; The nucleotide sequence of the forward primer HLA-DRB345-F is shown in SEQ ID No. 17 in the sequence listing; The nucleotide sequence of the reverse primer HLA-DRB345-R is shown in SEQ ID No. 18 in the sequence listing; Alternatively, the 9 groups of primers respectively having at least 80% sequence identity with the sequences shown in SEQ ID No. 1 to SEQ ID No. 18, the nucleotide sequences of which can be used as primers to specifically amplify the target sequences corresponding to the primers SEQ ID No. 1 to SEQ ID No. 18 in the PCR reaction.
[0007] On the basis of the above technical solutions, the application can be further improved as follows.
[0008] Further, the primers HLA-A-F and HLA-A-R, HLA-B-F and HLA-B-R, HLA-C-F and HLA-C-R, HLA-DPA1-F and HLA-DPA1-R, HLA-DQA1-F and HLA-DQA1-R, and HLA-DQB1-F and HLA-DQB1-R respectively amplify HLA- A , HLA-B , HLA-C , HLA-DPA1 , HLA-DQA1 , HLA-DQB1 the 5' UTR to 3' UTR region of the gene, and the primers HLA-DPB1-F and HLA-DPB1-R, and HLA-DRB1-F and HLA-DRB1-R respectively amplify HLA-DPB1 , HLA-DRB1Exon 2 to 3' UTR region of the gene, primer HLA-DRB345-F and HLA-DRB345-R amplify HLA-DRB3 、 HLA-DRB4 and HLA- DRB5 Exon 2 to 3' UTR region of the gene.
[0009] The application takes the beneficial effects of the above further technical solutions: the primer set provided by the application contains primers for amplifying HLA-A 、 HLA-B 、 HLA-C 、 HLA-DPA1 、 HLA-DPB1 、 HLA-DQA1 、 HLA-DQB1 、 HLA-DRB1 and HLA-DRB3 、 HLA-DRB4 、 HLA-DRB5 11 types of genes. Multiple sequence alignment is performed on all subtypes of HLA genes, and primer sequences are designed in highly conserved homologous regions. The specificity of the screened primer sequences is verified by PCR, and no non-specific amplification is produced. The primers are optimized for sequence, compatible with unified PCR reaction conditions, have high success rate of long-distance amplification, high sensitivity, and cover introns, can analyze HLA all four domains of the gene, and are suitable for large-scale, high-throughput HLA typing detection.
[0010] Further, a HLA genotyping kit comprises the primer set of the above HLA gene.
[0011] Further, HLA The genotyping kit further comprises cell lysis solution, proteinase K, dNTPs, DNA polymerase, Tn5 transposase, and PCR buffer.
[0012] Further, a HLA genotyping detection method uses the primer set of the above HLA gene, or uses the above HLA genotyping kit to detect HLA genotyping.
[0013] Further, HLA The genotyping detection method comprises the following steps: (1) lysing and digesting cells using cell lysis solution and proteinase K; (2) extracting genomic DNA of the cells by isopropanol precipitation method; (3) using the genomic DNA extracted in step (2) as a template, using HLAThe primer sets of the gene were used for PCR amplification. (4) Combine the PCR products obtained in step (3) and then purify them; (5) Treat the DNA obtained in step (4) with Tn5 transposase; (6) Using the DNA processed in step (5) as a template, sequencing adapters are added by PCR; (7) Sequencing the PCR product obtained in step (6), and comparing the sequencing results with the HLA-IMGT database to obtain the sequence. HLA Fractal
[0014] Furthermore, the reaction temperature in step (1) is 55 °C and the reaction time is 12~16 h.
[0015] Furthermore, the single PCR amplification system in step (3) includes: 25-100 ng genomic DNA, dNTPs, high-fidelity DNA polymerase, PCR buffer, and HLA One of the primer sets for the gene; the PCR amplification conditions were: 95 ℃ for 5 min; 98 ℃ for 10 s, 60 ℃ for 15 s, 68 ℃ for 8 min, for a total of 30 cycles.
[0016] Furthermore, the PCR amplification system in step (6) includes: DNA treated in step (5), dNTPs, DNA polymerase with strand displacement function, PCR buffer and sequencing adapter primers; the PCR amplification conditions are: 72 ℃ for 5 min; 98 ℃ for 30 s; 98 ℃ for 15 s, 60 ℃ for 30 s, 72 ℃ for 3 min, for a total of 9 cycles; 72 ℃ for 5 min.
[0017] Furthermore, in step (6), Illumina Nextera sequencing adapter primers are used, and in step (7), sequencing is performed using a second-generation sequencer compatible with the Illumina Nextera library structure.
[0018] The beneficial effects of the present invention are: (1) HLA Amplicones can cover introns. HLA The genotyping resolution can reach all four domains; (2) 11 types were amplified using uniform PCR conditions. HLA Genes are easy to use; (3) Amplify each type of gene. HLA The required amount of template genomic DNA for the gene is low, only 25 ng, making it suitable for precious samples. HLA Genotyping. This invention solves, to some extent, the problem of next-generation sequencing detection. HLA The method addresses the problems of reduced typing success rate due to difficulties in long-distance amplification and increased experimental complexity due to inconsistent reaction conditions, and has broad application prospects and clinical reference value. BRIEF DESCRIPTION OF DRAWINGS
[0019] Figure 1 For HLA electrophoresis results of amplicons and libraries and HLA typing results. DETAILED DESCRIPTION
[0020] The specific embodiments of the present application will be described in detail below with reference to the accompanying drawings.
[0021] Example 1 HLA typing identification of PLC / PRF / 5 cell line 1. Collect 1 x 10 6 PLC / PRF / 5 cells into a 1.5 mL centrifuge tube, centrifuge to remove supernatant, add 100 μL of 1 x cell lysis solution, 100 μL of DNase-free H2O and 4 μL of proteinase K (20 mg / mL) and mix, incubate at 55 °C for 12 h at 1200 rpm; use isopropanol precipitation method to extract genomic DNA.
[0022] 2. Configure 9 independent PCR reaction systems (25 μL each), each containing: (1) Enzyme component: 0.5 U of high-fidelity DNA polymerase (Takara, R050A); (2) Substrate component: 0.2 mM dNTP mixture (containing 0.2 mM of dATP / dCTP / dGTP / dTTP each); (3) Buffer system: 1 x PCR buffer (Takara, R050A); (4) Target primer: 0.2 μM of primer pair specific for amplifying a single HLA gene (any one of HLA Gene: HLA-A / HLA- B / HLA-C / HLA-DPA1 / HLA-DPB1 / HLA-DQA1 / HLA-DQB1 / HLA-DRB1 / HLA-DRB3 , HLA-DRB4 , HLA- DRB5 ); (5) Template DNA: 25 ng of PLC / PRF / 5 cell line genomic DNA.
[0023] The primer sequences for specific amplification of HLA-A genes are as follows: HLA-AF: GTTTCCAGAGAAGCCAATCAGTGTC (SEQ ID NO.1); HLA-AR: CACCTCCTCACATTATGCCTACACG (SEQ ID NO. 2); For specific amplification HLA-B The primer sequences for the gene are: HLA-BF:TCCTTCTCCAGGATACTCGTGACG (SEQ ID NO.3); HLA-BR: ACCCACTCTAGACCCCAAGAATCTC (SEQ ID NO.4); For specific amplification HLA-C The primer sequences for the gene are: HLA-CF: GACTCAGGCACACAGTGTGACAAAG (SEQ ID NO.5); HLA-CR: CAGGTCTTTTATTTGCTCTCTCAACTTC (SEQ ID NO.6); For specific amplification HLA-DPA1 The primer sequences for the gene are: HLA-DPA1-F: CCCAGCAACAGAGAATGTCAGCTC (SEQ ID NO.7); HLA-DPA1-R: GCCCTACTACTTCATAGCTGTGGG (SEQ ID NO.8); For specific amplification HLA-DPB1 The primer sequences for the gene are: HLA-DPB1-F: CAACAGGAGCAAGTTGAGGAATTCTCAAG (SEQ ID NO.9); HLA-DPB1-R: TGGTGCTAAGAAGAAGGGAACATGG (SEQ ID NO. 10); For specific amplification HLA-DQA1 The primer sequences for the gene are: HLA-DQA1-F: CAGGGTTTGGTTTGGGTGTCTTCAG (SEQ ID NO. 11); HLA-DQA1-R: CATCATCATGCCACTTCCCAATTCC (SEQ ID NO. 12); For specific amplification HLA-DQB1 The primer sequences for the gene are: HLA-DQB1-F: CTTCAGCTCCAGTGCTGATTGGTTC (SEQ ID NO. 13); HLA-DQB1-R: GGTGGGGATGAAAGGAGATGACCTG (SEQ ID NO. 14); The primer sequence for specific amplification of the HLA-DQB1 gene is as follows: HLA-DRB1 The primer sequence for specific amplification of the HLA-DQB1 gene is as follows: HLA-DRB1-F: GTCAATGGCATTTAAGAGACTCATGGTGAG (SEQ ID NO. 15); HLA-DRB1-R: TGCTGAACCAGTAGCAACCAGGTCC (SEQ ID NO. 16); The primer sequence for specific amplification of the HLA-DRB1 gene is as follows: HLA-DRB3 , HLA-DRB4 , HLA-DRB5 The primer sequence for specific amplification of the HLA-DRB1 gene is as follows: HLA-DRB345-F: CCTCAGCCTCTCTGCTTTAGTGAACT (SEQ ID NO. 17); HLA-DRB345-R: GGGAAAGCTTTTCATCCTGCAAAGCT (SEQ ID NO. 18).
[0024] The above primers respectively amplify the 5' UTR to 3' UTR region of the HLA-DQB1 gene and HLA-A , HLA-B , HLA-C , HLA-DPA1 , HLA-DQA1 , HLA-DQB1 The 2nd exon to 3' UTR region of the HLA-DRB1 gene. HLA-DPB1 , HLA-DRB1 , HLA-DRB3 , HLA-DRB4 , HLA-DRB5 The 2nd exon to 3' UTR region of the HLA-DRB1 gene.
[0025] 3. Run the PCR program: 95 ℃ 5 min; 98 ℃ 10 s, 60 ℃ 15 s, 68 ℃ 8 min; for a total of 30 cycles.
[0026] The product was subjected to TAE electrophoresis to detect whether the amplification was successful, and the results are shown in Figure 1 A, the band size is consistent with the expected.
[0027] 4. Take 5 μL from each PCR system (total 45 μL). Add 22.5 μL VAHTS DNA Clean Beads (Vazyme, Cat. No. N411) to the mixture, and purify the DNA according to the requirements of the instructions. Use 20 μL DNase-free H2O to elute the DNA, and finally use Nanodrop to detect the DNA concentration.
[0028] 5. Prepare Tn5 dimer: anneal Read1 and Read2 with ME sequence CTGTCTCTTATACACATCT (SEQ ID NO. 19), wherein the sequences of Read1 and Read2 are respectively: Read1: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG (SEQ ID NO. 20); Read2: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO. 21), and the 5' end of the sequence Read2 is phosphorylated.
[0029] Prepare the following reaction system: 10 μL 100 μM Read1 + ME annealing product, 10 μL 100 μM Read2 + ME annealing product, 25 μL 10× TPS (Mei5bio, Cat. No. MF650-01), 25 μL M5 Tn5 transposase (Mei5bio, Cat. No. MF650-01), 100 μL glycerol, and 80 μL DNase-free H2O; incubate at room temperature for 30 min to obtain Tn5 dimer.
[0030] 6. Prepare 50 μL Tn5 enzyme digestion system: 10 mM Tris-HCl (pH 8.0), 5 mM MgCl2, 10% (v / v) DMF, 100 ng DNA (purified in step 4), and 1 μL Tn5 dimer (prepared in step 5), and use DNase-free H2O to make up the volume to 50 μL; incubate at 55 ℃ for 5 min, add 50 μL VAHTS DNA Clean Beads (Vazyme, Cat. No. N411), and purify the DNA according to the requirements of the instructions; use 30 μL DNase-free H2O to elute the DNA.
[0031] 7. Configure 50 μL index PCR reaction system: 30 μL DNA (obtained by purification in step 6), 10 μL 5x PCR buffer (Vazyme, TD601), 1 μL DNA polymerase with strand displacement function (Vazyme, TD601), 5 μL 10 μM Illumina Nextera i5 adapter primer, and 5 μL 10 μM Illumina Nextera i7 adapter primer; run the PCR program: 72 ℃ for 5 min; 98 ℃ for 30 s; 98 ℃ for 15 s, 60 ℃ for 30 s, 72 ℃ for 3 min, a total of 9 cycles; 72 ℃ for 5 min; add 32.5 μL VAHTS DNA Clean Beads (Vazyme, item number N411), and purify the DNA according to the requirements of the instructions; use 20 μL DNase-free H2O to elute the DNA.
[0032] Use TAE electrophoresis to detect the fragment length distribution of the sample, and the results are shown in Figure 1 B.
[0033] 8. Use DNBSEQ-T7 (Huada) sequencer to perform PE150 sequencing on the sample, and the sequencing amount is 2 GB.
[0034] 9. Use open source software T1k to analyze HLA subtypes. On a linux system, the usage instruction of the software is: run-t1k-1 R1.fq.gz -2 R2.fq.gz --preset hla-wgs -f hlaidx_dna_seq.fa -t 20 --skipPostAnalysis --noExtraction. Among them, R1.fq.gz and R2.fq.gz are fastq files generated by sequencing, and hlaidx_dna_seq.fa is the HLA DNA reference sequence built-in T1k software.
[0035] The result file with suffix allele.tsv generated after the software runs is the parsed HLA subtype, and the results are shown in Figure 1 C.
[0036] Although the specific embodiments of the present application are described in detail in combination with the embodiments, it should not be understood as limiting the protection scope of the patent. Various modifications and variations made by those skilled in the art within the scope described in the claims are still within the protection scope of the patent.
Claims
1. A kind HLA The primer set of the gene is characterized by, consist of the following 9 groups of primers, the sequence information of which is as follows: The nucleotide sequence of forward primer HLA-A-F is shown as SEQ ID No. 1 in the sequence listing; The nucleotide sequence of reverse primer HLA-A-R is shown as SEQ ID No. 2 in the sequence listing; The nucleotide sequence of forward primer HLA-B-F is shown as SEQ ID No. 3 in the sequence listing; The nucleotide sequence of reverse primer HLA-B-R is shown as SEQ ID No. 4 in the sequence listing; The nucleotide sequence of forward primer HLA-C-F is shown as SEQ ID No. 5 in the sequence listing; The nucleotide sequence of reverse primer HLA-C-R is shown as SEQ ID No. 6 in the sequence listing; The nucleotide sequence of forward primer HLA-DPA1-F is shown as SEQ ID No. 7 in the sequence listing; The nucleotide sequence of reverse primer HLA-DPA1-R is shown as SEQ ID No. 8 in the sequence listing; The nucleotide sequence of forward primer HLA-DPB1-F is shown as SEQ ID No. 9 in the sequence listing; The nucleotide sequence of reverse primer HLA-DPB1-R is shown as SEQ ID No. 10 in the sequence listing; The nucleotide sequence of forward primer HLA-DQA1-F is shown as SEQ ID No. 11 in the sequence listing; The nucleotide sequence of reverse primer HLA-DQA1-R is shown as SEQ ID No. 12 in the sequence listing; The nucleotide sequence of forward primer HLA-DQB1-F is shown as SEQ ID No. 13 in the sequence listing; The nucleotide sequence of reverse primer HLA-DQB1-R is shown as SEQ ID No. 14 in the sequence listing; The nucleotide sequence of forward primer HLA-DRB1-F is shown as SEQ ID No. 15 in the sequence listing; The nucleotide sequence of reverse primer HLA-DRB1-R is shown as SEQ ID No. 16 in the sequence listing; The nucleotide sequence of forward primer HLA-DRB345-F is shown as SEQ ID No. 17 in the sequence listing; The nucleotide sequence of reverse primer HLA-DRB345-R is shown as SEQ ID No. 18 in the sequence listing; Alternatively, the 9 groups of primers respectively have a nucleotide sequence with at least 80% sequence identity to the sequences shown as SEQ ID No. 1 to SEQ ID No. 18, and the nucleotide sequence can specifically amplify the target sequence corresponding to the primers SEQ ID No. 1 to SEQ ID No. 18 in the PCR reaction.
2. The method of claim 1, HLA a primer set for a gene, characterized in that: The primers HLA-A-F and HLA-A-R, HLA-B-F and HLA-B-R, HLA-C-F and HLA-C-R, HLA-DPA1-F and HLA-DPA1-R, HLA-DQA1-F and HLA-DQA1-R, HLA-DQB1-F and HLA-DQB1-R, respectively amplify HLA-A , HLA-B , HLA-C , HLA-DPA1 , HLA-DQA1 , HLA-DQB1 the 5' UTR to 3' UTR region of the gene, the primers HLA-DPB1-F and HLA-DPB1-R, HLA-DRB1-F and HLA-DRB1-R, respectively amplify HLA-DPB1 , HLA-DRB1 the 2nd exon to 3' UTR region of the gene, and the primers HLA-DRB345-F and HLA-DRB345-R amplify HLA-DRB3 , HLA-DRB4 and HLA-DRB5 the 2nd exon to 3' UTR region of the gene.
3. A method according to claim 1 or 2, wherein the method comprises the step of: - determining the presence or absence of a genetic marker in the sample. HLA A genotyping test kit characterized in that: comprising the method of claim 1 or 2 HLA a primer set for a gene.
4. The method according to claim 3 HLA Genotyping detection kit, characterized in that: Also included are cell lysis solution, proteinase K, dNTPs, DNA polymerase, Tn5 transposase and PCR buffer.
5. A kind HLA The genotyping detection method is characterized by: The method according to claim 1 or 2, HLA a primer set for the gene, or HLA a genotyping detection kit according to claim 3 or 4, HLA detects the genotyping.
6. The method of any one of claim 5 HLA A method of detecting genotyping, characterized by, The method comprises the following steps: (1) lysing and digesting cells by using cell lysis solution and protease K; (2) extracting genomic DNA of cells by using isopropanol precipitation method; (3) Using the genomic DNA extracted in step (2) as a template, PCR amplification is performed using the primer sets of the genes, respectively. HLA genes, respectively. (4) combining the PCR products obtained in step (3) and purifying again; (5) treating the DNA obtained in step (4) with Tn5 transposase; (6) adding sequencing adapters to the DNA treated in step (5) by PCR as a template; (7) The PCR product obtained in step (6) is sequenced, and the sequencing result is compared with the HLA-IMGT database for sequence alignment to obtain the HLA-A, HLA-B, and HLA-DRB1 genotypes. HLA typing.
7. The method of claim 6, HLA A method of detecting genotyping, characterized by: The reaction temperature of step (1) is 55 ℃, and the reaction time is 12-16 h.
8. The method of claim 6, HLA A method of detecting genotyping, characterized by: The single PCR amplification system in the step (3) comprises: 25-100 ng genomic DNA, dNTPs, high-fidelity DNA polymerase, PCR buffer and HLA 1 group of primers of the gene; and the PCR amplification conditions are: 95 ℃ for 5 min; 98 ℃ for 10 s, 60 ℃ for 15 s, 68 ℃ for 8 min, for a total of 30 cycles.
9. The method of claim 6, HLA A method for detecting genotyping, characterized by, The PCR amplification system of step (6) comprises the DNA treated in step (5), dNTPs, DNA polymerase with strand displacement function, PCR buffer and sequencing adapter primers; the PCR amplification conditions are as follows: 72 ℃ for 5 min; 98 ℃ for 30 s; 98 ℃ for 15 s, 60 ℃ for 30 s, 72 ℃ for 3 min, a total of 9 cycles; 72 ℃ for 5 min.
10. The method of claim 9, HLA A method of detecting genotyping, characterized by: In step (6), the sequencing adapter primers are Illumina Nextera sequencing adapter primers, and in step (7), a second-generation sequencer compatible with the library structure of Illumina Nextera is used for sequencing.