An epegRNA primer pair for detecting an indel marker associated with porcine epidemic diarrhea virus resistance and application thereof

By inserting/deleting mutations at specific locations in the pig genome, and utilizing epigRNA primer pairs and the PE editing system, the problem of unstable protective efficacy of existing vaccines has been solved, enabling efficient screening and breeding of resistant pigs and reducing the risk of PEDV infection.

CN121204231BActive Publication Date: 2026-06-19YANGZHOU UNIV

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
YANGZHOU UNIV
Filing Date
2025-10-31
Publication Date
2026-06-19

AI Technical Summary

Technical Problem

Existing vaccines offer unstable protection against porcine epidemic diarrhea virus (PEDV), and maternal antibodies provide short-term protection, increasing the difficulty of prevention and control. It is necessary to screen and identify PEDV resistance functional genes and obtain resistance molecular genetic markers to improve the resistance of pigs.

Method used

Using lead editing (PE) technology, gene insertion/deletion (Indel) mutations were achieved at specific locations in the pig genome through epigRNA primer pairs. Indel markers associated with resistance to porcine diarrhea virus were detected using epigRNA primer pairs. Efficient base editing was then performed in pig cells using the PE editing system to screen for highly resistant pig individuals.

Benefits of technology

It enables efficient and precise gene editing, significantly improves pig resistance to PEDV, provides a means for early prediction and molecular marker-assisted breeding, and reduces the risk of PEDV infection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121204231B_ABST
    Figure CN121204231B_ABST
Patent Text Reader

Abstract

This invention discloses an epigRNA primer pair for detecting Indel markers associated with porcine epidemic diarrhea virus (PEDV) resistance and its application. The epigRNA sequence provided by this invention can achieve precise AACA insertion mutations in the sequence at ChrX:56448702 in the porcine genome through leader editing; the A / AAACA mutation can be used as a molecular marker for breeding resistant to PEDV.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to an epigRNA primer pair for detecting Indel-labeled antibodies associated with porcine diarrhea virus resistance and its application, belonging to the field of animal genetics, breeding, and genetic engineering technology. Background Technology

[0002] Porcine epidemic diarrhea (PED) is a highly contagious intestinal disease caused by porcine epidemic diarrhea virus (PEDV), characterized by vomiting, diarrhea, and dehydration in piglets. PEDV is one of the main pathogens causing viral diarrhea in pigs, posing a significant threat to newborn piglets, with mortality rates reaching 100% in infected suckling piglets, seriously threatening the high-quality and healthy development of my country's pig industry. In recent years, due to the rapid mutation rate of PEDV, the unstable protective effect of existing vaccines, and the short-term protection period of maternal antibodies for newborn piglets, the difficulty and cost of PEDV prevention and control have increased. Therefore, screening and identifying PEDV resistance functional genes and obtaining resistance molecular genetic markers, and then implementing disease-resistant breeding to improve pigs' resistance to PEDV from a genetic perspective, is of great significance for the prevention and control of PEDV.

[0003] Insertion-deletion (Indel) is a type of variation in the genome, referring to a small insertion or deletion mutation at a specific location in the genomic DNA, resulting in differences in the DNA sequence length at that site among different individuals (or strains). As a common DNA length polymorphism, Indel has become an important molecular marker in pig disease resistance breeding due to its ease of detection, low cost, and good stability.

[0004] Prime editing (PE) is a gene editing method based on search and replacement that does not produce DNA double-strand breaks and does not require a template strand. It can achieve the insertion and deletion of bases in the target sequence and the free conversion of 12 types of bases. The PE system consists of three core components: a PE protein composed of a modified Cas9 nickase and reverse transcriptase, pegRNA (or optimized epigRNA), and nicking sgRNA (ngRNA, optional). The PE2 system consists of PE protein and epigRNA, while the more efficient PE3 / PE3b system uses ngRNA. Currently, molecular breeding has become a novel approach for livestock breeding, and PE editing is an important technical tool for identifying functional genetic variations. By screening and identifying resistance-related genetic variation sites through novel biotechnologies such as PE editing, the process of breeding swine viral diarrhea resistance can be accelerated, promoting the rapid development of modern animal husbandry. Summary of the Invention

[0005] Purpose of the invention: The purpose of this invention is to provide an epeRNA primer pair for detecting Indel markers associated with porcine diarrhea virus resistance and its application.

[0006] Technical solution: The present invention provides an epeRNA primer pair for detecting Indel markers associated with porcine diarrhea virus resistance, the nucleotide sequence of which is shown in SEQ ID NO.9-10; the Indel marker associated with porcine diarrhea virus resistance is located at ChrX: 56448702 on the porcine genome with accession number NC_010461.5, and its base is A or AAACA.

[0007] Among them, individuals with the genotype AAACA containing the polymorphic site of the Indel marker showed significantly higher resistance to porcine diarrhea virus than those with the A genotype.

[0008] The present invention also provides a detection reagent or kit containing the said epigRNA primer pair.

[0009] The kit also includes template DNA and Taq Plus Master Mix II.

[0010] This invention also provides a gene editing method for inserting an Indel marker associated with porcine diarrhea virus resistance, comprising the following steps:

[0011] (1) Anneal the epegRNA primers targeting the genetic mutation site to form dsDNA;

[0012] (2) The dsDNA was ligated with the linearized pU6-tevopreq1-GG-acceptor vector, the ligation product was transformed into competent cells, cultured, extracted, and the epigRNA3 expression plasmid was obtained.

[0013] (3) The epigRNA3 expression plasmid and the leader editor pCMV-PEmax-P2A-BSD were co-transfected into porcine small intestinal epithelial cells; the base editing was performed using the PE2 editing system, and the mass ratio of the epigRNA plasmid to pCMV-PEmax-P2A-BSD in the PE2 system was 1:3.

[0014] (4) Use blast fungicide for drug screening, select positive clone cells to obtain cells with Indel markers inserted for resistance to swine diarrhea virus; the Indel markers for resistance to swine diarrhea virus are located at ChrX: 56448702 on the swine genome and have the base AAACA.

[0015] The annealing reaction system described in step (1) contains an annealing buffer and enzyme-free water.

[0016] The annealing process in step (1) is 95 °C for 2 min, decreasing by 0.1 °C every 8 s until it reaches 25 °C.

[0017] In step (2), the linearized pU6-tevopreq1-GG-acceptor vector is obtained by digestion with restriction endonuclease Bsal-HFv2.

[0018] The present invention also provides the use of the epigRNA primer pair or the detection reagent or kit in identifying or breeding pigs with high resistance to porcine diarrhea virus.

[0019] The present invention also provides the application of the epigRNA primer pair or the detection reagent or kit in the early prediction of porcine epidemic diarrhea virus resistance.

[0020] The present invention also provides the application of the epigRNA primer pair or the detection reagent or kit in marker-assisted breeding associated with resistance to porcine epidemic diarrhea virus.

[0021] This invention also provides a method for identifying or breeding pigs with high resistance to porcine diarrhea virus, comprising the following steps:

[0022] (1) Extract genomic DNA from the pigs to be tested;

[0023] (2) Using the genomic DNA of the pig to be tested as a template, PCR amplification was performed using the primer pair shown in SEQ ID NO.1-2;

[0024] (3) Analyze the PCR amplification products; when the genotype at the 152 bp of the PCR amplification product is AAACA, the pig to be tested is a pig with high resistance to swine diarrhea virus; when the genotype at the 152 bp of the PCR amplification product is A, the pig to be tested is a pig with low resistance to swine diarrhea virus.

[0025] The PCR amplification reaction system in step (2) includes template DNA, the primer pair or Taq Plus Master Mix II.

[0026] The PCR amplification reaction procedure in step (2) is as follows: 95 °C pre-denaturation for 5 min; 95 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 30 s, for a total of 35 cycles; 72 °C extension for 5 min.

[0027] Step (3) includes detecting the genotype at 152 bp of the PCR amplification product. Individuals with the genotype AAACA are significantly more resistant to porcine diarrhea virus than those with the genotype A.

[0028] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: (1) The provided epigRNA sequence can be efficiently and accurately inserted into the sequence at ChrX: 56448702 in the pig genome by using a leader editor; (2) A / AAACA mutation can be used as a molecular marker for breeding of pig epidemic diarrhea. Attached Figure Description

[0029] Figure 1 This is the PCR agarose gel image in this embodiment; where 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 represent 10 test samples; M is the DNA Marker I pattern;

[0030] Figure 2 This is a genotyping diagram of the Meishan pig sample in this embodiment, where Figure A is the sequencing peak diagram of the wild type; Figure B is the sequencing peak diagram of the mutant type.

[0031] Figure 3 This example shows the efficiency detection of mixed pool editing of porcine small intestinal epithelial cells after base insertion editing. Figures A, B, C, D, E, and F correspond to the efficiency detection of PE2-epegRNA1, PE2-epegRNA2, PE2-epegRNA3, PE3-epegRNA1, PE3-epegRNA2, and PE3-epegRNA3 editing, respectively.

[0032] Figure 4 These are the sequencing peak diagrams of cells after base insertion editing in this embodiment, where Figure A is the sequencing peak diagram of wild type; Figure B is the sequencing peak diagram of mutant type.

[0033] Figure 5 The figure shows the effect of base insertion editing on PEDV infection before and after in this embodiment, where A is the mRNA expression level of PEDV-M and B is the protein level of PEDV-N.

[0034] Figure 6 This example illustrates the effect of base insertion mutations on PEDV titers. Detailed Implementation

[0035] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0036] Example 1

[0037] 1. Ear tissue samples were collected from 300 Meishan pigs, and DNA extraction was performed using the FastPure DNA extraction kit. ®The Cell / Tissue DNAIsolation Mini Kit (Nanjing Novizan Biotechnology Co., Ltd., DC102-01) was used to extract genomic DNA from ear tissue and detect its concentration. The DNA sample was stored at -20℃ for later use.

[0038] 2. Primers were designed based on the pig genome sequence (accession number NC_010461.5) from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ), including the forward primer: SEQ ID NO.1: 5'-AGCCCCTGGATACAATGGGA-3' and the reverse primer: SEQ ID NO.2: 5'-CACAGCAGGAGAGGGATAGC-3'. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The 20 μl PCR reaction system included: 1 μL template DNA (100 ng / μL), 1 μL each of primers F and R (10 μM), 10 μL 2 × Taq Plus Master Mix II, and 7 μL ddH2O. The PCR reaction conditions were: 95℃ for 5 min; 95℃ for 30 s, 60℃ for 30 s, 72℃ for 30 s, 35 cycles; 72℃ for 5 min. The PCR amplification products are shown below. Figure 1 As shown, the PCR amplification product size is 296 bp. Sanger sequencing revealed a genetic variation at 152 bp in the PCR amplification fragment, a 4 bp insertion of AACA, located at ChrX: 56448702 in the pig genome. The genotyping results for the two genotypes are shown below. Figure 2As shown, the wild type has no base insertion, and its sequence is as shown in SEQ ID NO.3: AGCCCCTGGATACAATGGGAAGGCAGAGAAGGAGGGGGGCCAGCTCTTGGCATAAGAGAGCCAGTCTTCCTTCTTGCTGTTCCAAATCCAGTGCGTTTGGGGGAGGGGTAGCCGAGCTTATCCCTAGAGAAGGCATCCTTTCCCACCAACACTTCGCTAGACTCCAGGCTTCATCAGGCAAAAGGTAGAGAGAGAAGATCAGTCAAGCCAGCCCCCAGTCCCTGGCCCACCCAGAGCCCTGTGCTCTAGTGCTAAGCCGACTCTACAATGTGCTGGCTATCCCTCTCCTGCTGTG. This genotype is denoted as WT. The mutant type has an AACA base insertion, and its sequence is as shown in SEQ ID NO. Shown in NO.4: AGCCCCTGGATACAATGGGAAGGCAGAGAAGGAGGGGGGCCAGCTCTTGGCATAAGAGAGCCAGTCTTCCTTCTTGCTGTTCCAAATCCAGTGCGTTTGGGGGGAGGGGTAGCCGAGCTTATCCCTAGAGAAGGCATCCTTTCCCACCAACA AACACTTCGCTAGACTCCAGGCTTCATCAGGCAAAAGGTAGAGAGAGAAGATCAGTCAAGCCAGCCCCCAGTCCCTGGCCCACCCAGAGCCCTGTGCTCTAGTGCTAAGCCGACTCTACAATGTGCTGGCTATCCCTCTCCTGCTGTG, this genotype is recorded as MUT.

[0039] 3. Three pairs of epigRNA primers (SEQ ID NO. 5~10) were designed on the website http: / / pegfinder.sidichenlab.org / . The epigRNAs included sgRNA targeting the genetic variant site, a backbone, and a 3' extension containing the primer binding sequence and reverse transcription template. Three pairs of ngRNAs (SEQ ID NO. 11~16) for use in the PE3 editing system were also designed. Annealing reaction system: 10 μL each of primers F and R at a concentration of 50 μM, 10 μL of annealing buffer, and 20 μL of enzyme-free water. Reaction program: 95 ℃ for 2 min, decreasing by 0.1 ℃ every 8 s (700 times) to 25 ℃, resulting in dsDNA after annealing. Specific primer sequences are shown in Tables 1 and 2.

[0040] Table 1 Primer Information

[0041]

[0042] Table 2 Primer Information

[0043]

[0044] 4. The pU6-tevopreq1-GG-acceptor vector (Wuhan Miaoling Biotechnology Co., Ltd., P41657) was linearized using the Type IIS restriction endonuclease BsaI-HFv2. The digestion system was as follows: 5 μg vector, 1 μL BsaI-HFv2 enzyme, 1 μL Ncol-HF enzyme, 1 μL Pvull-HF enzyme, 4 μL rCutSmar Buffer, and enzyme-free water to a final volume of 40 μL. Digestion was performed at 37℃ for 3 h, followed by 1% agarose gel electrophoresis for 20 min. The 2.2 kb linearized vector was purified and recovered using a gel extraction kit (Omega Bio-tek, D2500-01). The obtained dsDNA was ligated to the linearized vector using T4 DNA ligase. The ligation product was transformed into DH5α competent cells, plated on LB medium containing 100 ng / ml ampicillin, and cultured at 37°C for 14 h. Positive clones were then picked and cultured in a larger volume to extract plasmids. Sanger sequencing was performed using universal primer U6 (Sangon Biotech (Shanghai) Co., Ltd.), and expression plasmids of epigRNA1, epigRNA2, epigRNA3, ngRNA1, ngRNA2, and ngRNA3 were successfully obtained.

[0045] 5. The plasmid obtained above was coupled with the leader editor pCMV-PEmax-P2A-BSD (Wuhan Miaoling Biotechnology Co., Ltd., P37189) via Lipofectamine. TM 3000 (ThermoFisher, L3000015) plasmids were co-transfected into porcine small intestinal epithelial cells. The total amount of plasmids used in 6-well plates was 2 μg. In the PE2 system, the mass ratio of plasmid epigRNA to pCMV-PEmax-P2A-BSD was 1:3, and in the PE3 editing system, the mass ratio of plasmid ngRNA, epigRNA, and pCMV-PEmax-P2A-BSD was 1:3:9. The medium was changed 6 h after transfection, and the cells were cultured in complete medium for 24 h before drug screening.

[0046] 6. The screening concentration of blast fungicide was 10 μg / mL. Cell DNA was extracted 6 days after screening. PCR amplification was performed using the primers and conditions from step 2, and the recovered products were subjected to next-generation sequencing (Illumina-PE250). Mutation efficiency was analyzed using CRISPResso2 software, and the results are as follows: Figure 3 The results showed that the editing efficiency of PE2-epegRNA1 was 4.78%, PE2-epegRNA2 was 24.66%, PE2-epegRNA3 was 27.46%, PE3-epegRNA1 was 9.56%, PE3-epegRNA2 was 18.87%, and PE3-epegRNA3 was 21.18%. This demonstrates that using PE2-epegRNA3 for PE editing yields higher editing efficiency.

[0047] 7. Using the limiting dilution method, positive monoclonal cells edited with PE2-epegRNA3 were selected, cultured further, and cellular DNA was extracted. PCR amplification was performed using the primers and conditions from step 2, and the cells were sent for Sanger sequencing to determine the genotype. The results are as follows: Figure 4 As shown, an AACA base insertion occurs at 152 bp in the PCR amplification product, corresponding to 127 bp in the sequencing peak diagram.

[0048] Example 2

[0049] 1. Untreated porcine small intestinal epithelial cells and positive monoclonal cells selected after PE2-epegRNA3 editing were both mixed at a ratio of 1×10⁻⁶. 5 Cells were seeded at a density of 1 / mL in six-well cell culture plates. Each well was then inoculated with 2 mL of DMEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin solution (Beijing Solarbio Science & Technology Co., Ltd., P1400). When cell confluence reached 80%, the original medium was removed, and 2 mL of serum-free DMEM medium containing 2 μg / mL trypsin was added. PEDV was then added at a multiplicity of infection (MOI) of 1, and the cells were cultured at 37 °C with 5% CO2 for 24 h. The viral supernatant was collected. RNA and proteins were extracted from the cells using TRIzol and cell lysis buffer, respectively.

[0050] 2. RNA was extracted from cells using the TRIzol method and reverse transcribed into cDNA using a reverse transcription kit (Novizan, R323-01). The effect of mutations at this genetic variation site on PEDV infection was detected by RT-qPCR. The PEDV-M primers used were as follows: upstream primer: SEQ ID NO.17: 5'-AGGTCTGCATTCCAGTGCTT-3', downstream primer: SEQ ID NO.18: 5'-GGACATAGAAAGCCCAACCA-3'. The RT-qPCR reaction system was: 5 μL of 2×AceQ qPCR SYBR Green Master Mix, 0.2 μL each of upstream and downstream primers, 1 μL of cDNA, and enzyme-free water to a final volume of 10 μL. The amplification program was: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 10 s, 60℃ annealing for 30 s, for 40 cycles. The results are as follows. Figure 5 As shown in Figure A, the genomic copy number of PEDV is significantly reduced after the A / AAACA mutation. WT represents pre-mutation cells, and MUT represents post-mutation cells.

[0051] 3. Protein concentration was determined using the BCA method. Based on the protein concentration, 5× non-denaturing protein loading buffer was added, and the mixture was heated at 98 °C for 10 min. A standard loading volume of 10 μg of protein was used for polyacrylamide gel electrophoresis. The protein bands were transferred to a 0.22 μm polyvinylidene fluoride membrane under the following conditions: 300 mA, 50 min. After blocking with 5% skim milk powder, the membrane was incubated overnight at 4 °C with primary antibody (PEDV-N, Shanghai Youlong Biotechnology Co., Ltd.; GAPDH, Wuhan Sanying Biotechnology Co., Ltd., 60004-1-Ig). The membrane was washed three times with 1×TBST on a decolorizing shaker for 10 min each time. The corresponding mouse secondary antibody (Beijing Kangwei Century Biotechnology Co., Ltd., CW0102S) was incubated at room temperature for 1 h, followed by three washes with 1×TBST on a decolorizing shaker for 10 min each time. Chemiluminescence was then performed using horseradish peroxidase catalyzing the chemiluminescent material. The results are as follows: Figure 5 As shown in Figure B, the protein expression level of PEDV was significantly reduced after the A / AAACA mutation. GAPDH was used as an internal control to indicate consistent sample loading concentration; WT represents pre-mutation cells, and MUT represents post-mutation cells.

[0052] 4. Through TCID 50 To investigate the effect of mutations at this genetic variant site on PEDV titers, 96-well monolayers of Vero cells were prepared, with 100 μL per well and a plating density not exceeding 2 × 10⁻⁶. 5Virus solution was thawed at room temperature. Seven 1.5 ml centrifuge tubes were prepared for each viral sample and placed in a centrifuge rack. 900 μL of virus maintenance solution was added to each centrifuge tube. The thawed viral solution was vortexed to mix. 100 μL of the mixture was pipetted into the first centrifuge tube and mixed. The mixture was then diluted to 10⁻⁶ each time. -7 Remove the 96-well plate, aspirate the culture medium, wash with PBS, and add 100 μL of virus solution (set to 10). -2 10 -3 10 -4 10 -5 10 -6 10 -7 Six gradients (six replicates per gradient) were used, and the cells were re-insulated into the incubator. Pathological changes in each well were observed and recorded daily, and calculations were performed using the Reed-Muench method. Results are as follows: Figure 6 As shown, the A / AAACA mutation significantly reduced the PEDV titer.

Claims

1. A method for identifying or selecting pigs having high resistance to porcine epidemic diarrhea virus, characterized by, Includes the following steps: (1) Extract genomic DNA from the pigs to be tested; (2) Using the genomic DNA of the pig to be tested as a template, PCR amplification was performed using the primer pair shown in SEQ ID NO.1-2; (3) Analyze the PCR amplification product; when the base at the 152 bp of the PCR amplification product is AAACA, the pig to be tested is a pig with high resistance to porcine epidemic diarrhea virus; when the base at the 152 bp of the PCR amplification product is A, the pig to be tested is a pig with low resistance to porcine epidemic diarrhea virus; the pig is a Meishan pig.

2. The application of reagents or kits for detecting resistance-related Indel molecular markers in the identification or selection of pigs with high resistance to porcine epidemic diarrhea virus, characterized in that, The nucleotide sequence of the Indel molecular marker is shown in SEQ ID NO.

3. The base at the 152nd bp of SEQ ID NO.3 is AAACA or A. When the base at the 152nd bp of SEQ ID NO.3 is AAACA, the tested pigs exhibit high resistance to porcine epidemic diarrhea virus. The pigs are Meishan pigs.

3. The application of reagents or kits for detecting resistance-related Indel molecular markers in the early prediction of porcine epidemic diarrhea virus resistance, characterized in that, The nucleotide sequence of the Indel molecular marker is shown in SEQ ID NO.

3. The base at the 152nd bp of SEQ ID NO.3 is AAACA or A. When the base at the 152nd bp of SEQ ID NO.3 is AAACA, the tested pigs exhibit high resistance to porcine epidemic diarrhea virus. The pigs are Meishan pigs.