A SNP site related to yak hair traits and application

Abstract

The present application relates to the technical field of molecular marker, in particular to a SNP site related to yak hair traits and application. The present application provides a SNP molecular marker related to yak hair traits, wherein the SNP molecular marker is located at position 25388433 of chromosome 6 of yak reference genome Bosgu_v3.0 version with EuroPean Nucleotide Archive registration number GCA_005887515.1, and the mutation base is G or A. The present application can quickly identify the corresponding traits by PCR and gene sequencing method, can be used for yak molecular marker assisted breeding, and is not limited by yak breed and age. Therefore, in production, the individual with genotype GA or AA at the site can be preferentially selected as the parent for scale breeding, which greatly accelerates the accuracy and effectiveness of the selection of yak hair traits, and improves the economic benefit of yak breeding.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of molecular markers, and particularly relates to a SNP site related to yak hair traits and application. BACKGROUND

[0002] Yak is mainly concentrated in the Qinghai-Tibet Plateau and surrounding alpine regions, and is the only cattle breed that can utilize pasture resources to generate economic benefits in alpine regions, providing most of the production and living materials for local herdsmen. Tianzhu yak belongs to a meat and hair dual-purpose type, and produces meat and milk while its down has high application value. Tianzhu white yak has excellent hair production performance, and its hair fiber structure is compact and diverse, has good warmth retention performance, and can also be used as a textile and dyeing raw material. Therefore, it is of great significance to carry out genetic resource protection and development and utilization of Tianzhu white yak, to improve the hair production performance of Tianzhu white yak, and to promote the development of Tianzhu white yak industry.

[0003] Single nucleotide polymorphism (SNP) is known as the third generation of DNA genetic markers, mainly refers to the polymorphism caused by the replacement of a single nucleotide in the genomic sequence, and has the advantages of high distribution density, stable heredity and automatic analysis. The replacement refers to the mutual replacement between purine bases (A / G) and pyrimidine bases (T / C). The SNP appearing in the coding region will affect the function of the gene and cause changes in biological traits, and therefore can be used as a biological marker related to certain traits. SNP analysis is widely used in livestock research, and can be used as a potential molecular marker to assist the breeding work of livestock, thereby improving the production performance and reproductive performance of livestock.

[0004] FGF5 Fibroblast growth factor 5 (FGF5) is a key negative factor for regulating the hair growth cycle of mammals. In the initial stage of hair follicle regression, the gene starts to express, and it transmits the “stop growing” signal by encoding fibroblast growth factor 5, promotes the transition of hair follicle from the growth phase to the regression phase, and further promotes the hair to stop growing and fall off. This physiological mechanism plays a decisive role in the length of the hair, and therefore, in many mammals (such as cats, dogs, mice, sheep, etc.), loss-of-function mutations of the gene have been confirmed to be key factors leading to the appearance of long hair phenotype. At present, the research on the gene of yak has been applied to the field of molecular breeding. By screening individuals with excellent genotypes, it can assist in breeding yak breeds with higher hair yield and better hair quality, thereby improving the economic benefits of yak breeding. FGF5 FGF5 FGF5 FGF5 SUMMARY ​​​​

[0005] The application aims to provide a SNP site related to yak hair traits and an application.

[0006] The application provides a SNP molecular marker related to yak hair traits, wherein the SNP molecular marker is located at position 25388433 of chromosome 6 of a yak reference genome Bosgu_v3.0 version with a EuroPean Nucleotide Archive registration number of GCA_005887515.1, and the mutation base is G or A.

[0007] Preferably, the nucleotide sequence containing the molecular marker is shown as SEQ ID NO. 1, and the SNP molecular marker is located at position 201.

[0008] Preferably, according to the mutation base type of the molecular marker, the yak individual genotype is divided into GG, GA and AA; the body side hair length, head hair length and hair yield of the yak individual with the genotype AA are significantly higher than those of the individuals with the genotypes GA and GG; the back hair length of the yak individuals with the genotypes AA and GA is significantly higher than that of the individual with the genotype GG; and the head hair length and hair yield of the yak individual with the genotype GA are significantly higher than those of the individual with the genotype GG.

[0009] Preferably, the yak is Tianzhu white yak.

[0010] The application provides an application of a reagent for detecting the molecular marker in detection of yak hair traits or early selection of yak hair traits.

[0011] Preferably, the yak individual is screened by detecting the molecular marker.

[0012] Preferably, the reagent comprises a primer pair for amplifying the molecular marker.

[0013] Preferably, the nucleotide sequences of the primer pair are shown as SEQ ID NO. 2-3.

[0014] The application provides a method for detecting yak hair traits, comprising the following steps:

[0015] (1) extracting yak genomic DNA as template DNA;

[0016] (2) performing PCR amplification on the template DNA obtained in step (1) by using the primer pair shown as SEQ ID NO. 2-3 to obtain a PCR amplification product;

[0017] (3) purifying the PCR amplification product obtained in step (2), and performing genotyping detection, so that the individual genotype of the yak is divided into GG, GA and AA; the body side hair length, head hair length and wool yield of the yak individual with the genotype AA are significantly higher than those of the individuals with the genotypes GA and GG; the back hair length of the yak individuals with the genotypes AA and GA is significantly higher than that of the individual with the genotype GG; the head hair length and wool yield of the yak individual with the genotype GA are significantly higher than those of the individual with the genotype GG.

[0018] The application provides a method for early selection of yak hair traits, which comprises the following steps:

[0019] (1) extracting yak genomic DNA as template DNA;

[0020] (2) performing PCR amplification on the template DNA obtained in step (1) by using primers shown in SEQ ID NO. 2-3, so as to obtain a PCR amplification product;

[0021] (3) purifying the PCR amplification product obtained in step (2), and performing genotyping detection, so that the individual genotype of the yak is divided into GG or AG when the SNP molecular marker base is G; the individual genotype of the yak is divided into AA when the SNP molecular marker base is A; the body side hair length, head hair length and wool yield of the yak individual with the genotype AA are significantly higher than those of the individuals with the genotypes GA and GG; the back hair length of the yak individuals with the genotypes AA and GA is significantly higher than that of the individual with the genotype GG; the head hair length and wool yield of the yak individual with the genotype GA are significantly higher than those of the individual with the genotype GG; and the yak individual with the genotype GA or AA is selected for early selection of hair traits.

[0022] Compared with the prior art, the application has the following beneficial effects:

[0023] The application finds the SNP site related to the yak hair traits by analyzing the correlation between the site genotype and the yak hair traits, the SNP molecular marker is located at the position 25388433 of the chromosome 6 of the yak reference genome Bosgu_v3.0 version EuroPean Nucleotide Archive registration number GCA_005887515.1, and the mutation base is G or A; according to the genotyping detection, the individual genotype of the yak is divided into GG, GA and AA, the body side hair length, head hair length and wool yield of the yak individual with the genotype AA are significantly higher than those of the individuals with the genotypes GA and GG (P<0.05); the back hair length of the yak individuals with the genotypes AA and GA is significantly higher than that of the individual with the genotype GG (P<0.05); and the head hair length and wool yield of the yak individual with the genotype GA are significantly higher than those of the individual with the genotype GG (P<0.05).

[0024] The application can quickly identify corresponding traits by PCR and gene sequencing method, can be used for yak molecular marker assisted breeding, and is not limited by yak breeds and ages, therefore, in production, the individual with the genotype of GA or AA at the site can be preferentially selected as the parent for scale breeding, the accuracy and effectiveness of the selection of yak hair traits are greatly improved, and the economic benefits of yak breeding are improved. BRIEF DESCRIPTION OF DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the following will briefly introduce the drawings needed to be used in the embodiments or the prior art description. Obviously, the drawings in the following description are only embodiments of the present application, and for those skilled in the art, other drawings can also be obtained without creative labor on the basis of the provided drawings.

[0026] Figure 1 Sequencing peak charts of three genotypes in the embodiments of the present application. DETAILED DESCRIPTION

[0027] The present application can be used for yak molecular marker assisted breeding, and is not limited by yak breeds and ages, therefore, in production, the individual with the genotype of GA or AA at the site can be preferentially selected as the parent for scale breeding, the accuracy and effectiveness of the selection of yak hair traits are greatly improved, and the economic benefits of yak breeding are improved. FGF5 The present application can be used for yak molecular marker assisted breeding, and is not limited by yak breeds and ages, therefore, in production, the individual with the genotype of GA or AA at the site can be preferentially selected as the parent for scale breeding, the accuracy and effectiveness of the selection of yak hair traits are greatly improved, and the economic benefits of yak breeding are improved. The genotype analysis of the target fragment amplified by one pair of primers (SEQ ID NO. 2 and SEQ ID NO. 3) found a SNP site with three genotypes, and through the analysis of MEGA 11.0 and BioEdit software, a SNP site was screened out at the 201st base of the fragment of the sequence SEQ ID NO. 1. Then, the SPSS 25.0 software was used to analyze the correlation between the genotype of the mutation site of the yak individual and the hair traits, and it was found that the body side hair length, head hair length and hair yield of the yak individual with the genotype AA were significantly higher than those of the individuals with the genotypes GA and GG (P<0.05); the back hair length of the yak individuals with the genotypes AA and GA was significantly higher than that of the individual with the genotype GG (P<0.05); the head hair length and hair yield of the yak individual with the genotype GA were significantly higher than those of the individual with the genotype GG (P<0.05).

[0028] In order to make the purpose, technical solutions and advantages of the present application more clear, the technical solutions of the present application will be described in detail below in combination with embodiments. It should be pointed out that the following embodiments are given only for the purpose of illustration, and are not used to limit the scope of the present application.

[0029] All reagents not described in detail in this invention are conventional reagents and are commercially available; all methods not specifically described in detail are conventional experimental methods and can be learned from the prior art. Those skilled in the art can make various modifications and substitutions to this invention without departing from its spirit and purpose.

[0030] Example 1: SNP site identification

[0031] (1) Yak sample collection

[0032] This invention uses the Tianzhu White Yak breed as the testing subject. Blood samples were collected from 759 Tianzhu White Yaks in Xiamiaoergou Village, Dachaigou Town, Tianzhu Tibetan Autonomous County, Wuwei City, Gansu Province. The wool production performance of the Tianzhu White Yaks was measured, including hair weight, skirt hair length, lateral hair length, head hair length, and back hair length. 4 ml of blood was collected from the jugular vein using EDTA anticoagulant blood collection tubes and stored at -20℃.

[0033] (2) Isolation, extraction and purification of genomic DNA

[0034] Genomic DNA was extracted from blood samples of Tianzhu white yaks using the TIANamP Blood Genomic DNA Kit; DNA quality and concentration were determined by 1.5% agarose gel electrophoresis and Thermo Scientific Nano DroP 2000c.

[0035] (3) Primer design and screening

[0036] According to Ensemble's announcement regarding the Tianzhu white yak FGF5 The gene (accession number: ENSBGRG00000010381) was used to design multiple primer pairs based on its DNA sequence using Primer 5.0 software. PCR amplification was performed on DNA samples from Tianzhu white yak, and the gene sequencing results were analyzed. A pair of primers containing an SNP site was selected, and its primer sequence information is as follows:

[0037] F: 5'-CCTGAAATAAAGACAGCCAGT-3' (shown in SEQ ID NO. 2);

[0038] R: 5'-GACACTGTTAGGAGAAAAAGG-3' (shown in SEQ ID NO.3).

[0039] (4) PCR amplification of the target gene fragment

[0040] PCR reaction system was 25 μL: 2x Taq PCR Mix 12.5 μL, DNA template (100 ng / μL) 1 μL, upstream and downstream primers (10 μmol / L) 1 μL each, 9.5 μL of enzyme-free sterile water. PCR amplification procedure: 94℃ pre-denaturation 3 min; 94℃ denaturation 30 s, 54℃ annealing 30 s, 72℃ extension 1 min, 30 cycles; 72℃ extension 5 min, 4℃ cooling. After amplification, the amplification product was detected by electrophoresis in 1.5% agarose gel.

[0041] (5) Gene sequencing

[0042] The qualified PCR reaction liquid was sent to Shanghai Shengong Biotechnology Co., Ltd. for bidirectional Sanger sequencing. The amplified target sequence is shown as SEQ ID NO. 1, and the SNP site is located at position 201 of the sequence shown in SEQ ID NO. 1. The sequencing peak chart at the mutation site is shown as Figure 1 .

[0043] SEQ ID NO. 1

[0044] TGACTTCTACCCCAGTTTCACACACACACAAAAATCATTTTCCTGAAATAAAGACAGCAGTGATTACTTAATTCAATTTTGACAAATTTTTTAAAAGTGTTGGCACCCCACTCCAGTACTCTTGCCTGGAAAATCCCATGGATGGAGGAGCCTGGTAGGCTGCAGTCCATGGGATCGCTAAGAGTCGGACACGACTGAGCGACTTCACTTTCACTTTTCACTTTCATGCACTGGAGAAGGAAATGGCAACCCACTCCAGTGTTCTTGCCTGAAGAATCCCAGGGATGGGGGAGCCTGGTGGGCTGCCATCTCTGGGGTCGCACAGAGTCGGGCACAACTGAAGCGACTTAGCAGCACTGTATAATTTAACCTTTTTCTCCTAACAGTGTCAATGAAAATAA

[0045] Example 2 Correlation between SNP molecular marker site genotypes and wool traits

[0046] (1) Genotyping

[0047] All individuals repeat the steps of (4), (5) in example 1, and the specific genotype of different individuals is determined according to the gene sequencing result. Three genotypes are detected in the detection population, and the genotype frequency and allele frequency are shown in table 1.

[0048] The 759 blood DNA samples of Tianzhu white yak are genotyped by PCR and gene sequencing, and it is found that the Tianzhu white yak FGF5 The gene SNP molecular marker site has three genotypes, which are homozygous type GG, heterozygous type GA and homozygous type AA. The frequency of the three genotypes is 0.348 (GG), 0.493 (GA) and 0.159 (AA).

[0049] Table 1 Tianzhu white yak FGF5 Genotype and allele frequency of gene SNP site

[0050]

[0051] (2) SNP genotype and hair trait phenotype value correlation analysis

[0052] In order to determine whether the SNP marker prepared by the application is related to the difference of Tianzhu white yak hair traits, the least square statistical analysis correlation analysis of the three genotypes of the SNP site at position 201 on the fragment of SEQ ID NO. 1 and the trait phenotype value of Tianzhu white yak skirt hair length, body side hair length, head hair length, back hair length and hair yield is carried out by using SPSS25.0 software, the correlation of the SNP site genotype and hair traits is calculated, and the results are shown in table 2.

[0053] The model used is as follows:

[0054] Y j =μ+G j +e j ; wherein Y j represents the observed hair trait value; G j represents the genetic effect of genotype j; μ represents the total average value of each trait; e j represents the random residual effect. The difference between groups is tested by LSD multiple comparison, and the test results are expressed by Mean±SE.

[0055] Table 2 Tianzhu white yak FGF5 Correlation analysis of gene polymorphism and hair traits

[0056]

[0057] Note: different superscript lowercase letters represent significant difference (P<0.05), significant difference (P<0.05)

[0058] As shown in Table 2, the polymorphism at the 25388433 locus of the 6th chromosome of Tianzhu White Yak has significant correlation with the body side hair length, head hair length, back hair length and hair yield of Tianzhu White Yak (P<0.05). Among them, the body side hair length, head hair length and hair yield of the Tianzhu White Yak individual with genotype AA are significantly higher than those of the individuals with genotypes GA and GG (P<0.05); the back hair length of the Tianzhu White Yak individual with genotypes AA and GA is significantly higher than that of the individual with genotype GG (P<0.05); the head hair length and hair yield of the Tianzhu White Yak individual with genotype GA are significantly higher than those of the individual with genotype GG (P<0.05).

[0059] The example identifies a SNP marker significantly correlated with the hair traits of Tianzhu White Yak, so that the selection of the individual with dominant genotype can be selected, which will help to improve the hair traits of Tianzhu White Yak.

[0060] In combination with the above results, the mutation site of the application can be used as a potential genetic marker for improving the hair yield performance of Tianzhu White Yak for the assisted selection of Tianzhu White Yak.

[0061] The above only describes the preferred embodiments of the application, and it should be noted that, for those skilled in the art, without departing from the principles of the application, a number of improvements and refinements can be made, and these improvements and refinements should also be considered as the protection scope of the application.

Claims

1. The use of a reagent for detecting a SNP molecular marker in the preparation of a reagent for detecting the traits of yak hair or early selection of yak hair traits, characterized in that, The SNP molecular marker is located at position 25388433 of chromosome 6 of Bosgu_v3.0 version of the yak reference genome with the European Nucleotide Archive accession number GCA_005887515.1, and the mutation base is G or A; The body side hair length, head hair length and hair yield of the yak individual with the genotype AA are significantly higher than those of the individuals with the genotypes GA and GG; the back hair length of the yak individuals with the genotypes AA and GA is significantly higher than that of the individual with the genotype GG; the head hair length and yield of the yak individual with the genotype GA are significantly higher than those of the individual with the genotype GG; and the yak is Tianzhu White Yak.

2. Use according to claim 1, wherein The nucleotide sequence of the SNP molecular marker is shown as SEQ ID NO. 1, and there is a G or A base mutation at position 201 of SEQ ID NO.

1.

3. The use according to claim 1, wherein The reagent comprises a primer pair for amplifying the SNP molecular marker.

4. Use according to claim 3, wherein the compound is ###0002### The nucleotide sequences of the primer pair are shown as SEQ ID NO. 2-3.

5. A method for detecting the traits of yak hair, characterized in that, The method comprises the following steps: (1) extracting yak genomic DNA as template DNA; (2) performing PCR amplification on the template DNA obtained in step (1) by using the primer pair shown as SEQ ID NO. 2-3 to obtain a PCR amplification product; (3) purifying the PCR amplification product obtained in step (2) and then performing sequencing, and genotyping the SNP molecular marker according to the sequencing result; when the base of the SNP molecular marker is G, the genotype is GG or AG; when the base of the SNP molecular marker is A, the genotype is AA; the body side hair length, head hair length and hair yield of the yak individual with the genotype AA are significantly higher than those of the individuals with the genotypes GA and GG; the back hair length of the yak individuals with the genotypes AA and GA is significantly higher than that of the individual with the genotype GG; the head hair length and yield of the yak individual with the genotype GA are significantly higher than those of the individual with the genotype GG; and the yak is Tianzhu White Yak.

6. A method for early selection of traits in yak hair, characterized by, The method comprises the following steps: (1) extracting yak genomic DNA as template DNA; (2) performing PCR amplification on the template DNA obtained in step (1) by using the primer pair shown as SEQ ID NO. 2-3 to obtain a PCR amplification product; (3) purifying the PCR amplification product obtained in step (2) and then performing sequencing, and genotyping the SNP molecular marker according to the sequencing result; when the base of the SNP molecular marker is G, the genotype is GG or AG; when the base of the SNP molecular marker is A, the genotype is AA; the body side hair length, head hair length and hair yield of the yak individual with the genotype AA are significantly higher than those of the individuals with the genotypes GA and GG; the back hair length of the yak individuals with the genotypes AA and GA is significantly higher than that of the individual with the genotype GG; the head hair length and yield of the yak individual with the genotype GA are significantly higher than those of the individual with the genotype GG; and the yak is Tianzhu White Yak.

Images