Construction method and application of anxiety and / or depression model

An anxiety and depression model was established by knocking out the glucose ceramide synthase gene in mice using gene editing technology. This addresses the challenges of existing models in simulating pathological mechanisms and assessing behavior, and provides an important tool for studying anxiety and depression.

CN121220437APending Publication Date: 2025-12-30WEST CHINA HOSPITAL SICHUAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510103254.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-01-22
Publication Date
2025-12-30

AI Technical Summary

Technical Problem

Existing animal models of anxiety and depression face challenges in simulating complex pathological mechanisms and assessing behavioral performance, and there is a lack of research on constructing anxiety and depression models using gene editing technology.

Method used

Using gene editing technology, especially CRISPR/Cas9 technology, LoxP was inserted into the exon 2-5 region of the mouse Ugcg gene to construct Ugcgf/f mice. These mice were then crossed with D2-Cre mice to knock out the glucose ceramide synthase gene in neurons expressing dopamine D2 receptors, thus establishing an anxiety and depression model.

Benefits of technology

Anxiety and depression models were successfully constructed, which helps to explore the molecular mechanisms and neural circuits of anxiety and depression, provides an important means for drug screening and treatment, and does not affect the learning and memory abilities of mice.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121220437A_ABST
    Figure CN121220437A_ABST
Patent Text Reader

Abstract

The invention provides a construction method and application of an anxiety and / or depression model, and belongs to the technical field of biology. According to the construction method, a gene editing technology is adopted to knock out an animal gene encoding glucosylceramide synthetase, and the animal model is obtained. The invention finds that glucose ceramide synthetase (GCS) in neurons for expressing the dopamine D2 type receptor is key protein for anxiety and depression through research for the first time, and an anxiety and / or depression model can be successfully constructed by knocking out a gene (Ugcg gene) for coding glucose ceramide synthetase in neurons for expressing the dopamine D2 type receptor in a mouse. According to the method for constructing the anxiety and / or depression model, genes related to anxiety and depression are knocked out, so that molecular mechanisms, neural circuits and potential treatment targets of anxiety and depression can be deeply discussed, and an important means is provided for basic and clinical research of anxiety and depression.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method for constructing an anxiety and / or depression model and its applications. Background Technology

[0002] Anxiety and depression are common mental disorders worldwide, severely impacting patients' quality of life and imposing a heavy burden on society and families. In recent years, the incidence of anxiety and depression has been on the rise, but treatment methods (pharmacy, psychotherapy, and physical therapy, etc.) suffer from limited efficacy, high dependence, drug tolerance, and significant side effects. Basic and clinical research on anxiety and depression has become a hot topic.

[0003] Animal models are crucial tools for studying the mechanisms of anxiety and depression and developing related drugs. Existing animal models of anxiety and depression are typically stress models, inducing stress responses in animals through various stimuli, resulting in states of anxiety or depression. However, these models still face many challenges, particularly in simulating complex pathological mechanisms, effectively assessing behavioral performance, and providing accurate drug responses. Using gene editing technology to edit animal genes to obtain corresponding animal models is currently a common method for constructing various animal models. This method offers advantages such as rapid modeling, ease of operation, low cost, and good accuracy and specificity.

[0004] Glucosylceramide (GlcCer), an important glycosphingolipid, has been shown to play crucial roles in the nervous system, including regulating neuroinflammation, maintaining cell membrane stability, and neuroprotection. The synthesis and metabolism of glucosylceramide occur through a series of enzymatic reactions, with glucosylceramide synthase (GCS) being the key enzyme in its synthesis. The activity regulation of glucosylceramide synthase is closely related to nerve cell function. Studies have found that glucosylceramide exerts its effects in the nervous system through multiple pathways. Through its metabolites, glucosylceramide can regulate neuroinflammatory responses, reducing the levels of inflammatory factors and thus combating neurological inflammation caused by mental illness. Glucosylceramide protects nerve cells from oxidative stress and cell damage by regulating cell membrane stability, promoting neuronal growth and repair. The synthesis of glucosylceramide directly affects neuronal function and morphology, promoting synapse formation and signal transmission between neurons.

[0005] Currently, there are no studies on constructing animal models of anxiety and depression by knocking out the gene encoding glucose ceramide synthase. Summary of the Invention

[0006] In order to address the problems of the prior art, the present invention aims to provide a method for constructing an anxiety and / or depression model and its uses.

[0007] This invention provides a method for constructing an anxiety and / or depression model, which involves using gene editing technology to knock out the gene encoding glucose ceramide synthase in an animal, thereby obtaining the animal model.

[0008] Furthermore, the aforementioned construction method involves using gene editing technology to knock out the gene encoding glucose ceramide synthase in neurons of animals that express dopamine D2 receptors, thereby obtaining an animal model.

[0009] Furthermore, the animal in question is a mouse.

[0010] Furthermore, the gene editing technology is a conditional gene knockout technology.

[0011] Furthermore, the construction method includes the following steps: mixing Cre mice with Ugcg... f / f The mouse is then hybridized to obtain the desired result.

[0012] Furthermore, the Ugcg f / f Mice were constructed using CRISPR / Cas9 gene editing technology. LoxP molecules were inserted at both ends of exons 2-5 of the mouse Ugcg gene to construct the Ugcg gene. f / f Mice;

[0013] And / or, the Cre mouse is a D2-Cre mouse.

[0014] Furthermore, the construction of Ugcg f / f The mouse gRNA sequences are shown in SEQ ID NO.1–4.

[0015] The present invention also provides an anxiety and / or depression model, which is a model constructed by the aforementioned construction method.

[0016] The present invention also provides the use of the aforementioned anxiety and / or depression models in research on anxiety disorders and / or depression for the purpose of non-disease diagnosis or treatment.

[0017] The present invention also provides the use of the aforementioned anxiety and / or depression models in screening drugs for the prevention and / or treatment of anxiety disorders and / or depression.

[0018] The present invention has achieved the following beneficial effects:

[0019] This invention is the first to discover that glucose-ceramide synthase (GCS) in neurons expressing dopamine D2 receptors is a key protein in anxiety and depression. Knocking out the gene encoding glucose-ceramide synthase (Ugcg gene) in mouse neurons expressing dopamine D2 receptors successfully constructs anxiety and / or depression models. This method for constructing anxiety and / or depression models, by knocking out genes related to anxiety and depression, helps to deeply explore the molecular mechanisms, neural circuits, and potential therapeutic targets of anxiety and depression, providing an important tool for basic and clinical research on anxiety and depression.

[0020] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0021] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following embodiments. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0022] Figure 1 Results of constructing conditionally knocked-out Ugcg gene mice: A shows the gene-generating mouse construction strategy; B and C show the control mice (D2-Cre mice) and D2-Ugcg mice, respectively. f / f Representative immunofluorescence images of mice and statistical analysis of differences; D and E represent control mice (D1-Cre mice) and D1-Ugcg mice, respectively. f / f Representative immunofluorescence images of mice and statistical analysis of differences.

[0023] Figure 2 D2-Ugcg f / f Behavioral assessment results of mice: A represents the total distance traveled by mice in the open field experiment; B represents the time spent by mice in the central area of ​​the open field experiment; C represents the time spent by mice in the open arm area of ​​the elevated cross maze experiment; D represents the number of times mice entered the open arm area of ​​the elevated cross maze experiment; E represents the sucrose preference index of mice in the sucrose preference experiment; F represents the immobility time of mice in the forced swimming experiment; G represents the proportion of time spent on new objects in the new object recognition experiment; H represents the proportion of mice in the correct area of ​​the T maze; all data are expressed as mean ± SEM; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001, ns indicates no significant difference.

[0024] Figure 3 D1-Ugcg f / fBehavioral assessment results of mice: A is the total distance traveled by mice in the open field experiment; B is the time spent by mice in the central area of ​​the open field experiment; C is the time spent by mice in the open arm area of ​​the elevated cross maze experiment; D is the number of times mice entered the open arm of the elevated cross maze experiment; E is the time spent entering the light field in the light-dark shuttle experiment; F is the number of times mice entered the light field in the light-dark shuttle experiment; G is the sucrose preference index of mice in the sucrose preference experiment; H is the immobility time of mice in the forced swimming experiment; all data are expressed as mean ± SEM; ns indicates no significant difference. Detailed Implementation

[0025] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0026] 1. Experimental reagents

[0027] The reagents used in this section are as follows: cocaine hydrochloride (China National Institutes for Food and Drug Control), physiological saline (Sichuan Kelun Pharmaceutical Co., Ltd.), RIPA lysis buffer (Shanghai Beyotime Biotechnology Co., Ltd., P0013B), BCA kit (Shanghai Beyotime Biotechnology Co., Ltd., P0010), 5×SDS-PAGE electrophoresis loading buffer (Shanghai Beyotime Biotechnology Co., Ltd., P0015), 7.5% SDS-PAGE reagent (Guangzhou Baihe Biotechnology Co., Ltd., PG111), 10% SDS-PAGE reagent (Guangzhou Baihe Biotechnology Co., Ltd., PG112), 12.5% ​​SDS-PAGE reagent (Guangzhou Baihe Biotechnology Co., Ltd., PG113), methanol (Shanghai Chemical Reagent Co., Ltd.), and protein pre-staining marker (Thermo). Scientfic (26616), Tris-base (Solarbio, G8200), glycine (Solarbio, T8060), anti-GCS antibody (Shanghai Sangon Biotech Co., Ltd.), anti-Tubulin antibody (Cell Signaling Technology, #15115), horseradish peroxidase-labeled secondary antibody (Cell Signaling Technology, #8887), BeyoECL (Shanghai Beyotime Biotechnology Co., Ltd., P0018), Tween-20 (Biorad, #1706531), RNA extraction kit (Axygen, AP-MN-P-50), isopropanol (Shanghai Chemical Reagent Co., Ltd.), 100% ethanol (Shanghai Chemical Reagent Co., Ltd.), DEPC water (Shanghai Beyotime Biotechnology Co., Ltd.), RNAStore sample preservation solution (Tiangen Biotech Co., Ltd., DP408), Bestar™ qPCR RT Kit ( Bioscience, DBI-2220), Stormstar SYBY Green qPCR Mastermix( Bioscience, DBI-2243), (-)-L-threo-PDMP (hydrochloride) (Cayman, 10005278).

[0028] 2. Main Instruments

[0029] Electronic analytical balance (Sartorius), refrigerator (Electrolux), deep cryogenic freezer (Thermo Scientific), ice maker (Scotsman), flatbed shaker (Haimen Qilin Medical Instrument Factory), adjustable vortex mixer (SCILOGEX), ultrasonic disruptor (Ningbo Xinzhi Biotechnology Co., Ltd.), constant temperature water bath (Guohua Electric Appliance Co., Ltd.), multi-tube automatic balancing centrifuge (Changsha Xiangyi Centrifuge Instrument Co., Ltd.), mouse brain stereotaxic apparatus (Shenzhen Ruiwode Biotechnology Co., Ltd.), 5μl flat-tip microsyringe (Shenzhen Ruiwode Biotechnology Co., Ltd.), micropipette (Eppendorf), LifeECO gene amplification instrument (Hangzhou Borui Technology Co., Ltd.), electrophoresis apparatus (Bio-Rad Laboratories, USA), electrophoresis tank (Bio-Rad Laboratories, USA), Western blot gel imaging system (Shanghai Qinxiang Scientific Instruments Co., Ltd.).

[0030] Example 1: Construction of an anxiety and / or depression model

[0031] 1. Obtain Ugcg f / f mice

[0032] Ugcg f / f Mice were constructed by inserting LoxP molecules into both ends of exons 2-5 of the mouse Ugcg gene. They can be prepared artificially or purchased commercially available genetically modified mice. Ugcg mice were prepared using CRISPR-Cas9 technology. f / f In mice, the gRNA sequences were as follows: gRNA1: TCTGTGGCCCTAAGTGAAGC (SEQ ID NO.1); gRNA2: GGGAGATATTAAGTTGCCAA (SEQ ID NO.2); gRNA3: GCAAACACCTGCTTCACTTA (SEQ ID NO.3); gRNA4: TAGGACTTTGATTTGACCTT (SEQ ID NO.4).

[0033] The Ugcg used in this embodiment f / fThe mice were commercially available genetically modified mice (product number T008258, Jiangsu Jicui Pharmaceutical Co., Ltd.).

[0034] 2. Obtain D2-Cre mice

[0035] D2-Cre mice are transgenic mice in which Cre recombinase is inserted into the dopamine D2 receptor gene locus. The D2-Cre mice used in this example are commercially available tool mice: D2-Cre [MMRRC, Tg(Drd2-cre)ER44Gsat] mice, which are provided by MMRRC and numbered ER44Gsat.

[0036] 3. Construction of an anxiety and / or depression model

[0037] Ugcg f / f Mice are crossed with D2-Cre mice to obtain Ugcg gene knockout mice (D2-Ugcg mice) in neurons expressing dopamine D2 receptors. f / f (Mouse). Neurons expressing dopamine D2 receptors include medium-sized polyspinous neurons in the dorsal striatum that express dopamine D2 receptors.

[0038] In this invention, UDP-glucosyltransferase (Ugcg gene) is a gene encoding glucose ceramide synthase (GCS).

[0039] The following specific experimental examples demonstrate the beneficial effects of the present invention.

[0040] Experimental Example 1, D2-Ugcg f / f Studies on anxiety and depression behavior in mice

[0041] I. Experimental Methods

[0042] 1. Construction of conditional gene knockout mice

[0043] All experimental procedures and the use of mice complied with the research protocols approved by the Institutional Animal Care and Use Committee of Sichuan University. f / f The mice were constructed by inserting LoxP molecules at both ends of exons 2-5, and were commercially available genetically modified mice (product number T008258, Jiangsu Jicui Pharmaceutical Co., Ltd.).

[0044] D2-Cre and D1-Cre mice are transgenic mice in which Cre recombinase is inserted into the dopamine D2 receptor or D1 receptor gene locus. The D2-Cre and D1-Cre mice used in this example are commercially available utility mice: D2-Cre [MMRRC, Tg(Drd2-cre)ER44Gsat] mice and D1-Cre [MMRRC, Tg(Drd1a-cre)EY262Gsat] mice, provided in MMRRC units and numbered ER44Gsat and EY262Gsat, respectively.

[0045] Ugcg f / f Mice were crossed with commercially available D1-Cre [MMRRC, Tg(Drd1a-cre)EY262Gsat] or D2-Cre [MMRRC, Tg(Drd2-cre)ER44Gsat] mice to obtain Ugcg gene knockout mice (D1-Ugcg) in neurons expressing dopamine D1 receptors. f / f Ugcg gene knockout mice (D2-Ugcg mice) and neurons expressing dopamine D2 receptors f / f (Mouse). In order to knock out the Ugcg gene from neurons expressing dopamine D1 and D2 receptors.

[0046] Among them, D2-Ugcg f / f The mice were models of anxiety and / or depression.

[0047] Ugcg f / f Gene identification in mice was performed using a forward primer (SEQ ID NO. 5: CTTGGCTAGTGGTCAGTCATCTAGC) and a reverse primer (SEQ ID NO. 6: GGAAGCACACCAGTAAGGGAAACA). Gene identification in D1-Cre mice was performed using a forward primer (SEQ ID NO. 7: GCTATTGGAGATGCTCCTGATGGAA) and a reverse primer (SEQ ID NO. 8: CGGCAAACGGACAGAAGCATT). Gene identification in D2-Cre mice was performed using a forward primer (SEQ ID NO. 9: GTGCGTCAGCATTTGGAGCAA) and a reverse primer with the nucleotide sequence shown in SEQ ID NO. 8. This ensured the successful construction of conditional gene knockout mice.

[0048] Conditional gene knockout mice (D2-Ugcg) f / f Mice and D1-Ugcg f / f Behavioral tests were conducted on mice.

[0049] 2. Behavioral testing

[0050] D1-Ugcg was administered according to the following method. f / f Mice and D2-Ugcg f / f Behavioral tests were performed on the mice.

[0051] 2.1 Anxiety-like behavior

[0052] 2.1.1 Open Field Test (OFT)

[0053] The open field experiment was divided into two parts: an adaptation period and a testing period. (1) Adaptation period: The day before the experiment, mice were placed in a spontaneous activity detection box and allowed to move freely to adapt to the detection environment for a total of 15 minutes. (2) Testing period: Mice were placed in a spontaneous activity detection box. No monitoring was performed for the first minute. After one minute, the activity of the mice in the spontaneous activity detection box was monitored for a total of 5 minutes. The monitoring indicators were set as the distance s (cm) and the speed v (cm / s) of the mice. The spontaneous activity detection box was divided into a central area and a peripheral area. The total distance s and the time in the central area were calculated based on the s and v values ​​of different areas. The movement of the mice was recorded using Ethovision XT software throughout the experiment.

[0054] 2.1.2 Elevated Plus Maze Test (EPMT)

[0055] The elevated cross maze consists of a cross support and a camera, and includes two open arms and two closed arms. Mice are placed in the closed arms, and their movement trajectories are recorded over 5 minutes. The data are analyzed using ANY-Maze software, and the detection indicators include total movement distance (m), percentage of time spent in the open arms, and percentage of time spent in the closed arms.

[0056] 2.1.3 Light-Dark Test (LDT)

[0057] The mouse black-and-white shuttle box consisted of two identical compartments. The bright compartment was white on all sides and had a white light source, while the dark compartment was black on all sides and had a door that could be opened in the center. Mice were placed in the dark compartment, and their movement trajectories were recorded over 5 minutes and analyzed using ANY-Maze software. The key performance indicators (KPIs) included the total number of shuttles and the time spent in the bright and dark compartments (in seconds).

[0058] 2.2 Depression-like behavior

[0059] 2.2.1 Sucrose Preference Test (SPT)

[0060] The sucrose preference test is an important indicator for detecting depressive-like behavior. The specific operation steps are as follows: (1) Adaptation period: Place a bottle containing 1% sucrose solution and a bottle containing pure drinking water on the mouse cage at the same time, and let the experimental mice drink water freely for a total of 48 hours. (2) Water deprivation: Do not provide any drinking water to the experimental mice for 6 hours after the adaptation period. (3) Sucrose preference test: Weigh the original 1% sucrose solution bottle and pure drinking water bottle (g), exchange their positions on the mouse cage, and let the mice choose to drink water freely. After 24 hours, weigh the 1% sucrose solution bottle and pure drinking water bottle again (g′). Sucrose preference degree = sucrose (g′) / {drinking water (g′) + sucrose (g′)} × 100%

[0061] 2.2.2 Forced Swimming Test (FST)

[0062] The forced swimming experiment was divided into two parts: an adaptation period and a testing period. (1) Adaptation period: The day before the experiment, the mice were placed in a transparent cylindrical water tank filled with purified water and allowed to move freely for 15 minutes to adapt to the environment. The tank dimensions were: r = 8 cm, h = 40 cm, the water temperature was maintained at 25 ± 2 ℃, and the water volume was two-thirds of the total capacity. (2) Testing period: The mice were placed in the water tank. No monitoring was performed for the first minute. After one minute, the mice's activity in the tank was monitored for a total of 5 minutes. The monitoring threshold was set at 1.5 cm / s. Above this threshold, the mouse's movement was defined as moving; below this threshold, the mouse's movement was defined as not moving. The spontaneous activity detection box and Ethovision XT software were used to record the movement of the mice throughout the experiment.

[0063] 2.3 Novel Object Recognition (NOR) Experiment

[0064] The novel object recognition experiment consists of three main phases: First, a pre-adaptation phase, where mice freely explore the experimental box to adapt to the environment and reduce stress; next, a training phase, where two identical objects are placed in the box, and the mice freely explore for 20 minutes to ensure they have no preference for any particular object; finally, a testing phase, where one object is replaced with a new object, and the mice again freely explore, typically for 15 minutes. During the experiment, the exposure time of the mice to the new and familiar objects is recorded, and a novel object preference index is calculated to assess the mice's interest in the new object, thereby determining their object recognition memory function.

[0065] 2.4T Maze

[0066] The T-maze experiment consists of three main phases: First, the training phase, where mice are placed at the starting end of a T-maze and choose one arm to explore (the target arm), while the other arm remains closed. Mice can only choose one arm at a time, and their choice is reinforced with a food reward. Next, the testing phase, where mice are returned to the starting end and the goal is to choose the arm they previously visited, testing their spatial memory retention. During the experiment, the accuracy of the mice's arm selections is recorded to assess their memory and learning abilities.

[0067] 3. Statistical Analysis

[0068] All data are expressed as mean ± SEM. For all behavioral data, two-tailed Student's st-tests or one-way ANOVA Tukey's statistical analysis were used.

[0069] II. Experimental Results

[0070] 1. Constructing a conditionally knocked-out GCS gene mouse

[0071] Based on CRISPR / Cas9 gene editing technology, LoxP was inserted at both ends of the exon 2-5 region of the Ugcg gene (encoding GCS) to construct Ugcg. f / f Mice, the construction strategy is as follows Figure 1 As shown in Figure A. The Ugcg in this invention... f / f The mice were commercially available genetically modified mice purchased from overseas. Ugcg was administered. f / f D1-Ugcg was obtained by mating mice with either D1-Cre or D2-Cre mice. f / f Mice and D2-Ugcg f / f Mice. Immunofluorescence was used to detect the knockout efficiency. The results showed that, compared with control mice, D1-Ugcg... f / f Mice and D2-Ugcg f / f GCS expression was significantly downregulated in mice. Figure 1 B-1E) indicates that the conditional gene knockout mouse was successfully constructed.

[0072] 2. Conditional knockout of the Ugcg gene induces anxiety-depression-like behavior in mice.

[0073] To investigate whether knocking out the Ugcg gene leads to anxiety-depression-like behavior in mice, behavioral tests were conducted. The results showed that conditional knockout of the Ugcg gene in neurons expressing dopamine D2 receptors did not affect the movement of mice. Figure 2 A), but significantly reduces the time spent in the central area of ​​the open field ( Figure 2B). In the elevated cross maze experiment, mice with conditional knockout of the Ugcg gene in neurons expressing dopamine D2 receptors showed significantly reduced time spent in the open arm and number of times they entered the open arm. Figure 2 C-2D). Conditional knockout of the Ugcg gene in neurons expressing dopamine D2 receptors significantly reduced sucrose preference. Figure 2 E), and the immobility time during forced swimming increased significantly ( Figure 2 F). The above behavioral studies demonstrate that conditional knockout of the Ugcg gene in neurons expressing dopamine D2 receptors leads to anxiety and depression-like behaviors in mice. This invention further examined learning and memory behavior in mice, and the results showed that D2-Ugcg... f / f It does not change the mouse's exploration of new objects or its selection of the correct region. Figure 2 The results (G-2H) indicate that conditional knockout of the Ugcg gene in neurons expressing dopamine D2 receptors does not affect the learning and memory abilities of mice. In conclusion, conditional knockout of the Ugcg gene in neurons expressing dopamine D2 receptors leads to anxiety and depressive behaviors in mice, but does not affect their learning and memory.

[0074] To further explore whether conditional knockout of the Ugcg gene in neurons expressing dopamine D1 receptors leads to anxiety and depression in mice, behavioral tests were conducted. The results showed that conditional knockout of the Ugcg gene in neurons expressing dopamine D1 receptors did not affect the mice's movement or the time spent in the open field center. Figure 3 A-3B). In the elevated cross maze experiment, mice with conditional knockout of the Ugcg gene in neurons expressing dopamine D1 receptors showed no significant changes in the time spent in the open arm or the number of times they entered the open arm. Figure 3 In the light-dark travel experiment, there were no significant changes in the time and number of times the light field was entered. Figure 3 E-3F). Conditional knockout of the Ugcg gene in neurons expressing dopamine D1 receptors showed no significant change in sucrose preference. Figure 3 G), and the immobility time during forced swimming also did not change significantly ( Figure 3 H). The above behavioral studies demonstrate that conditional knockout of the Ugcg gene in neurons expressing dopamine D1 receptors does not lead to anxiety- and depression-like behaviors in mice.

[0075] In summary, this invention is the first to discover that glucose-ceramide synthase (GCS) in neurons expressing dopamine D2 receptors is a key protein in anxiety and depression. Knocking out the gene encoding glucose-ceramide synthase (Ugcg gene) in mouse neurons expressing dopamine D2 receptors successfully constructs anxiety and / or depression models. This invention's method for constructing anxiety and / or depression models, by knocking out genes related to anxiety and depression, helps to deeply explore the molecular mechanisms, neural circuits, and potential therapeutic targets of anxiety and depression, providing an important tool for basic and clinical research on anxiety and depression.

Claims

1. A method of constructing a model of anxiety and / or depression, characterized by: It is obtained by knocking out the gene encoding glucosylceramide synthase in animals using gene editing technology.

2. The construction method of claim 1, wherein: It is obtained by knocking out the gene encoding glucosylceramide synthase in neurons expressing dopamine D2 receptor in animals using gene editing technology.

3. The method of construction of claim 2, wherein: The animal is a mouse.

4. The construction method according to any one of claims 1 to 3, characterized in that: The gene editing technology is conditional gene knockout technology.

5. The method of construction of claim 4, wherein: The construction method comprises the following steps: crossing Cre mice with Ugcg f / f The mice are crossed, and the offspring is obtained.

6. The method of construction of claim 5, wherein: The Ugcg f / f Mice were constructed using CRISPR / Cas9 gene editing technology, LoxP was inserted at both ends of the 2-5 exon region of the Ugcg gene of the mice, and Ugcg f / f Mice; The Cre mouse is a D2-Cre mouse.

7. The method of construction of claim 6, wherein: The construct Ugcg f / f The gRNA sequences for mice are shown in SEQ ID NO. 1-4.

8. A model of anxiety and / or depression, characterized in that: It is obtained by the construction method of any one of claims 1-7.

9. Use of the anxiety and / or depression model of claim 8 in the research of anxiety and / or depression diseases, which is for the purpose of non-disease diagnosis or treatment.

10. Use of the anxiety and / or depression model of claim 8 in screening drugs for preventing and / or treating anxiety and / or depression.