SSR (Simple Sequence Repeat) primer combination for identifying variety of bighead atractylodes rhizome and identifying method thereof

By designing and screening SSR primer combinations, combined with PCR amplification and electrophoresis detection techniques, the problem of identifying Atractylodes macrocephala germplasm resources was solved, achieving efficient and accurate identification of Atractylodes macrocephala varieties and improving the accuracy and efficiency of variety identification.

CN121204293APending Publication Date: 2025-12-26BOZHOU VOCATIONAL & TECHNICAL COLLEGE +2
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511683560.6
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-17
Publication Date
2025-12-26

AI Technical Summary

Technical Problem

Current technologies lack effective molecular markers for identifying Atractylodes macrocephala germplasm resources, leading to germplasm confusion, reduced genetic diversity, and difficulty in ensuring variety quality.

Method used

The method employs SSR primer combinations and identification techniques, including the design and screening of specific SSR primer pairs, and identifies Atractylodes macrocephala varieties through PCR amplification and electrophoresis detection, combined with fluorescent labeling and capillary electrophoresis for accurate identification.

Benefits of technology

It has enabled efficient and accurate identification of Atractylodes macrocephala germplasm resources, and can reliably distinguish Atractylodes macrocephala samples from different origins, thus improving the accuracy and efficiency of variety identification.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121204293A_ABST
    Figure CN121204293A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of molecular markers in molecular biology, in particular to an SSR (simple sequence repeat) primer combination for identifying the variety of bighead atractylodes rhizome and an identification method thereof.The method comprises the steps that firstly, common primers are adopted for amplification, and preliminary detection is completed through electrophoresis; on the basis, a detection method of combining a fluorescence labeling primer with capillary electrophoresis is further utilized, accurate identification is realized, a large number of candidate SSR markers are selected based on transcriptome data and SSR site screening, screening and optimization work is carried out through multiple conditions, and the accuracy of the SSR markers is improved. Finally, a set of SSR molecular markers capable of stably, accurately, simply and efficiently identifying the germplasm resources of the atractylodes macrocephala koidz are obtained.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of molecular markers in molecular biology, and particularly relates to a SSR primer combination for identifying Atractylodes macrocephala Koidz. and an identification method thereof. BACKGROUND

[0002] Atractylodes macrocephala Koidz. is the dried rhizome of Atractylodes macrocephala Koidz. of the family Asteraceae, which has the effects of invigorating the spleen and replenishing qi, drying dampness and promoting water excretion, stopping sweating and preventing miscarriage. Modern pharmacological studies have shown that Atractylodes macrocephala Koidz. has the effects of improving gastrointestinal function, anti-cancer, protecting nerves, and has potential therapeutic effects on low immunity, cerebral ischemia, rheumatoid arthritis, depression, diabetes, etc. However, due to long-term transplantation, hybridization between different regions, and inter-specific and inter-population hybridization and propagation, the germplasm of Atractylodes macrocephala Koidz. is in chaos, the variety is unknown, the resources of Atractylodes macrocephala Koidz. are gradually decreasing, the genetic diversity is decreasing, and the quality of the variety cannot be guaranteed.

[0003] Simple sequence repeat (SSR) is a locus polymorphism formed due to different numbers of basic repeat units. As a relatively ideal molecular marker, SSR is widely used to study germplasm resources and genetic diversity. Compared with other molecular markers, SSR markers can simultaneously detect multiple alleles, have large information content, co-dominant expression, extensive genome coverage, and are stable and reliable, and are a kind of molecular marker that can efficiently and accurately determine the genetic diversity of a species. However, this technology is lacking in Atractylodes macrocephala Koidz.

[0004] In recent years, with the progress of high-throughput sequencing technology and the rapid development of bioinformatics technology, the strategy of developing SSR markers based on transcriptome sequencing method has been widely applied, which has the advantages of high polymorphism, strong co-dominance, strong specificity, wide distribution, and low cost. Although SSR markers have been widely used in many medicinal plants, they have not been used to identify different germplasm resources of Atractylodes macrocephala Koidz.

[0005] In view of the above defects, the present inventors have finally obtained the present application after a long period of research and practice. SUMMARY

[0006] The purpose of the present application is to solve the problem of how to apply SSR markers to identify different germplasm resources of Atractylodes macrocephala Koidz., and to provide a SSR primer combination for identifying Atractylodes macrocephala Koidz. and an identification method thereof.

[0007] In order to achieve the above object, the present application discloses a SSR primer combination for identifying Atractylodes macrocephala varieties, which comprises any two combinations of SSR01, SSR02, SSR03, SSR04, SSR05, SSR06, SSR07, SSR08, SSR09, SSR10, SSR11, SSR12, SSSR13, SSR14, SSR15, SSR16, wherein,

[0008] The nucleotide sequence of the upstream primer of SSR01 is shown as SEQ ID NO. 1, and the nucleotide sequence of the downstream primer of SSR01 is shown as SEQ ID NO. 2;

[0009] The nucleotide sequence of the upstream primer of SSR02 is shown as SEQ ID NO. 3, and the nucleotide sequence of the downstream primer of SSR02 is shown as SEQ ID NO. 4;

[0010] The nucleotide sequence of the upstream primer of SSR03 is shown as SEQ ID NO. 5, and the nucleotide sequence of the downstream primer of SSR03 is shown as SEQ ID NO. 6;

[0011] The nucleotide sequence of the upstream primer of SSR04 is shown as SEQ ID NO. 7, and the nucleotide sequence of the downstream primer of SSR04 is shown as SEQ ID NO. 8;

[0012] The nucleotide sequence of the upstream primer of SSR05 is shown as SEQ ID NO. 9, and the nucleotide sequence of the downstream primer of SSR05 is shown as SEQ ID NO. 10;

[0013] The nucleotide sequence of the upstream primer of SSR06 is shown as SEQ ID NO. 11, and the nucleotide sequence of the downstream primer of SSR06 is shown as SEQ ID NO. 12;

[0014] The nucleotide sequence of the upstream primer of SSR07 is shown as SEQ ID NO. 13, and the nucleotide sequence of the downstream primer of SSR07 is shown as SEQ ID NO. 14;

[0015] The nucleotide sequence of the upstream primer of SSR08 is shown as SEQ ID NO. 15, and the nucleotide sequence of the downstream primer of SSR08 is shown as SEQ ID NO. 16;

[0016] The nucleotide sequence of the upstream primer of SSR09 is shown as SEQ ID NO. 17, and the nucleotide sequence of the downstream primer of SSR09 is shown as SEQ ID NO. 18;

[0017] The nucleotide sequence of the SSR10 upstream primer is shown as SEQ ID NO. 19, and the nucleotide sequence of the SSR10 downstream primer is shown as SEQ ID NO. 20;

[0018] The nucleotide sequence of the SSR11 upstream primer is shown as SEQ ID NO. 21, and the nucleotide sequence of the SSR11 downstream primer is shown as SEQ ID NO. 22;

[0019] The nucleotide sequence of the SSR12 upstream primer is shown as SEQ ID NO. 23, and the nucleotide sequence of the SSR12 downstream primer is shown as SEQ ID NO. 24;

[0020] The nucleotide sequence of the SSR13 upstream primer is shown as SEQ ID NO. 25, and the nucleotide sequence of the SSR13 downstream primer is shown as SEQ ID NO. 26;

[0021] The nucleotide sequence of the SSR14 upstream primer is shown as SEQ ID NO. 27, and the nucleotide sequence of the SSR14 downstream primer is shown as SEQ ID NO. 28;

[0022] The nucleotide sequence of the SSR15 upstream primer is shown as SEQ ID NO. 29, and the nucleotide sequence of the SSR15 downstream primer is shown as SEQ ID NO. 30;

[0023] The nucleotide sequence of the SSR16 upstream primer is shown as SEQ ID NO. 31, and the nucleotide sequence of the SSR16 downstream primer is shown as SEQ ID NO. 32.

[0024] The specific sequences are as follows:

[0025] SEQ ID NO. 1: ACCAGGACACACCCTCTTTTATC,

[0026] SEQ ID NO. 2: AAGATCTGGGTCAAGGGTGAAAA;

[0027] SEQ ID NO. 3: CAGGTGAAAACCATTGGGAAAGT,

[0028] SEQ ID NO. 4: AGAACACCAACCCTAACCAAAGA;

[0029] SEQ ID NO. 5: GCTTTGGAACATGGTGAAAGGAA,

[0030] SEQ ID NO. 6: ACAACTGAAGGCCACAAACAAAA;

[0031] SEQ ID NO. 7: CCCAGGCACAAATTAAGCAGATT,

[0032] SEQ ID NO. 8: AGATAAAGGAGAAGTTGCCAGGG;

[0033] SEQ ID NO. 9: TTCCAGCCTCCTTATCCTCACTA,

[0034] SEQ ID NO. 10: CCATGGGTGTGTTTGTCGTAATC;

[0035] SEQ ID NO. 11: CTCCATGCTAGTTGAAGGCAATG,

[0036] SEQ ID NO. 12: AGCCTCATACAAACGTACCATCT;

[0037] SEQ ID NO. 13: TCCGCAGTGGAATCCATATGAAT,

[0038] SEQ ID NO. 14: CCAATTGACGAGCAGATTTGTGT;

[0039] SEQ ID NO. 15: CTCATTGGCTACTCTAGTCGCTT,

[0040] SEQ ID NO. 16: GACTCATAACTACCACCACCTCC;

[0041] SEQ ID NO. 17: CAGCACCGTACTACTCCTATTCC,

[0042] SEQ ID NO. 18: ACTGGAGAGCCAATTTGTAGGTT;

[0043] SEQ ID NO. 19: GGGGTCACCAGTGATCATTTCAT,

[0044] SEQ ID NO. 20: CCCAGGCACAAATTAAGCAGATT;

[0045] SEQ ID NO. 21: AGTTCAGGTTGCAAAACCAAAACT,

[0046] SEQ ID NO. 22: CTCAATTAGCAGTTCAACCAGCA;

[0047] SEQ ID NO. 23: CCAATGAAGGGTTTGGTTTTGGT,

[0048] SEQ ID NO. 24: CAACACATGTATCTCTGCTTGCC;

[0049] SEQ ID NO. 25: AGGGAAGGAAAAAGTTGGAAAACT;

[0050] SEQ ID NO. 26: GTCCTTAGGATAGGTACCTGGGA;

[0051] SEQ ID NO. 27: CGGAAATATGTGAAGTTTGGCCA,

[0052] SEQ ID NO. 28: TCGGAAACATCTCTACCCTTTGG;

[0053] SEQ ID NO. 29: CACCCAAAAATCCTATCCATGGC,

[0054] SEQ ID NO. 30: GGTGGTGGAAAAGTTGGAGAATG;

[0055] SEQ ID NO. 31: GCATGTGTGAAATTCTGTAATGGC,

[0056] SEQ ID NO. 32: GCATGTGTGAAATTCTGTAATGGC.

[0057] The application also discloses a kit comprising the SSR primer combination.

[0058] The application also discloses a method for identifying a variety of Atractylodes macrocephala Koidz, comprising the following steps:

[0059] S1, extracting DNA of a sample to be analyzed;

[0060] S2, using the SSR primer combination as claimed in claim 1 to perform PCR amplification with the DNA obtained in step S1 as a template, so as to obtain amplification products;

[0061] S3, performing electrophoresis on each group of PCR amplification products according to each group of PCR amplification products obtained in step S2.

[0062] The system of PCR amplification in the step S2 is: 1 muL template, 10 muL 2xPCR Mix, 1 muL upstream primer, 1 muL downstream primer, 7 muL ddH2O.

[0063] The program of PCR amplification in the step S2 is: pre-denaturation 94 DEG C for 5 min; 94 DEG C denaturation for 30 s, 56 DEG C annealing for 30 s, 72 DEG C extension for 30 s, a total of 35 cycles; then 72 DEG C extension for 10 s, 4 DEG C keeping.

[0064] The electrophoresis in the step S3 is agarose gel electrophoresis, capillary electrophoresis and polyacrylamide gel electrophoresis.

[0065] Compared with the prior art, the beneficial effects of the present application are that: the present application firstly adopts ordinary primers for amplification, and completes preliminary detection through non-denaturing polyacrylamide gel electrophoresis; on this basis, further uses fluorescently labeled primers combined with capillary electrophoresis detection method to realize accurate identification; based on transcriptome data and SSR site screening, a large number of candidate SSR markers are selected, and screening and optimization work is carried out through multiple conditions, and finally a set of SSR molecular markers which can stably and accurately, simply and efficiently identify Atractylodes lancea germplasm resources is obtained. BRIEF DESCRIPTION OF DRAWINGS

[0066] Figure 1 It is a fluorescence capillary electrophoresis peak diagram of primer pair SSR07 on Hebei Anguo sample;

[0067] Figure 2 It is a fluorescence capillary electrophoresis peak diagram of primer pair SSR07 on Henan Dancheng sample;

[0068] Figure 3 It is a fluorescence capillary electrophoresis peak diagram of primer pair SSR07 on Hubei Huanggang sample;

[0069] Figure 4 It is a fluorescence capillary electrophoresis peak diagram of primer pair SSR15 on Hebei Anguo sample;

[0070] Figure 5 It is a fluorescence capillary electrophoresis peak diagram of primer pair SSR15 on Henan Dancheng sample;

[0071] Figure 6 It is a fluorescence capillary electrophoresis peak diagram of primer pair SSR15 on Hubei Huanggang sample;

[0072] Figure 7 It is a fluorescence capillary electrophoresis peak diagram of primer pair SSR01 on Sichuan Leshan sample;

[0073] Figure 8Fluorescent capillary electrophoresis peak pattern for sample from Anhui Qimen using primer pair SSR01;

[0074] Figure 9 Fluorescent capillary electrophoresis peak pattern for sample from Anhui Xuancheng using primer pair SSR01;

[0075] Figure 10 Fluorescent capillary electrophoresis peak pattern for sample from Sichuan Leshan using primer pair SSR02;

[0076] Figure 11 Fluorescent capillary electrophoresis peak pattern for sample from Anhui Qimen using primer pair SSR02;

[0077] Figure 12 Fluorescent capillary electrophoresis peak pattern for sample from Anhui Xuancheng using primer pair SSR02;

[0078] Figure 13 Fluorescent capillary electrophoresis peak pattern for sample from Anhui Bozhou using primer pair SSR06;

[0079] Figure 14 Fluorescent capillary electrophoresis peak pattern for sample from Henan Jiyuan using primer pair SSR06;

[0080] Figure 15 Fluorescent capillary electrophoresis peak pattern for sample from Zhejiang Panan using primer pair SSR06;

[0081] Figure 16 Fluorescent capillary electrophoresis peak pattern for sample from Anhui Bozhou using primer pair SSR11;

[0082] Figure 17 Fluorescent capillary electrophoresis peak pattern for sample from Henan Jiyuan using primer pair SSR11;

[0083] Figure 18 Fluorescent capillary electrophoresis peak pattern for sample from Zhejiang Panan using primer pair SSR11;

[0084] Figure 19 Fluorescent capillary electrophoresis peak pattern for sample from Zhejiang Huishan using primer pair SSR12;

[0085] Figure 20 Fluorescent capillary electrophoresis peak pattern for sample from Zhejiang Xinchang using primer pair SSR12;

[0086] Figure 21 Fluorescent capillary electrophoresis peak pattern for sample from Anhui Yuexi using primer pair SSR12;

[0087] Figure 22 Fluorescent capillary electrophoresis peak pattern for sample from Hunan Tongshi using primer pair SSR12;

[0088] Figure 23 Fluorescent capillary electrophoresis peak chart for Zhejiang Huishan sample using primer pair SSR08;

[0089] Figure 24 Fluorescent capillary electrophoresis peak chart for Zhejiang Xinchang sample using primer pair SSR08;

[0090] Figure 25 Fluorescent capillary electrophoresis peak chart for Anhui Yuexi sample using primer pair SSR08;

[0091] Figure 26 Fluorescent capillary electrophoresis peak chart for Hunan Tongshi sample using primer pair SSR08. DETAILED DESCRIPTION

[0092] The above and other technical features and advantages of the present application will be more apparent from the following detailed description taken in conjunction with the accompanying drawings.

[0093] The technical means used in the examples are conventional means known to those skilled in the art, and the raw materials used are commercially available. The high-efficiency plant genomic DNA extraction kit (centrifugal column type) is purchased from Tian Gen Biochemical Technology (Beijing) Co., Ltd.; the non-toxic YeaRed nucleic acid dye (10,000x water solution) is purchased from Yixing Biological Technology (Shanghai) Co., Ltd.; the Trans2K DNA Marker is purchased from Beijing Quanshi Gold Biotechnology Co., Ltd.; the primers are synthesized by Tongyong Biological (Anhui) Co., Ltd.; and other reagents are imported or domestic analytical pure reagents. ® The high-efficiency plant genomic DNA extraction kit (centrifugal column type) is purchased from Tian Gen Biochemical Technology (Beijing) Co., Ltd.; the non-toxic YeaRed nucleic acid dye (10,000x water solution) is purchased from Yixing Biological Technology (Shanghai) Co., Ltd.; the Trans2K DNA Marker is purchased from Beijing Quanshi Gold Biotechnology Co., Ltd.; the primers are synthesized by Tongyong Biological (Anhui) Co., Ltd.; and other reagents are imported or domestic analytical pure reagents.

[0094] Example 1

[0095] Genomic DNA extraction of Atractylodes macrocephala medicinal materials:

[0096] Fresh rhizome samples were taken for drying and powdering, 20 mg was taken and placed in a 1.5 ml centrifuge tube, and a plant genomic DNA extraction kit from Tiangen Biosciences (Beijing) Co., Ltd. was used to extract genomic DNA to obtain the DNA template. The Atractylodes lancea sample information is shown in Table 1. The 78 Atractylodes lancea germplasm resources come from 13 different production areas in China: Xuan Cheng, Anhui (XCAM-1~XCAM-6), Yue Xi, Anhui (YX-1~YX-6), Qimen, Anhui (QM-1~QM-6), Bozhou, Anhui (BZ-1~BZ-6), Pan'an, Zhejiang (PA-1~PA-6), Huishan, Zhejiang (HS-1~HS-6), Xinchang, Zhejiang (XC-1~XC6), Anguo, Hebei (AG-1~AG-6), Tongshi, Hunan (TS-1~TS-6), Leshan, Sichuan (LS-1~LS-6), Dancheng, Henan (DC-1~DC-6), Jiyuan, Henan (JY-1~JY-6).

[0097] Response: The end of Hebei Anguo is written incorrectly, and can be deleted. The abbreviations in the table are correct after checking.

[0098] Table 1 Atractylodes lancea sample information table

[0099]

[0100] Example 2

[0101] SSR primer screening for Atractylodes lancea germplasm identification:

[0102] According to the Atractylodes lancea transcriptome data, 100 candidate SSR primers were designed, and then after preliminary screening and rescreening, 16 SSR primers with stable amplification results and strong identification ability were finally obtained. Among them, the preliminary screening step: first, 7 Atractylodes lancea samples from different production areas were used to screen out 48 primers that could be used and could amplify products from 100 SSR primers; rescreening: 48 SSR sites obtained by preliminary screening were used as templates with 7 Atractylodes lancea DNA from different production areas, and 16 stable product sites were further screened out by polyacrylamide gel electrophoresis. Table 2 gives 16 pairs of SSR primers screened out, which were used for PCR.

[0103] Table 2 16 pairs of SSR primers

[0104]

[0105] All PCR amplification reaction procedures were performed by PCR amplification instrument, and the appropriate SSR reaction system and procedure were screened by optimization. The reaction system was: 1 μL template, 10 μL 2 × PCR Mix, 1 μL upstream primer F, 1 μL downstream primer R, 7 μL of ddH2O. The reaction procedure was: pre-denaturation 94°C for 5 min; 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 30 s, a total of 35 cycles; then 72°C extension for 10 s, 4°C holding.

[0106] Example 3

[0107] 16 SSR primer pairs were tested for effectiveness:

[0108] The collected DNA from 78 Atractylodes lancea materials from 13 production areas in China, each from 6 samples, was used as a template, and 16 primer pairs in Table 2 (the 5' end of the upstream primer of each primer pair was connected with a fluorescent label) were used for fluorescent capillary electrophoresis, respectively. The fluorescent capillary electrophoresis detection was completed by Shenguo Bioengineering (Shanghai) Co., Ltd. From the results of fluorescent capillary electrophoresis, each primer group could obtain good typing effect in 78 germplasms. Because there were many SSR molecular marker primers and Atractylodes lancea samples, the peak graphs of amplification results of SSR07\SSR15 combination, SSR01\SSR02 combination, SSR06\SSR11 combination, and SSR08\SSR12 combination were taken as examples for display, and the results are shown in Figures 1-26 .

[0109] From the difference in capillary electrophoresis peak value, the primer combination of SSR07 and SSR15 could distinguish the Atractylodes lancea samples from Hebei Anguo, Henan Dancheng, and Hubei Huanggang. See Figures 1-6 . Figures 1-3 The results of fluorescent capillary electrophoresis of primer SSR07 on Atractylodes lancea samples from Hebei Anguo, Henan Dancheng, and Hubei Huanggang are shown in Figures 4-6 The results of capillary electrophoresis of primer SSR15 on Atractylodes lancea samples from Hebei Anguo, Henan Dancheng, and Hubei Huanggang are shown in the figure, where the abscissa represents the size of the allele, and the ordinate represents the fluorescence intensity, wherein Figures 1-3It can be seen that the primer SSR07 has an allele size of 125.13 bp in the Atractylodes lancea sample from Anguo, Hebei, 113.67 bp and 125.2 bp in the Atractylodes lancea sample from Dancheng, Henan, and 116.56 bp and 121.54 bp in the Atractylodes lancea sample from Huanggang, Hubei. The primer SSR15 has alleles of 108.61, 108.72, 114.66 and 111.43 in the Atractylodes lancea samples from the three producing areas. According to the different allele sizes of the example primers in the Atractylodes lancea samples from the three producing areas, the Atractylodes lancea samples from different producing areas can be effectively distinguished. The primer combination of SSR01 and SSR02 can effectively distinguish the Atractylodes lancea samples from Leshan, Sichuan, Qimen, Anhui and Xuancheng, Anhui according to the allele sizes, as shown in Figures 7-12 ; the primer combination of SSR06 and SSR11 can distinguish the Atractylodes lancea samples from Bozhou, Anhui, Jiyuan, Henan and Pan'an, Zhejiang, as shown in Figures 13-18 ; and the primer combination of SSR08 and SSR12 can distinguish the Atractylodes lancea samples from Huishan, Zhejiang, Xinchang, Zhejiang, Yuexi, Anhui and Tongshi, Hunan, as shown in Figures 19-26 .

[0110] The above description is merely preferred embodiments of the present application, only illustrative, but not limitative. It is understood by those skilled in the art that many changes, modifications, even equivalents can be made to the present application within the spirit and scope defined by the claims of the present application, and all shall fall within the protection scope of the present application.

Claims

1. An SSR primer combination for identifying Atractylodes macrocephala varieties, characterized in that, The SSR primer combination comprises any two combinations of SSR01, SSR02, SSR03, SSR04, SSR05, SSR06, SSR07, SSR08, SSR09, SSR10, SSR11, SSR12, SSR13, SSR14, SSR15, and SSR16; wherein, The nucleotide sequence of the upstream primer of SSR01 is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer of SSR01 is shown in SEQ ID NO.2; The nucleotide sequence of the upstream primer of SSR02 is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of SSR02 is shown in SEQ ID NO.4; The nucleotide sequence of the upstream primer of SSR03 is shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of SSR03 is shown in SEQ ID NO.6; The nucleotide sequence of the upstream primer of SSR04 is shown in SEQ ID NO.7, and the nucleotide sequence of the downstream primer of SSR04 is shown in SEQ ID NO.8; The nucleotide sequence of the upstream primer of SSR05 is shown in SEQ ID NO.9, and the nucleotide sequence of the downstream primer of SSR05 is shown in SEQ ID NO.

10. The nucleotide sequence of the upstream primer of SSR06 is shown in SEQ ID NO.11, and the nucleotide sequence of the downstream primer of SSR06 is shown in SEQ ID NO.12; The nucleotide sequence of the upstream primer of SSR07 is shown in SEQ ID NO.13, and the nucleotide sequence of the downstream primer of SSR07 is shown in SEQ ID NO.

14. The nucleotide sequence of the upstream primer of SSR08 is shown in SEQ ID NO.15, and the nucleotide sequence of the downstream primer of SSR08 is shown in SEQ ID NO.

16. The nucleotide sequence of the upstream primer of SSR09 is shown in SEQ ID NO.17, and the nucleotide sequence of the downstream primer of SSR09 is shown in SEQ ID NO.

18. The nucleotide sequence of the upstream primer of SSR10 is shown in SEQ ID NO.19, and the nucleotide sequence of the downstream primer of SSR10 is shown in SEQ ID NO.

20. The nucleotide sequence of the upstream primer of SSR11 is shown in SEQ ID NO.21, and the nucleotide sequence of the downstream primer of SSR11 is shown in SEQ ID NO.

22. The nucleotide sequence of the upstream primer of SSR12 is shown in SEQ ID NO.23, and the nucleotide sequence of the downstream primer of SSR12 is shown in SEQ ID NO.

24. The nucleotide sequence of the upstream primer of SSR13 is shown in SEQ ID NO.25, and the nucleotide sequence of the downstream primer of SSR13 is shown in SEQ ID NO.

26. The nucleotide sequence of the upstream primer of SSR14 is shown in SEQ ID NO.27, and the nucleotide sequence of the downstream primer of SSR14 is shown in SEQ ID NO.

28. The nucleotide sequence of the upstream primer of SSR15 is shown in SEQ ID NO.29, and the nucleotide sequence of the downstream primer of SSR15 is shown in SEQ ID NO.

30. The nucleotide sequence of the upstream primer of SSR16 is shown in SEQ ID NO.31, and the nucleotide sequence of the downstream primer of SSR16 is shown in SEQ ID NO.

32.

2. A reagent kit, characterized in that, It contains the SSR primer combination as described in claim 1.

3. A method for identifying a variety of Atractylodes macrocephala, characterized in that, Includes the following steps: S1, Extract DNA from the sample to be analyzed; S2, using the DNA obtained in step S1 as a template, perform PCR amplification using the SSR primer combination as described in claim 1 to obtain the amplification product; S3. Based on the PCR amplification products obtained in step S2, perform electrophoresis on each group of PCR amplification products.

4. The method for identifying a variety of Atractylodes macrocephala as described in claim 3, characterized in that, In step S2, the PCR amplification system is as follows: 1 μL template, 10 μL 2×PCR Mix, 1 μL upstream primer, 1 μL downstream primer, and 7 μL ddH2O.

5. The method for identifying a variety of Atractylodes macrocephala as described in claim 3, characterized in that, In step S2, the PCR amplification program is as follows: pre-denaturation at 94℃ for 5 min; denaturation at 94℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 30 s, for a total of 35 cycles; followed by extension at 72℃ for 10 s, and holding at 4℃.

6. The method for identifying a variety of Atractylodes macrocephala as described in claim 3, characterized in that, In step S3, the electrophoresis is agarose gel electrophoresis, capillary electrophoresis, and polyacrylamide gel electrophoresis.