Construction method and application of expression human ATP7B and high-frequency mutant transgenic mouse animal model

Abstract

The invention discloses a construction method and application of an animal model for expressing human ATP7B and a high-frequency mutant transgenic mouse of the human ATP7B, and belongs to the technical field of animal model construction. The invention provides a construction method of a human ATP7B high-frequency mutant transgenic mouse model. The method comprises the following steps: firstly, transforming a BAC plasmid, knocking out a non-target gene, and accurately introducing specific p.R778L, p.P992L and p.T935M point mutation of East Asian population by utilizing a CRISPR / Cas9 technology, so as to obtain mutant BAC DNA (Deoxyribose Nucleic Acid); and then, microinjection is carried out on the mouse fertilized eggs, and transgenic positive F0-generation mice are obtained through cultivation. And finally, hybridizing and screening with Atp7b gene knockout mice in multiple generations to obtain a target strain of which the endogenous Atp7b is completely deleted and which only expresses the human mutant ATP7B. The model can accurately simulate the genetic background and pathological phenotype of East Asia WD patients, and can be used for screening targeted drugs aiming at human ATP7B mutation and evaluating the improvement effect of the drugs on liver and nerve injury.

Description

Technical Field

[0001] This invention belongs to the field of animal model construction technology, specifically relating to a method for constructing and applying a transgenic mouse animal model expressing human ATP7B and its high-frequency mutants. Background Technology

[0002] Wilson's disease (WD) is an autosomal recessive inherited disorder of copper metabolism caused by mutations in the ATP7B gene, resulting in a deficiency in the function of the copper transporter P-type ATPase. Patients clinically present with cirrhosis, neuropsychiatric symptoms, and in severe cases, it can be life-threatening.

[0003] The existing animal models used to study WD mainly include the following categories, but all of them have significant limitations:

[0004] Therefore, there has long been a lack of an animal model for WD that can simultaneously meet the following conditions: (1) Genetic background matching: precisely carrying high-frequency pathogenic mutations in East Asian populations; (2) Complete pathological phenotype: It can reproduce the pathological features of multiple organs such as the liver and nervous system of WD; (3) High practicality: Based on the mouse system with fast reproduction and low cost, it is easy to conduct large-scale research.

[0005] This gap has severely hampered research into the pathogenesis of WD patients in East Asia (especially the mechanisms of neurological symptoms) and the development of targeted therapies. Summary of the Invention

[0006] In view of this, the purpose of this invention is to provide a method for constructing a transgenic mouse model expressing human ATP7B and its high-frequency mutants, and its application.

[0007] To achieve the above objectives, the present invention provides the following technical solution: This invention provides a method for constructing a transgenic mouse model expressing human ATP7B and its high-frequency mutants, comprising the following steps: S1. The three additional genes UTP14C, ALG11, and NEK5 of the BAC plasmid were knocked out, and the ATP7B-BAC plasmid was transformed into E. coli to obtain the BAC strain. Subsequently, recombination was performed in this strain using pRedET and pFlpe plasmids to introduce a 3×Myc tag to obtain wild-type ATP7B-BAC DNA. Using CRISPR / Cas9 combined with single-stranded DNA-mediated base editing technology, the wild-type ATP7B-BAC DNA was modified with p.R778L, p.P992L, and p.T935M bases, respectively. After screening, label excision, and sequencing verification, four mutant ATP7B-BAC DNAs were obtained. The mutant ATP7B-BAC DNA obtained by NotI restriction enzyme digestion was then purified by dialysis. S2. The purified mutant ATP7B-BAC DNA was introduced into the fertilized eggs of donor mice via microinjection, and then transplanted into surrogate mother mice to develop and give birth to F0 generation mice. Transgenic positive F0 generation mice were then screened. S3. The obtained transgenic positive F0 generation mice were then compared with Atp7b. - / - Mice were crossbred to obtain F1 generation mice; the F1 generation mice were then crossbred again with Atp7b - / - Mice were backcrossed for 2 to 3 generations. After each generation of crosses, the offspring mice were genotyped and screened for mice with the genotype of endogenous Atp7b homozygous knockout and integration of human ATP7B mutant BAC, which are transgenic mice expressing human ATP7B high-frequency mutants.

[0008] Furthermore, in S1, p.R778L is located in exon 8 of the ATP7B gene, with a base mutation c.2333G>T, resulting in the amino acid changing from arginine to leucine; p.P992L is located in exon 13, with a base mutation c.2975C>T, resulting in the amino acid changing from proline to leucine, which is the second most frequent mutation in East Asian populations; p.T935M is located in exon 12, with a base mutation c.2804C>T, resulting in the amino acid changing from threonine to methionine.

[0009] Furthermore, the single-stranded DNA sequence for CRISPR / Cas9 base editing in S1 is designed for each mutation site to ensure that only the target bases are replaced and there are no other random mutations; the sequencing verification uses Sanger sequencing, covering the full-length coding region of the ATP7B gene and 200bp upstream and downstream of the mutation site.

[0010] Furthermore, the four types of ATP7B-BAC DNA in S1 are ATP7B-BAC DNA without base modification, ATP7B-BAC DNA modified with p.R778L base, ATP7B-BAC DNA modified with p.P992L base, and ATP7B-BAC DNA modified with p.T935M base.

[0011] Preferably, the concentration of purified mutant ATP7B-BAC DNA in S1 is ≥50 ng / μL.

[0012] Preferably, the donor mouse in S2 is an SPF-grade Fvb mouse. Further, in S2, the microinjection involves injecting a DNA solution into the male pronucleus of the fertilized egg.

[0013] Preferably, the surrogate mother mouse in S2 is an ICR strain mouse.

[0014] Preferably, Atp7b in S3 - / - The mice were endogenous Atp7b gene knockout mice. Furthermore, the endogenous Atp7b wild-type was detected using ATP7B-WT-F (GTGAACATCAAGGTGTCCCTG) and ATP7B-WT-R (ATGGCTGTCTGCAGGAACATG). Endogenous Atp7b knockout was detected using ATP7B-KO-F (GGCATTGTGAACATCAAGGTG) and ATP7B-KO-R (TCGAGATCCACTAGTTCTAGC). Detection of human ATP7B mutant BAC using Myc tag primers.

[0015] This invention also provides the application of the transgenic mouse animal model obtained by the above construction method in the study of the pathogenesis of Wilson's disease (WD), which is used to study the effects of high-frequency WD mutations p.R778L, p.P992L, and p.T935M on copper metabolism in East Asian populations, and the pathogenesis mechanism of extrapyramidal symptoms of WD neurological symptoms.

[0016] The present invention also provides the application of the transgenic mouse animal model obtained by the above construction method in the screening and evaluation of WD therapeutic drugs, characterized in that it is used to evaluate the effect of targeted drugs against high-frequency mutations in human ATP7B on liver damage and nerve function.

[0017] It contains at least the following beneficial technical effects: 1. Simulating the genetic background of East Asian WD patients: For the first time, a model was constructed targeting the core high-frequency mutations (p.R778L, p.P992L, p.T935M) in East Asian populations, solving the "racial mismatch" problem of existing models and enabling precise study of the pathogenic mechanism of these mutations; 2. Reproduced WD multi-organ pathological phenotype: compared to Atp7b showing only liver cirrhosis. - / - In mice, this model preserves the characteristics of liver lesions while allowing observation of neurological function-related phenotypes (such as changes in motor coordination), filling the gap in the model for the study of neurological symptoms of WD. 3. High biorelevance and stability: The full-length human ATP7B gene (including complete regulatory sequences) is introduced using BAC technology, ensuring that the gene expression pattern is consistent with that of humans; the mutation sites have been verified by multiple generations of sequencing to be stably inherited, with no chimeric or reversion mutations, and the experiment has high reproducibility; 4. Highly efficient support mechanism research and drug development: By comparing the phenotypic differences among the three mutant models, the pathogenicity of different mutations can be clarified; at the same time, it can be used to screen targeted drugs against human ATP7B mutations (such as gene editing tools to repair mutations and small molecule drugs to improve copper metabolism), and evaluate the effect of drugs on liver and nerve damage. 5. Cost-effectiveness advantages: Mouse models have a short breeding cycle (generation interval of about 2 months), low breeding costs, and can be used for large-scale experiments. They are easier to promote than large mammal or non-human primate models. Attached Figure Description

[0018] Figure 1 The process of preparing ATP7B-BAC humanized transgenic mice, including plasmid preparation, injection, mouse breeding, and hybridization screening, is shown.

[0019] Figure 2 (BAC plasmid construction and technical roadmap) This demonstrates the entire process of BAC plasmid modification, transgenic mouse preparation, and hybridization verification: First, BAC plasmids containing human ATP7B wild-type (WT) and mutants R778L, P992L, and T935M are microinjected into mouse zygotes to obtain F0 generation mice; after screening for positive F0 generation mice by PCR identification (containing a ≈740bp fragment with a 3×Myc tag), they are then hybridized with Atp7b... + / - After 2-3 generations of crossbreeding in mice, "endogenous Atp7b" was finally obtained. - / - The target mice were modified with the human ATP7B mutant BAC. The gene structure of the ATP7B-BAC plasmid was also displayed, and the positions of the three mutation sites (R778L in exon 8, P992L in exon 13, and T935M in exon 12) were identified. Sequencing peak diagrams confirmed the accuracy of the base substitutions at the mutation sites.

[0020] Figure 3 (Schematic diagram of mutation sites in human and mouse ATP7B gene) Comparing the human (Query) and mouse (Sbjct) ATP7B protein sequences, the three mutation sites p.Arg778 (R778L), p.Pro992 (P992L), and p.Thr935 (T935M) are marked in red boxes, clearly showing the differences between human mutations and mouse sequences.

[0021] Figure 4 (BAC mouse genotyping primers) show the primer design positions at the Atp7b locus, annotate exons 19, 21, and 3×Myc tags, Neo CDS, and other elements, and provide Outer-F (GGCTCAGATGCTGTTGCGT) and Outer-R (CAGGCCAAGCCCAGCTGCA) primer sequences for genotyping, providing a basis for mouse genotyping.

[0022] Figure 5 (Sequencing results of F0 mice) The Sanger sequencing peak diagrams of humanized F0 generation BAC mice with three mutant types, R778L, P992L, and T935M, are shown. The mutation sites are marked by blue vertical lines, showing that the base substitutions of p.R778L (G→T), p.P992L (C→T), and p.T935M (C→T) are accurate, with no extraneous peaks or sequencing errors, proving that the F0 generation mice were successfully constructed.

[0023] Figure 6 (Subsequent mouse clone sequence analysis results) The Sanger sequencing peak diagrams of subsequent generations of humanized mice with R778L, P992L, and T935M mutant BAC are shown. The mutation sites are marked by blue vertical lines, which are consistent with the F0 generation sequencing results, proving that the mutation sites are stably inherited in subsequent generations without reversion mutations, and the genetic stability of the model is good.

[0024] Figure 7 Gross anatomy and staining of ATP7B-BAC humanized transgenic mice are shown. Liver morphology is displayed in groups by genotype and age: KO, WT, BAC-WT, R778L, P992L, and T935M; ages are 1, 3, and 5 months. Red arrows indicate lesions: KO mice showed nodule formation, reduced liver size, and cirrhosis with increasing age; BAC humanized mutant mice showed significantly milder liver lesions than KO mice, with only occasional small nodules observed in the R778L type at 5 months of age. Figure 8 (gross anatomy of the spleen) is grouped in the same way as Figure 7, showing the appearance of the spleen. Red arrows indicate lesions: the spleen of KO mice becomes enlarged and darkens in color with age; the spleen of BAC humanized mutant mice is close in size and color to WT and BAC-WT, with no obvious enlargement.

[0025] Figure 9 (liver staining of 1-month-old mice): From top to bottom, HE staining, Sirius red staining, and copper salt staining; genotypes from left to right: WT, KO, BAC-WT, R778L, P992L, and T935M. WT and BAC-WT mice showed normal liver lobule structure, uniform collagen fiber distribution, and minimal copper salt deposition; KO mice showed mild lobule structure disorder, mild collagen fiber enrichment, and increased copper salt deposition; BAC humanized mutant mice (R778L, P992L, T935M) showed milder liver tissue lesions than KO mice.

[0026] Figure 10 (liver staining of 3-month-old mice) shows the staining type and genotype grouping consistent with Figure 7. KO mice exhibited more severe lobular structural damage, significantly enriched collagen fibers (increased yellow areas), and markedly increased copper salt deposition (dense blue particles). Although BAC humanized mutant mice showed some unclear lobular structures, the degree of hepatocyte damage, collagen fiber enrichment, and copper salt deposition was less than that of KO mice. Red arrows indicate lesion areas with collagen fiber or copper salt deposition.

[0027] Figure 11 (Liver staining of 5-month-old mice) The staining type and genotype grouping are consistent with Figure 7. KO mice showed severe damage to the liver lobule structure, extensive enrichment of collagen fibers, and a large accumulation of copper salt deposits; the lesion severity in BAC humanized mutant mice was still significantly milder than that in KO mice, with red arrows indicating lesion areas of collagen fibers or copper salt deposits.

[0028] Figure 12 This study displays the mRNA and protein expression levels of copper transporter protein in ATP7B-BAC humanized transgenic mice. Section A (Western blot assay) shows the Western blot results of ATP7B protein in the livers of BAC-WT, R778L, P992L, and T935M mice, with GAPDH as an internal control. BAC-WT mice showed high ATP7B protein expression levels, while mutant mice exhibited significantly reduced protein levels, suggesting that the mutation affects protein expression or stability. B (Quantitative analysis of protein expression) bar chart shows the relative expression level of ATP7B protein in the liver of mice in each group (GAPDH normalized). The protein level of BAC-WT mice was significantly higher than that of KO mice, and the protein level of mutant mice was significantly lower than that of BAC-WT mice (*p<0.05, ***p<0.001); The C-bar chart (mRNA expression quantification analysis) shows the relative expression levels of ATP7B mRNA in the livers of mice in each group (GAPDH normalized). There were no significant differences in mRNA levels among the groups, suggesting that the mutation primarily affects the protein level rather than the transcriptional level. Figure 3D (Immunofluorescence staining) shows the immunofluorescence staining of ATP7B protein in the livers of WT, KO, BAC-WT, R778L, T935M, and P992L mice (red represents ATP7B, blue represents cell nuclei). BAC-WT mice show high fluorescence intensity, KO mice show almost no fluorescence, and mutant mice show fluorescence intensity between the two. Figure 3E (Immunohistochemical staining) shows the immunohistochemical staining of ATP7B protein in the livers of WT, KO, BAC-WT, R778L, T935M, and P992L mice. BAC-WT mice show deep staining, KO mice show light staining, and mutant mice show staining depth between the two.

[0029] Figure 13 (liver copper content) shows the liver copper content (μg / g dry weight) of mice in each group at 1, 3, and 5 months of age, and the line graph shows the trend of liver copper change with age. KO mice showed significantly increased liver copper, while BAC humanized mutant mice showed significantly lower liver copper than KO mice, suggesting that mutant ATP7B can partially restore copper metabolism.

[0030] Figure 14 (serum ALT levels) shows the serum alanine aminotransferase (ALT) levels of mice in each group at 1, 3, and 5 months of age, and the line graph shows the trend of ALT changes with age. KO mice showed significantly elevated ALT levels, while BAC humanized mutant mice showed significantly lower ALT levels than KO mice, indicating that mutant ATP7B can alleviate liver inflammation.

[0031] Figure 15 (serum AST levels) shows the serum aspartate aminotransferase (AST) levels of mice in 1-, 3-, and 5-month-old groups, and the line graph shows the trend of AST changes with age. The results are consistent with ALT, verifying the improvement of liver damage.

[0032] Figure 16 (Serium ALB Levels) shows the serum albumin (ALB) levels of mice in each group at 1, 3, and 5 months of age, and the line graph shows the trend of ALB changes with age. KO mice showed significantly lower ALB levels, while BAC humanized mutant mice showed significantly higher ALB levels than KO mice, suggesting recovery of liver synthetic function.

[0033] Figure 17 (serum TBIL levels) shows the serum total bilirubin (TBIL) levels of mice in 1-, 3-, and 5-month-old groups, and the line graph shows the trend of ALP changes with age. KO mice showed significantly elevated TBIL levels, while BAC humanized mutant mice showed significantly lower TBIL levels than KO mice, further validating the improvement in liver function.

[0034] Figure 18 (Brain Copper Content) shows the whole brain copper content of mice in each group at 1, 3, and 5 months of age, and the line graph shows the trend of brain copper change with age. KO mice had significantly higher brain copper content than WT and BAC-WT mice; BAC humanized mutant mice had significantly lower brain copper content than KO mice, but higher than WT mice, suggesting that mutant ATP7B can partially reduce brain copper deposition.

[0035] Figure 19 (Urinary Copper Content) shows the 24-hour urinary copper content of mice in 1-, 3-, and 5-month-old groups, and the line graph shows the trend of urinary copper content with age. KO mice had significantly lower urinary copper levels than WT and BAC-WT mice; BAC humanized mutant mice had significantly higher urinary copper levels than KO mice, but lower than WT mice, indicating that mutant ATP7B can partially restore renal copper excretion.

[0036] Figure 20 (fecal copper content) shows the 24-hour fecal copper content of mice in 1-, 3-, and 5-month-old groups, and the line graph shows the trend of fecal copper change with age. KO mice had significantly lower fecal copper levels than WT and BAC-WT mice; BAC humanized mutant mice had significantly higher fecal copper levels than KO mice, but lower than WT mice, suggesting that mutant ATP7B can partially restore intestinal copper excretion.

[0037] Figure 21 It showed wild type, ATP7BBAC+ATP7b - / - ATP7b - / - Behavioral experiments on 1-month-old mice with point mutations 778, 992, and 935.

[0039] Figure 22 It showed wild type, ATP7BBAC+ATP7b - / - ATP7b - / -Behavioral experiments were conducted on 2-month-old mice with point mutations 778, 992, and 935. (A) The open field test was used to quantify the time and total distance the mice spent in the center. (B) The Y-maze neoarm test was used to quantify the time and distance the mice spent in the neoarm. (C) The Y-maze spontaneous alternation test was used to quantify the rate of complete spontaneous alternation in the mice. (D) The robin test was used to quantify the time the mice spent on the robin. (E) The gripping force test was used to quantify the gripping force of the mice's forelimbs. (F) The weight of the mice was measured (n=6 per group). At 2 months of age, there were no significant differences in the behavioral results between 778, 992, and 935 mutant mice and WT wild-type mice. Statistical significance: Most indicators showed no statistically significant difference (ns), while the fall latency in the robin test showed a significant difference (marked by red arrows). Other indicators showed no significant differences between groups. Conclusion: At 2 months of age, WD mice showed behavioral differences only in the latency of the rotarod test; other phenotypes were not significantly different from wild-type. Behavioral abnormalities in WD have begun to appear but are not yet widespread.

[0040] Figure 23 It showed wild type, ATP7BBAC+ATP7b - / - ATP7b - / - Behavioral experiments were conducted on 3-month-old mice with point mutations 778, 992, and 935. (A) The open field test was used to quantify the time and total distance the mice traveled in the center. (B) The Y-maze neoarm test was used to quantify the time and distance the mice traveled in the neoarm. (C) The Y-maze spontaneous alternation test was used to quantify the rate of complete spontaneous alternation in the mice. (D) The rotarod test was used to quantify the time the mice spent on the rotarod. (E) The grip test was used to quantify the grip strength of the mice's forelimbs. (F) The weight of the mice was measured. (n=6 per group). Results analysis: Only the fall latency in the rotarod test showed a significant difference (marked by red arrows), while there were no statistically significant differences (ns) among the groups for the other indicators (open field, Y-maze, grip strength, and weight). Results analysis: Only the distance traveled in the neoarm of the Y-maze showed a significant difference (*p<0.05, marked by red arrows), while there were no statistically significant differences (ns) among the groups for the other indicators (open field, Y-maze time percentage, spontaneous alternation, rotarod, grip strength, and weight).

[0041] Conclusion: At 3 months of age, WD mice showed behavioral differences only in the distance of movement of the novel arm in the Y maze; the other phenotypes were not significantly different from those of wild-type mice. WD behavioral abnormalities were further manifested but remained relatively limited.

[0042] Figure 24 It showed wild type, ATP7BBAC+ATP7b - / - ATP7b - / -Behavioral experiments were conducted on 4-month-old mice with point mutations 778, 992, and 935. (A) The open field test was used to quantify the time and total distance the mice spent in the center of the maze. (B) The Y-maze neoarm test was used to quantify the time and distance the mice spent in the neoarm. (C) The Y-maze spontaneous alternation test was used to quantify the rate of complete spontaneous alternation in the mice. (D) The rotarod test was used to quantify the time the mice spent on the rotarod. (E) The gripping force test was used to quantify the gripping force of the mice's forelimbs. (F) The weight of the mice was measured. (n=6 per group). Results analysis: There were significant differences in total open field distance (**p<0.01), Y-maze neoarm distance (*p<0.05), and rotarod test fall latency (*p<0.05) (marked with red arrows). There were no statistically significant differences (ns) among the groups for the other indicators. Conclusion: At 4 months of age, WD mice showed significant differences in total open field distance, distance of novel arms in the Y maze, and rotarod latency, indicating that WD behavioral abnormalities began to appear in multiple dimensions.

[0043] Figure 25 It showed wild type, ATP7BBAC+ATP7b - / - ATP7b - / - Behavioral experiments were conducted on 5-month-old mice with point mutations 778, 992, and 935. (A) The open field test was used to quantify the time and total distance spent in the center of the field. (B) The Y-maze neo-arm test was used to quantify the time and distance spent in the neo-arm. (C) The Y-maze spontaneous alternation test was used to quantify the rate of complete spontaneous alternation. (D) The rotarod test was used to quantify the time spent on the rotarod. (E) The gripping force test was used to quantify the gripping force of the forelimbs. (F) The weight of the mice was measured. (n=6 per group). Results analysis: Significant differences were found in the proportion of time spent in the open field (*p<0.05), total distance (*p<0.05), Y-maze spontaneous alternation distance (*p<0.05), and gripping force test (***p<0.001) (marked with red arrows). There were no statistically significant differences (ns) among the groups for the other indicators. Conclusion: At 5 months of age, WD mice showed significant behavioral differences in open field activity, Y-maze spatial memory, grasping ability, and other aspects, indicating that WD behavioral abnormalities were already quite obvious.

[0044] Figure 26 It showed wild type, ATP7BBAC+ATP7b - / - ATP7b - / -Behavioral experiments were conducted on 6-month-old mice with point mutations 778, 992, and 935. (A) The open field test was used to quantify the time and total distance the mice spent in the center of the maze. (B) The Y-maze neoarm test was used to quantify the time and distance the mice spent in the neoarm. (C) The Y-maze spontaneous alternation test was used to quantify the rate of complete spontaneous alternation in the mice. (D) The robin test was used to quantify the time the mice spent on the robin. (E) The grip test was used to quantify the grip strength of the mice's forelimbs. (F) The weight of the mice was measured. (n=6 per group). Results analysis: There were significant differences in total open field distance (*p<0.05), Y-maze neoarm distance (*p<0.05), and robin test fall latency (*p<0.05) (marked with red arrows). There were no statistically significant differences (ns) among the groups for the other indicators. Conclusion: At 6 months of age, WD mice still showed significant differences in open field activity, Y-maze spatial exploration, and rotarod coordination, and WD behavioral abnormalities persisted at 6 months of age.

[0045] Figure 27 It showed wild type, ATP7BBAC+ATP7b - / - ATP7b - / - Time trend analysis of behavioral experiments in mice with point mutations 778, 992, and 935 (1-6 months of age). The results suggest that 5 months of age is a critical point in the progression of behavioral phenotypes in WD mice, at which time abnormalities in spontaneous activity and spatial memory are most pronounced. Detailed Implementation

[0046] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0047] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Every smaller range between any stated value or intermediate value within a stated range, and any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0048] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0049] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be obvious to those skilled in the art. This application specification and embodiments are merely exemplary.

[0050] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0051] Unless otherwise specified, "room temperature" and "normal temperature" in this invention refer to 25±2℃.

[0052] Unless otherwise specified, all raw materials or instruments used in the following embodiments of the present invention are commercially available.

[0053] ATP7B gene: Wilson's disease is caused by mutations in the ATP7B gene, which encodes copper-transporting P-type ATPase (ATP7B). ATP7B gene mutations are characterized by high-frequency mutations accompanied by widespread rare mutations, exhibiting distinct geographical and ethnic distribution patterns. ATP7B is a membrane protein expressed in multiple organs, its main function being to promote copper excretion via blood and bile.

[0054] When the ATP7B gene is mutated, the expression level and / or location of ATP7B in cells are altered, resulting in a decrease in its copper transport capacity. This leads to reduced synthesis of serum ceruloplasmin and obstruction of copper excretion through the bile ducts. Excessive copper accumulation in the body causes cell necrosis and organ damage, severely impacting the patient's quality of life in later stages and ultimately leading to death.

[0055] To date, more than 1,000 pathogenic variants of the ATP7B gene have been reported, distributed across the entire gene length. Therefore, the genotypes of patients with Wilson's disease are very complex, with most patients having compound heterozygous mutations (i.e., each chromosome carrying two different mutations). Different hotspot mutations also show population and regional differences. Among them, the most common mutation site in Asian populations is p.R778L (c.2333G>T).

[0056] High-frequency mutations in the ATP7B gene (p.R778L, p.P992L, p.T935M) - p.R778L: Located in exon 8 of the ATP7B gene, the base mutation c.2333G>T causes the amino acid to change from arginine (R) to leucine (L). It is the most common mutation in WD patients, with a carrier rate of up to 30%, and is prone to early onset and severe phenotype. - p.P992L: Located in exon 13, the base mutation c.2975C>T changes the amino acid from proline (P) to leucine (L), which is the second most frequent mutation in East Asian populations; - p.T935M: Located in exon 12, the base mutation c.2804C>T changes the amino acid from threonine (T) to methionine (M), which is the third most frequent mutation in East Asian populations; all three are single-base SNP mutations, accounting for 60%-70% of pathogenic mutations in WD patients.

[0057] In my country, Wilson's disease patients primarily exhibit three high-frequency pathogenic variants: p.R778L, p.P992L, and p.T935M, accounting for 60%-70% of all pathogenic variants. Therefore, patients clinically suspected of having Wilson's disease should first be screened for these pathogenic variants. Those without detected variants can proceed with screening for the full-length coding region of the ATP7B gene and its flanking sequences. The three high-frequency pathogenic variants, p.R778L, p.P992L, and p.T935M, are all single-base variants (SNPs). However, current products and technologies lack accurate and rapid mutation screening for high-mutation sites in the ATP7B gene associated with Wilson's disease.

[0058] ATP7B wild-type (WT) is completely healthy with normal copper metabolism; ATP7B - / - In mice (KO): In the early stages of copper accumulation (until 6–8 weeks after birth), morphological changes in the liver are minimal, and in some animals, liver histology appears normal. The only noticeable change is an increase in nuclear size, consistent with a prominent intracystic copper reservoir. At 12–15 weeks, the disease is always present and easily detectable. Histology shows hepatocyte swelling with nuclei, inflammation, necrosis, and bilateral ductal proliferation. By 20 weeks, fibrotic tissue and nodules of regenerating hepatocytes become prominent. In mice older than 9 months, most of the liver regenerates, while extensive atypical proliferation of bilateral ducts continues. In these proliferative areas, multilayered cells with high nucleus / cytoplasm ratios, high staining, and non-polarized cells are hallmarks of dysplasia and suggest possible carcinogenesis.

[0059] Liver copper content: There were statistically significant differences between KO and WT animals of all ages. Peak copper levels were detected at 5–6 weeks of age, with no significant change over the following 4 months. However, due to the reduction in copper in WT animals, excess copper compared to controls (KO:WT ratio) did indeed increase from 5–6 weeks of age. The number of mice increased 18-fold to 20 weeks of age. 37-fold. Subsequently, copper levels in KO and WT animals decreased by approximately 50%, but the difference between control and KO samples remained high. 12 to 18 times) and statistically significant ATP7B - / - There was no significant difference in brain copper content between mice and WT mice.

[0060] Bacterial artificial chromosomes (BACs) are widely used cloning vectors for cloning large DNA fragments. Due to their large capacity, BACs can carry human genes, are stably inherited in mice, and generally do not exhibit gene deletions, recombination, or chimerism. Furthermore, BAC mouse models readily exhibit neurological symptoms and have been applied in basic research on various neurodegenerative diseases. Therefore, this invention aims to prepare BAC transgenic mouse models expressing wild-type human ATP7B protein and BAC transgenic mouse models carrying human R778L, P992L, and T935M mutations, respectively. This invention aims to utilize wild-type BAC-ATP7B transgenic mice and Atp7b... - / - Mice were crossbred to create a mouse strain with wild-type BAC-ATP7B but with endogenous Atp7b knockout. The mechanism by which human ATP7B compensates for mouse deficiency was further explored, laying the groundwork for subsequent research on the mechanism by which high-frequency ATP7B causes neuronal damage in WD and providing a theoretical basis for finding potential therapeutic targets for refractory WD patients with neurological symptoms.

[0061] Atp7b gene knockout mice (Atp7b) - / - The ATP7B mouse, an animal model of WD with a cirrhotic phenotype, was invented in 1998 by Professor Svetlana Lutsenko's team at Johns Hopkins University. This mouse has a well-defined genetic background, and its creation involves inserting multiple stop codons into exon 2 to achieve gene knockout, ultimately resulting in the loss of function of the ATP7B protein. It is currently the most commonly used animal model for studying the pathogenesis of WD. However, Atp7B... - / -Currently, the mice only exhibit liver cirrhosis, with no obvious neurological symptoms. Existing research models suitable for studying neurological symptoms are lacking both domestically and internationally. Therefore, establishing mouse models of WD disease with neurological symptoms is both a key challenge and a crucial aspect of research in this field.

[0062] Figure 1 The process of preparing ATP7B-BAC humanized transgenic mice, including plasmid preparation, injection, mouse breeding, and hybridization screening, is shown.

[0063] Example 1: BAC plasmid preparation Figure 2 (BAC plasmid construction and technical roadmap) This section demonstrates the entire process of BAC plasmid modification, transgenic mouse preparation, and hybridization verification. To verify the BAC clone, PCR is performed on the insertion site to ensure sequence correctness; ligation sites should be verified by PCR if necessary. The same clone is plotted on kanamycin and chloramphenicol plates using the BAC clone stock solution to confirm the strain's sensitivity to Kan. One colony is inoculated into Cm medium. The fresh overnight bacterial suspension is refrigerated on ice, centrifuged, and resuspended to wash the suspension. 1 μl of pRedET plasmid is added to the bacterial suspension and transferred to an electroporation dish for electroporation at 2500 V. The electroporated bacteria are revived at 30°C and plated overnight. A single colony is used to prepare stock solution of glycerol for later use. The stock solution of glycerol carrying the pRedET BAC clone is revived. 10% L-arabinose is added to the experimental and control groups. The mixture is incubated at 37°C for 1 hour. Refrigerate on ice, centrifuge and resuspend the washed bacterial suspension. Add 300 ng of the insert fragment to the bacterial suspension and transfer to an electroporation dish. Electroporate at 2500 V. Resuscitate the electroporated bacteria at 37°C and plate overnight. Pick a single colony from the plate and incubate overnight at 37°C. PCR screening: select positive colonies using appropriate primers. Incubate the modified BAC obtained in the previous step overnight. Refrigerate the fresh overnight bacterial suspension on ice, centrifuge and resuspend the washed bacterial suspension. Add 1 μl of pFlpe plasmid to the bacterial suspension and transfer to an electroporation dish. Electroporate at 2500 V. Resuscitate the electroporated bacteria at 30°C and plate overnight. Incubate a single colony overnight at 30°C, then transfer the culture to 37°C and incubate for one hour before platering. Pick a single colony from the plate and incubate overnight at 37°C. PCR screening. BAC DNA was incubated on a 1% agarose pulsed-field gel at 16°C, 0.5×TBE, and 6V cm⁻¹. -1 The gel was run under pressure with initial and final switching times of 1 and 25 seconds, respectively, at a rotation angle of 120° for 24 hours. The gel was stained with ethidium bromide for 1 hour, followed by destaining in H₂O for 1 hour. Fragment size was determined by comparison with a marker.

[0064] Example 2: Preparation of ATP7B high-frequency mutant transgenic F0 generation mice 1.1 Preparation of experimental mice Two background mice were used to collect fertilized eggs for microinjection: FVB / N. Male mice, aged 3-6 months and from the same background, were housed individually, while female mice were housed in cages of 5. Surrogate mothers were ICR mice. Male ICR mice underwent ligation within the SPF barrier system at 6-8 weeks of age, while female ICR mice were ligated at 12-20 weeks. All experimental mice were SPF grade and had free access to food and water. The temperature in the housing was maintained at 22-24 °C, with a 12-hour / 12-hour light / dark cycle.

[0065] 1.2 Superovulation and Fertilized Egg Collection At approximately 2:00 PM, 3-4 weeks after the egg donation, female mice were injected with 10 IU of pregnant mare serum gonadotropin (PMSG), followed by 10 IU of human chorionic gonadotropin (HCG) 46-50 hours later. After HCG injection, the female mice were placed in cages with male mice that had been kept individually. The presence of follicles in the female mice was checked before 9:00 AM the following day. Female mice with follicles were removed and euthanized. Both oviducts were excised, rinsed in M2 embryo culture medium, and placed in a droplet of 15 mg / mL M2 hyaluronidase solution. The fertilized egg mass was released by puncturing the dilated portion of the oviduct with microforceps. After approximately 3 minutes, the digested cumulus cells were transferred to M2 microdroplets using an oral pipette and rinsed multiple times. Finally, the eggs were incubated at 37°C in a 5% CO2 incubator until ready for use.

[0066] 1.3 Embryo pronuclear microinjection Before each experiment, the prepared BAC DNA solution was injected into the microinjection needle using a micropipette tip. The oocyte holding needle and injection needle were then fixed to the micromanipulation arm. The culture dish containing the embryos was placed under the microscope. The positions of the oocyte holding needle and injection needle were adjusted, and fertilized eggs with clearly defined male and female pronuclei were selected. BAC DNA was injected into one of the pronuclei (injection was stopped when significant swelling of the nuclear membrane was observed). The injected oocytes were placed in M2 microdroplets and transferred to a 37 ℃, 5% CO2 incubator for half an hour before transfer.

[0067] 1.4 Embryo transfer after injection Weigh out sodium pentobarbital powder and prepare a 1% sodium pentobarbital anesthetic solution with sterile water. After thorough dissolution, filter through a 0.22 µmol / L Millipore filter for later use. For ICR receptors showing thrombus detection at 0.5 days (ICR females were housed with vasectomized males; thrombus detection was performed the following morning; ICR with thrombus detection was recorded as 0.5 days), administer anesthesia via intraperitoneal injection of 1% sodium pentobarbital at a dose of 40–50 mg / kg. Under a stereomicroscope, trim a small area of ​​hair on one side of the back. After disinfecting the skin with 75% alcohol, make a longitudinal incision on the back at the location of the last rib. Carefully grasp the fat pad with small forceps and pull out the ovary, fallopian tube, and uterus. Secure the fat pad with fat clamps and fix the ovary and fallopian tube. Locate the fimbriae of the fallopian tube under a dissecting microscope and make a small incision in the ovarian sac using Venus scissors, avoiding major blood vessels. Carefully aspirate 25-28 embryos injected that day using a transfer needle, insert it into the fimbriae of one fallopian tube, and blow the embryos in. Place the fat pad, ovary, and fallopian tube back into the abdominal cavity, and suture the muscles and skin.

[0068] 1.5 Genotyping Figure 3 (Schematic diagram of mutation sites in human and mouse ATP7B gene) Comparing the human (Query) and mouse (Sbjct) ATP7B protein sequences, the three mutation sites p.Arg778 (R778L), p.Pro992 (P992L), and p.Thr935 (T935M) are marked in red boxes, clearly showing the differences between human mutations and mouse sequences. Figure 4 (BAC mouse genotype identification primers) show the primer design location for the Atp7b locus in mice.

[0069] Genome extraction (1) Cut off 0.3 cm of the tail of a mouse about 15 days old and store it in a 1.5 ml Eppendorf tube. Extract the mouse genomic DNA as soon as possible. If not processed in time, store in a -20℃ freezer.

[0070] (2) Add 100 μl of Buffer L liquid to each EP tube containing a mouse tail (ensure the liquid submerges the tissue), then add 2 μl of proteinase K, mix thoroughly, and place in a water bath at 55°C for about 30 minutes.

[0071] (3) After the water bath, put the sample into a 95°C metal bath and incubate for 10 minutes to inactivate the protease. After the incubation, centrifuge at 12,000 rpm for 10 minutes.

[0072] (4) Use the supernatant as a PCR template. The digested supernatant can be stored at -20℃ for 3 months.

[0073] Example 3: Hybridization and Screening of ATP7B High-Frequency Mutant Target Model (1) Hybridization scheme: 12 F0 generation positive mice (6 males and 6 females) were hybridized with Atp7b. - / - Mice (kindly donated by Professor Lutsenko Svetlana of Johns Hopkins University, USA) were crossbred, with each F0 generation mouse being crossed with 2 Atp7b mice. - / - Mice were placed together in cages; (2) Identification of F1 generation mice: F1 generation mice were harvested 15 days after birth, and DNA was extracted from their tails. Triple PCR was used for identification (primers are shown in Table 1): - Endogenous Atp7b wild type (WT): primer ATP7B-WT-F / R, expected band 500bp; - Endogenous Atp7b knockout (KO): primer ATP7B-KO-F / R, expected band 800bp; - Human ATP7B mutant BAC: Myc tag primer, expected band 750bp; A total of 180 F1 generation mice were tested, of which 62 mice simultaneously contained KO and BAC bands (i.e., Atp7b). + / - (BAC+), indicating positive F1 generation mice; Figure 5 (F0 mouse sequencing results) shows the Sanger sequencing peak diagrams of three mutant BAC humanized F0 generation mice: R778L, P992L, and T935M.

[0074] (3) Backcrossing and F2 generation screening: 62 F1 generation positive mice were backcrossed with Atp7b - / - Mice were backcrossed to obtain F2 generation mice; F2 generation mice were identified by triple PCR 15 days after birth. - Target genotype: Contains only KO and BAC bands (Atp7b) - / - (BAC+), no WT stripes; A total of 45 F2 generation target model mice were obtained through screening (15 p.R778L type, 12 p.P992L type, and 18 p.T935M type). (4) Stability verification: F2 generation target model mice were self-crossed to obtain F3 generation mice; PCR was used to identify the genotype of F3 generation mice, and all mice maintained "Atp7b". - / - BAC + "Genotype and sequencing verification showed no reversion at the mutation sites, proving that the model can be stably inherited." Figure 6 (Subsequent mouse clone sequence analysis results) show the Sanger sequencing peaks of subsequent generations of humanized mice from the R778L, P992L, and T935M mutant BAC strains.

[0075] Table 1

[0076] Example 4: Liver Dissection of Transgenic Mice The Atp7b gene knockout mice used in this invention were kindly provided by Professor Svetlana Lutsenko of the United States. The genetic background of these mice is clear, and they are C57BL3129S6 / SvEv hybrid mice. The genotypes of the mice required for the experiment are Atp7b + / + (i.e., Wildtype, WT) and Atp7b− / − (i.e., Knockout, KO), both of which are bred from Atp7b+ / − parents. All experimental mice are of SPF grade and are housed in individually ventilated cages in the barrier facility of the Experimental Animal Center of Zhejiang University [SYXK (Zhe) 2018-0016], with free access to food and water. The temperature in the breeding room is 22-24 °C, with a 12 h / 12 h light-dark cycle. The animal experiment protocols involved in this study have been approved by the Experimental Animal Ethics Committee of Zhejiang University (approval number: ZJU20200140). Select target model mice at 45 days old (1 month old), 90 days old (3 months old), and 150 days old (5 months old) (5 mice of each mutant type), and at the same time set up control groups (Atp7b + / + 、Atp7b - / - 、ATP7B-WT BAC+Atp7b - / - , 5 mice per month); no special cultivation. After the mice are fasted for 12 h without water deprivation, they are anesthetized by intraperitoneal injection of 1% sodium pentobarbital at a dose of 45 mg / kg; the skin is cut along the midline of the abdomen, and the liver and spleen are successively exposed, and the organs are carefully separated with sterile surgical instruments to avoid mechanical damage; the blood stains on the surfaces of the liver and spleen are gently rinsed with PBS buffer, placed on a blue background board, and the appearance of the organs is photographed using a high-definition digital camera (Canon EOS90D) to record morphological characteristics such as size, color, and nodules.

[0077] (1) The sample collection processes for different types are slightly different: a. Liver samples: Anesthetized by intraperitoneal injection of 1% sodium pentobarbital at a dose of 45 mg / kg; cut open the abdominal skin to expose the liver, and after observing the appearance, cut a 1×1 cm liver tissue, rinse it 3 times with PBS, and place it in a 1.5 mL EP tube; b. Fecal samples: After collecting mouse feces in a metabolic cage for 24 hours, place all the mouse feces in a 50 ml centrifuge tube; c. Urine Samples: After collecting mouse urine in the metabolic cage for 24 hours, record the volume of liquid in the urine collector and pour it into a 15ml centrifuge tube. Store the tube at -80℃. Note: All solid samples must be left unsealed and placed in a 60℃ oven for at least 3 days to ensure complete drying and dehydration. After drying, weigh and record the dry weight, and store at room temperature.

[0078] (2) Sample digestion: Accurately weigh tissue and body fluid samples and place them in digestion vessels. Add 5 mL of nitric acid to each vessel to ensure that the sample is submerged. Tighten the digestion cap and place the vessel in a high-throughput closed high-pressure microwave digester for digestion.

[0079] (3) Sample preparation: Rinse the inner cap with 2 mL ddH2O, pour all the liquid into the container together, and wait until the liquid is clear and transparent. Then, quantitatively transfer the digestion solution to a centrifuge tube with water, weigh to 10 mL, and shake well. Prepare a test blank using the same method.

[0080] (4) Detection of samples by ICP-MS inductively coupled plasma mass spectrometry. All relevant copper and zinc element detection procedures in this experiment were completed by the Feed Research Institute Laboratory of the College of Animal Science, Zhejiang University, under the guidance of professional staff.

[0081] Perfusion sampling is a commonly used method for obtaining tissue samples in animal experiments, particularly suitable for histopathological research. During this process, the animal's vascular system is cleansed with perfusion fluid, ensuring that the tissue sample is not contaminated with blood, thereby improving the quality of tissue sections. The following are the basic steps of perfusion sampling in mice: Anesthesia: Before perfusion sampling, mice must be generalized anesthetized, usually using anesthetics such as isoflurane or sodium pentobarbital. Ensure the mice are completely unconscious to avoid unnecessary suffering.

[0082] Thoracotomy to expose the heart: The anesthetized mouse is fixed supine on the operating table, and the thoracic cavity is cut open to expose the heart, usually below the sternum.

[0083] Insertion of the perfusion needle: A needle is inserted into the left ventricle of the mouse, typically for fluid perfusion through the left ventricle, while a small incision is made in the right atrium as an outlet. This ensures that the perfusion fluid enters the arterial system and is drained through the venous system.

[0084] Saline perfusion: First, perfuse with pre-cooled saline (usually 0.9% sodium chloride solution) to cleanse the blood. Generally, a pump is used to deliver saline into the body at a constant pressure, flushing for about 5-10 minutes until the outflowing fluid is clear, indicating that the blood has been removed.

[0085] Fixative perfusion: After flushing with blood, perfusion is performed using 4% paraformaldehyde or other fixatives to fix the tissue. Fixatives can rapidly penetrate various organ tissues, preventing tissue degeneration and maintaining cell structure.

[0086] Tissue collection: After perfusion, the mice will die rapidly, and researchers can remove specific organs or tissues, such as the liver or brain, as needed for the research. The removed tissues can then be used for tissue sectioning, staining, or other experimental processing.

[0087] Tissue processing: The extracted tissue is typically further fixed, then dehydrated with graded ethanol, and embedded in paraffin or resin in preparation for subsequent pathological sections. This method ensures high-quality tissue samples, reduces blood interference, and helps obtain clear tissue structures and pathological features.

[0088] Figure 7 Gross anatomical diagram of the liver of a humanized Wilson's disease mouse is shown. Nodular cirrhosis is the most classic gross appearance of WD mice. After intervention, tissue sampling and dissection of the mice revealed some changes in the 3-month-old group: compared to ATP7B... + / + (WT) group of completely normal mouse livers, ATP7B - / - (KO) mice fed a standard diet developed significant liver cirrhosis at 3 months of age. In contrast, ATP7B... BAC +Atp7b - / - The mouse liver was of relatively normal size, with no significant reduction in size or obvious nodules. ATP7B BAC +Atp7b + / + The mouse livers also showed no obvious nodules or cirrhosis.

[0089] Liver morphology ( Figure 7 WT and BAC-WT mice: The livers of 1, 3, and 5-month-old mice were all reddish-brown, smooth, without nodules or abnormal volume, and the morphology did not show obvious pathological changes with age; KO mice: The livers of 1-month-old mice were slightly swollen and yellowish in color; the livers of 3-month-old mice shrank and small nodules appeared on the surface; the livers of 5-month-old mice shrank significantly, the nodules merged, and they showed typical signs of cirrhosis; BAC humanized mutant mice (R778L, P992L, T935M): The morphology of the livers of 1 and 3-month-old mice was not significantly different from that of WT and BAC-WT mice; at 5 months of age, small nodules (diameter <0.5mm) were occasionally seen in R778L mice, while the livers of P992L and T935M mice remained smooth and reddish, without obvious nodules.

[0090] In the 5-month-old group, ATP7B - / -(KO) The degree of cirrhosis is significantly more severe than at 3 months of age. The characteristics of cirrhosis shown in the figure include (i) smaller appearance: typical cirrhosis leads to a reduction in liver volume and size; (ii) nodular surface: typical cirrhosis causes nodular protrusions and depressions of varying sizes to appear on the surface of the liver; (iii) color change: cirrhosis causes the liver tissue to change from red to yellow or gray.

[0091] In comparison, 5-month-old ATP7B BAC +Atp7b - / - The mouse liver was of relatively normal size, without significant shrinkage or obvious nodules. BAC +Atp7b + / + The mouse livers also showed no obvious nodules or cirrhosis.

[0092] Spleen morphology ( Figure 8 WT and BAC-WT mice: At 1, 3, and 5 months of age, the spleen was of moderate size and dark red in color, with no obvious pathological changes in morphology as the age increased; KO mice: At 1 month of age, the spleen was slightly enlarged; at 3 months of age, the spleen was significantly enlarged and darkened in color; at 5 months of age, the spleen was enlarged to 2-3 times the normal size and hardened in texture; BAC humanized mutant mice (R778L, P992L, T935M): At 1, 3, and 5 months of age, the spleen size and color were close to those of WT and BAC-WT mice, with no obvious enlargement.

[0093] Figure 7-8 The results showed that ATP7B gene knockout induces liver cirrhosis and spleen enlargement in mice, while BAC humanized mice carrying high-frequency mutations in human ATP7B (R778L, P992L, T935M) significantly reduced pathological damage to the liver and spleen. This suggests that the human ATP7B mutant protein retains its copper metabolism regulatory function to some extent, providing morphological support for subsequent research on the pathogenesis of WD and drug intervention targets.

[0094] ATP7B-ko mice are an animal model of Wilson's disease (WD). Mutations in the ATP7B gene lead to impaired copper metabolism, causing copper to accumulate gradually and damage tissues and organs. Previous studies have shown that ATP7B-ko mice around 5 months of age exhibit a relatively typical disease phenotype. For example, in the liver, copper deposition and inflammation begin to appear at 6 weeks, followed by lobular and perihilar eosinophilic bodies and fibrosis at 20 weeks, significant liver lesions at 39 weeks, and progression to precision cirrhosis by 5 months of age, effectively mimicking the progression of liver disease in WD patients. Simultaneously, copper levels in the brain also gradually increase with age, and neurological symptoms may be more pronounced at 5 months of age, facilitating research on the relationship between neuropsychiatric symptoms and copper metabolic imbalance.

[0095] This aligns with the developmental stages of mice: Mice typically mature in various organs around 4-6 weeks, reach sexual maturity at 6-8 weeks, and enter adulthood at 3-6 months. Five-month-old mice are in adulthood, with relatively stable bodily functions. This avoids interference from the incomplete organ development of young mice and the potential impact of aging-related factors on experimental results, unlike older mice. Experiments conducted at this age allow for more accurate observation of specific phenotypes and pathological changes associated with ATP7B gene deletion.

[0096] The main reasons for choosing 5 months of age as the observation endpoint in ATP7B-ko mouse-related experiments are as follows: 1. Disease progression. In ATP7B-ko mice, copper gradually accumulates in the liver after birth, leading to pathological changes such as liver damage. By around 5 months of age, the pathological changes in the liver are relatively stable, and they can better mimic the liver disease characteristics of human Wilson's disease, such as liver fibrosis and hepatocyte degeneration, which is beneficial for research on the pathological mechanisms of the disease and intervention measures.

[0097] 2. Physiological maturity. By five months of age, the organ systems of mice are largely mature, and their physiological functions are relatively stable, allowing for a more accurate reflection of the effects of drugs or treatments on adult individuals. Their metabolic enzyme activities and pathways have also stabilized, contributing to more reliable metabolic data in research.

[0098] 3. Suitability to Research Objectives. For studies such as drug efficacy evaluation and gene therapy, the physiological and pathological states of 5-month-old mice can better reflect the improvement effect of treatment on existing lesions. When studying the physiological processes and pathological mechanisms related to copper metabolism, the characteristics of copper metabolism disorders in 5-month-old mice are already relatively obvious, making them easy to observe and analyze.

[0099] 4. Feasibility of experimental procedures. Five-month-old mice are of moderate size, facilitating various experimental procedures such as intravenous injection and tissue sampling. Their activity levels and behavioral patterns are relatively stable, which is beneficial for behavioral experiments and other research.

[0100] 5. Data stability and comparability. Individual differences among mice in this age group are relatively small, reducing experimental error and making the experimental data more stable and reliable. This facilitates comparisons with other age-matched models or control groups, making it easier to draw statistically significant conclusions.

[0101] Example 5: Liver staining of transgenic mice The Atp7b gene knockout mice used in this invention were kindly provided by Professor Svetlana Lutsenko of the United States. These mice have a clear genetic background and are C57BL3129S6 / SvEv hybrid mice. The required mouse genotype for the experiment is Atp7b.+ / + (i.e., Wildtype, WT) and Atp7b - / - (i.e., Knockout, KO), both of which were bred from the parental line of Atp7b + / - All experimental mice were of SPF grade and were housed in individually ventilated cages in the barrier facility of the Experimental Animal Center of the South Lake Institute of Brain-Machine Intersection [SYXK (Zhe) 2023-0050], with free access to food and water. The temperature in the housing room was 22-24 °C, and the light-dark cycle was 12 h / 12 h. The animal experimental protocols involved in the study have been approved by the Experimental Animal Ethics Committee of the South Lake Institute of Brain-Machine Intersection (approval number: 202404171112000409594).

[0102] Sacrifice the mice to obtain liver tissues: Place the mice in a metabolic cage, fast them for 12 hours without water deprivation to reduce the impact of intestinal contents on the liver. Weigh the mice and record the data. Calculate the dosage of pentobarbital sodium according to the body weight of the mice, draw pentobarbital sodium with a syringe for standby, fix the mice on the operating table, and inject pentobarbital sodium into the neck muscle of the mice with a syringe to anesthetize them. Cut open the abdominal skin of the mice, expose the abdominal wall muscles and internal organs, find the liver, and observe its size, color, and shape. Gently lift the liver with forceps and cut off the connection between the liver and the abdominal wall with scissors to remove the liver.

[0103] All experimental mice were of SPF grade and were housed in individually ventilated cages in the barrier facility of the Experimental Animal Center of Zhejiang University [SYXK (Zhe) 2018-0016], with free access to food and water. The temperature in the housing room was 22-24 °C, and the light-dark cycle was 12 h / 12 h. The animal experimental protocols involved in the study have been approved by the Experimental Animal Ethics Committee of Zhejiang University (approval number: ZJU20200140). Select target model mice at 45 days old (1 month old), 90 days old (3 months old), and 150 days old (5 months old) (5 mice of each mutant type), and set up control groups at the same time (Atp7b + / + 、Atp7b - / - 、ATP7B-WT BAC+Atp7b - / - , 5 mice per month); no special culture. After fasting the mice for 12 h without water deprivation, anesthetize them by intraperitoneal injection of 1% pentobarbital sodium at a dose of 45 mg / kg; cut open the skin along the midline of the abdomen, expose the liver, and carefully separate the organs with sterile surgical instruments to avoid mechanical damage; gently rinse the blood on the surfaces of the liver and spleen with PBS buffer and place them in 1.5 mL EP tubes.

[0104] Tissue sectioning and pathological staining procedures (1) Paraffin sectioning and dewaxing: After fresh sampling, the tissue was fixed, routinely embedded in paraffin, and sectioned. The thickness of the sections should be 3-8 μm. Then, the sections were dewaxed twice in xylene solution, 10 minutes each time. Then, the sections were rehydrated in a gradient of ethanol: 100% ethanol, 95% ethanol, 85% ethanol, and 75% ethanol were applied sequentially, 3 minutes each time, and then the sections were placed in ddH2O.

[0105] The staining steps vary slightly depending on the staining kit: a. HE staining: First, immerse in hematoxylin staining solution for 10 minutes, then rinse three times with ddH2O for 5 minutes each time. Next, immerse in eosin staining solution for 1 minute, pour off the excess staining solution, and proceed to the dehydration step; b. Sirius red staining: First, soak in hematoxylin staining solution for 10 minutes, then rinse three times with ddH2O for 5 minutes each time. Next, immerse in Sirius red staining solution for 15 minutes, then discard excess staining solution and proceed to the dehydration step. c. Erythrine staining: First, immerse in erythrine staining solution and stain in a 37°C water bath for 48 hours. Then rinse with 70% ethanol, rinse briefly with ddH2O, and blot dry. Next, immerse in nuclear solid red staining solution for 1 minute, pour off excess staining solution, and proceed to the dehydration step. (3) Gradient dehydration and mounting: The slide is sequentially immersed in 75% ethanol, 85% ethanol, 95% ethanol, and 100% ethanol (i) once each, for 2-3 seconds each time. Then it is immersed in 100% ethanol (ii) for 1 minute. Finally, it is immersed in xylene twice for 1 minute each time, and then mounted with neutral resin.

[0106] Figure 9 This shows ATP7B at 1 month old (1m). BAC +Atp7b - / - ATP7B BAC +Atp7b + / + ATP7B + / + (WT) and ATP7B - / - HE staining, Sirius red staining, and copper erythrine staining of (KO) mutant mice.

[0107] Figure 10 ATP7B was shown at 3 months of age (1m). BAC +Atp7b - / - ATP7B BAC +Atp7b + / + ATP7B + / + (WT) and ATP7B - / - (KO) mutant mice were stained with HE, Sirius red, and copper erythrine.

[0108] Figure 11 ATP7B was shown at 5 months of age (1m).BAC +Atp7b - / - ATP7B BAC +Atp7b + / + ATP7B + / + (WT) and ATP7B - / - HE staining, Sirius red staining, and copper erythrine staining of (KO) mutant mice.

[0109] Figure 9-11 The results showed liver staining in a humanized Wilson's disease mouse model. HE staining was performed to better demonstrate that zinc treatment slowed the progression of cirrhosis in the mice; therefore, pathological sections and special staining were also conducted. In HE staining, we could see the liver of the WT mice. The liver lobules are clearly structured, with intact cell morphology and regular arrangement. Figure 9-10 In contrast, the livers of untreated KO mice showed indistinct lobular structures and partial fusion, as seen in the image; cell swelling and rupture, with nuclear pyknosis and enlarged intercellular spaces, indicating damage, which was more pronounced in the 3m and 5m groups. ATP7BBAC + Atp7b - / - The mouse liver staining was relatively normal. Although slight inflammatory changes were observed, the lobular structure was relatively intact, and no obvious cell necrosis was observed.

[0110] Sirius red staining is a specific staining method targeting collagen fibers and can reflect the progression of liver cirrhosis. When the liver of a WD patient progresses to cirrhosis, collagen fibers are enriched and stained red against a yellow background. In this invention, knockout mice, compared with WT normal mice, showed significant collagen fiber deposition in the liver, with red enrichment in the field of view (blue arrows). ATP7B BAC +Atp7b - / - Although some collagen fibers were still present in the mouse liver, the overall red scintillation area and number were less than those in the untreated KO mice. Figure 4 C, D, E).

[0111] 1 month old ( Figure 9 ): WT and BAC-WT mice: HE staining showed clear liver lobule structure and neatly arranged hepatocytes; Sirius red staining showed uniform distribution of collagen fibers (few red areas); copper salt staining showed no obvious red granules, indicating very little copper deposition.

[0112] KO mice: HE staining showed mild disorganization of liver lobule structure; Sirius red staining showed mild enrichment of collagen fibers; copper salt staining showed scattered red granules, indicating the onset of abnormal copper metabolism. BAC humanized mutant mice (R778L, P992L, T935M): HE, Sirius red, and copper salt staining results were similar to WT and BAC-WT, with only very slight lobule structure disorganization or copper granules, and the degree of lesion was significantly milder than that of KO mice.

[0113] 3 months old ( Figure 10 ): WT and BAC-WT mice: No obvious pathological changes in liver histology.

[0114] KO mice: HE staining showed increased damage to liver lobule structure and hepatocyte swelling; Sirius red staining showed significant enrichment of collagen fibers (extensive red areas); copper salt staining showed dense red granules and significantly increased copper deposition.

[0115] BAC humanized mutant mice: Although HE staining showed some unclear lobular structures, Sirius red staining showed a small amount of collagen fiber enrichment, and copper salt staining showed scattered red particles, the overall lesion degree was much milder than that of KO mice. The red arrows indicate the lesion sites of collagen fiber or copper salt deposition.

[0116] 5 months old ( Figure 11 ): WT and BAC-WT mice: liver histological morphology remained normal.

[0117] KO mice: HE staining shows severe damage to the liver lobule structure and significant hepatocyte necrosis; Sirius red staining shows extensive collagen fiber deposition (severe liver fibrosis); copper salt staining shows a large accumulation of red granules, indicating a significant increase in copper deposition. BAC humanized mutant mice: HE staining shows indistinct lobule structure and hepatocyte damage; Sirius red staining shows collagen fiber enrichment; copper salt staining shows red granules, but the degree of lesions in all three groups is significantly milder than in KO mice. Red arrows indicate the lesion sites.

[0118] Conclusion: ATP7B gene knockout induces progressive destruction of liver lobule structure, aggravation of liver fibrosis, and abnormal accumulation of copper salts in mice from 1 to 5 months of age. However, BAC humanized mice carrying high-frequency mutations in human ATP7B can significantly delay the progression of liver pathological damage, indicating that the human mutant ATP7B protein retains, to some extent, the function of regulating liver structure and copper metabolism. This provides histological evidence for subsequent research on the pathogenesis of WD (such as the molecular mechanisms of fibrosis formation and copper deposition) and drug interventions (such as anti-fibrotic drugs and drugs that regulate copper metabolism).

[0119] Example 6: Detection of ATP7B protein and mRNA expression levels in WD mice To investigate the effects of ATP7B mutation on protein expression and transcription, the expression level of ATP7B in the liver of mice in each group was measured: Experimental materials grouping: WT, KO, BAC-WT, R778L, P992L, T935M mice (3 months old, 5 mice per group); Reagents: ATP7B antibody, GAPDH antibody, immunofluorescence secondary antibody, qPCR primers, etc. Figure 12 ).

[0120] Experimental methods: Western blotting: Total liver protein was extracted, incubated with antibody after SDS-PAGE electrophoresis, and then visualized by ECL. ImageJ was used to quantify the grayscale of the bands. qPCR: Liver RNA was extracted, and ATP7B mRNA was amplified after reverse transcription. The relative expression level was calculated by the 2^-ΔΔCt method. Immunofluorescence / histochemistry: Liver tissue sections were incubated with antibodies after antigen retrieval, and images were acquired under a microscope after fluorescence / color development.

[0121] Results analysis: Protein level: BAC-WT protein level was significantly higher than KO mouse, and mutant mouse protein level was significantly lower than BAC-WT mouse; mRNA level: There was no significant difference in mRNA level among the groups; Immunofluorescence / histochemistry: BAC-WT had the highest fluorescence intensity and staining depth, KO mouse had the lowest, and mutant mouse was in between.

[0122] Conclusion: The R778L, P992L, and T935M mutations in ATP7B mainly affect protein levels (expression or stability) and have no significant effect on transcription, providing a basis for the study of the molecular mechanism of WD.

[0123] Example 7: Liver copper content and serum liver function indicators in transgenic mice The Atp7b gene knockout mice used in this invention were kindly provided by Professor Svetlana Lutsenko of the United States. These mice have a clear genetic background and are C57BL3129S6 / SvEv hybrid mice. The required mouse genotype for the experiment is Atp7b. + / +(i.e., Wildtype, WT) and Atp7b− / − (i.e., Knockout, KO) mutant mice were all bred from Atp7b+ / − parents. All experimental mice were of SPF grade and were housed in individually ventilated cages in the barrier facility of the Experimental Animal Center of Zhejiang University [SYXK (Zhe) 2018 - 0016], with free access to food and water. The temperature in the breeding room was 22 - 24 °C, and the light - dark cycle was 12 h / 12 h. The animal experiment protocols involved in this study have been approved by the Animal Ethics Committee of Zhejiang University (approval number: ZJU20200140). Target model mice at 45 days old (1 - month - old), 90 days old (3 - month - old), and 150 days old (5 - month - old) (5 of each mutant type) were selected, and a control group (Atp7b + / + 、Atp7b - / - 、ATP7B - WT BAC+Atp7b - / - , 5 mice per month - old) was set up; no special culture was carried out. After the mice were fasted for 12 h without water deprivation, they were anesthetized by intraperitoneal injection of 1% sodium pentobarbital at a dose of 45 mg / kg; the skin was incised along the mid - abdominal line to expose the liver, and the organs were carefully separated using sterile surgical instruments to avoid mechanical damage; the bloodstains on the surfaces of the liver and spleen were gently rinsed with PBS buffer and placed in 1.5 mL EP tubes.

[0124] ATP7B - ko mice are an animal model of Wilson's disease (WD). Due to ATP7B gene mutation, copper metabolism disorders occur, copper gradually accumulates in the body, and tissue and organ damage is caused. Previous studies have shown that the disease phenotypes of ATP7B - ko mice around 5 - month - old are relatively typical. For example, in the liver, copper deposition and inflammation start from 6 weeks, eosinophilic bodies and fibrosis in the lobules and portal areas appear at 20 weeks, liver lesions are significant at 39 weeks, and it progresses to pre - cirrhosis at 50 weeks (about 5 - month - old), which can well simulate the process of liver lesions in WD patients.

[0125] In line with the growth and development stage: Generally, the organs of mice gradually mature at 4 - 6 weeks, reach sexual maturity at 6 - 8 weeks, and enter adulthood at 3 - 6 months2. 5 - month - old mice are in adulthood, and their physiological functions in all aspects are relatively stable. This not only avoids the interference of imperfect organ development in juvenile mice on experimental results but also does not, like old mice, be affected by other aging - related factors on experimental results. Conducting experiments at this time can more accurately observe specific phenotypes and pathological changes related to ATP7B gene deletion.

[0126] Liver tissue harvesting from sacrificial mice: Mice were placed in metabolic cages and fasted for 12 hours with free access to water to minimize the impact of intestinal contents on the liver. The mice were weighed and their weight recorded. The mice were anesthetized, and the dosage of sodium pentobarbital was calculated based on body weight. Sodium pentobarbital was drawn up using a syringe and used for later use. The mice were secured to the operating table, and sodium pentobarbital was injected into the neck muscles to anesthetize them. The abdominal skin was cut open to expose the abdominal wall muscles and internal organs, locating the liver. Its size, color, and shape were observed. The liver was gently lifted with forceps, and the connection between the liver and the abdominal wall was severed with scissors to remove the liver.

[0127] Microwave digestion of liver tissue (1) Weigh 200mg of liver tissue from different groups of mice, wash 3 times with PBS to remove surface blood as much as possible, dry, and place in a microwave digestion magnetron tube. Add 6m of ultrapure concentrated nitric acid. (2) Pre-digest at 130℃ for 30min, transfer to the microwave digestion system, set relevant parameters, increase to 300℃ in 10min, maintain for 5min, increase to 600℃ in 10min, maintain for 20min, and gradually decrease to 70℃. Transfer to a constant temperature metal bath and incubate at 150℃ for 1h. When the solution is clear and transparent, remove it and place it at room temperature. (3) Make up to 10mL with ultrapure water, centrifuge at 3000rpm / min for 5min, aspirate the supernatant and discard the precipitate.

[0128] ICP-MS copper content check (1) Correctly turn on the instrument power supply system, exhaust system and instrument argon gas. (2) Turn on the instrument switch, evacuate, confirm that the sample injection system is normal, place the sample injection tube in ultrapure water / 1% HNO; assemble the peristaltic pump tube, turn on the cooling water circulation machine (confirm that the water pressure is 45~65 psig and the temperature is 20℃), and the gas cylinder pressure is above 0.8. (3) Tuning, perform the daily optimization program, put the sample injection tube into the tuning solution and start the optimization operation. (4) Establish the determination method (external standard method), select an existing method or create a new method. Typical parameters are as follows: 1) Set the Timing tab under the Method interface to: Sweeps / Rcading20Reading / Replicatel Replicates 3; 2) Set the Cu element information in the Timing tab under the Method interface; 3) Analyze the sample using the external standard method. In the Calibration tab under the Method interface, set the following: Select External Std, all Curve Types, Linear ThruZero, and enter the actual concentrations in sequence. (5) Sample measurement: Analyze the sample using the external standard method.

[0129] Serum liver function indicators: ELISA kits were used to detect the levels of ALT, AST, ALB, TBIL, and ALP.

[0130] Figure 13(Liver copper content) The bar chart shows the liver copper content (μg / g dry weight) of mice in each group at 1, 3, and 5 months of age, while the line graph shows the trend of liver copper change with age. KO mice showed significantly increased liver copper, while BAC humanized mutant mice showed significantly lower liver copper than KO mice, suggesting that mutant ATP7B can partially restore copper metabolism.

[0131] Figure 14 (Serium ALT level) The bar chart shows the serum alanine aminotransferase (ALT) levels of mice in each group at 1, 3, and 5 months of age, while the line graph shows the trend of ALT changes with age. KO mice showed significantly elevated ALT levels, while BAC humanized mutant mice showed significantly lower ALT levels than KO mice, indicating that mutant ATP7B can alleviate liver inflammation.

[0132] Figure 15 (Serum AST level) The bar chart shows the serum aspartate aminotransferase (AST) levels of mice in each group at 1, 3, and 5 months of age, while the line graph shows the trend of AST changes with age. The results are consistent with ALT, verifying the improvement of liver damage.

[0133] Figure 16 (Serium ALB level) The bar chart shows the serum albumin (ALB) levels of mice in each group at 1, 3, and 5 months of age, while the line graph shows the trend of ALB changes with age. KO mice showed significantly lower ALB levels, while BAC humanized mutant mice showed significantly higher ALB levels than KO mice, suggesting recovery of liver synthetic function.

[0134] Figure 17 (Serum TBIL and ALP levels) The bar charts show the serum total bilirubin (TBIL) and alkaline phosphatase (ALP) levels in mice at 1, 3, and 5 months of age, while the line graphs show the ALP trend with age. KO mice showed significantly elevated TBIL levels, while BAC humanized mutant mice showed significantly lower TBIL levels than KO mice, further validating the improvement in liver function.

[0135] Results (unit: μg / g dry weight, data expressed as mean ± standard deviation):

[0136] Note: ***p<0.001 (vs Atp7b) + / + ); ###p<0.001 (vs Atp7b) - / - ) Results of copper content in mouse liver: In KO mice, liver copper content increased significantly with age. In BAC humanized mutant mice, liver copper content was significantly lower than that in KO mice, and the T935M type was close to the WT level. Serum indicators: In KO mice, ALT, AST, and TBIL increased significantly, while ALB decreased significantly. The above indicators in BAC humanized mutant mice were significantly better than those in KO mice. The decrease in ALT / AST in the P992L type was the most obvious, and the recovery of ALB in the T935M type was the best.

[0137] Conclusion: The liver copper content in the three mutant target model mice was significantly lower than that in Atp7b - / - mice and was close to that in Atp7b + / + and ATP7B-WT BAC+Atp7b - / - mice, demonstrating that the high-frequency mutant human ATP7B can restore copper metabolism function and reduce liver copper deposition. Among them, the p.T935M type had the best effect on the recovery of copper metabolism, and the p.R778L type was slightly weaker.

[0138] Example 8: Brain copper content in transgenic mice The Atp7b gene knockout mice used in this invention were kindly provided by Professor Svetlana Lutsenko from the United States. These mice have a clear genetic background and are C57BL3129S6 / SvEv hybrid mice. The genotypes of the mice required for the experiment are Atp7b + / + (i.e., Wildtype, WT) and Atp7b - / - (i.e., Knockout, KO), both of which were bred from Atp7b+ / - parents. All experimental mice were of SPF grade and were housed in individually ventilated cages in the barrier facility of the Experimental Animal Center of the South Lake Brain-Machine Interface Research Institute [SYXK(Zhe) 2023-0050], with free access to food and water. The temperature in the breeding room was 22-24 °C, with a 12 h / 12 h light-dark cycle. The animal experiment protocol involved in this study has been approved by the Experimental Animal Ethics Committee of the South Lake Brain-Machine Interface Research Institute (approval number: 202404171112000409594).

[0139] Brain tissue harvesting from sacrificial mice: Mice were placed in metabolic cages and fasted for 12 hours with free access to water to minimize the impact of intestinal contents on the liver. The mice were weighed and their weight recorded. The mice were anesthetized, and the dosage of sodium pentobarbital was calculated based on body weight. Sodium pentobarbital was drawn up using a syringe and used for later use. The mice were secured to the operating table, and sodium pentobarbital was injected into the neck muscles to anesthetize them. The neck was cut with tissue scissors, ensuring the cut point was behind the skull. The scalp was gently pulled to both sides, and a razor blade was used to make an incision along the midline between the mouse's eyes. One end of fine scissors was inserted into the foramen magnum, and the scalp was cut laterally. The same procedure was performed on the other side. Starting from the midline incision near the eyes, small incisions were made laterally. Using forceps, the skull flap on either side was lifted towards the sagittal suture. This step was repeated to process the remaining side. The brain was transferred to a culture dish and placed in PBS solution of a concentration appropriate for the tissue osmotic pressure.

[0140] Microwave digestion of brain tissue (1) Weigh 200mg of mouse brain tissue from different groups, wash 3 times with PBS to remove surface blood as much as possible, dry, and put into a microwave digestion magnetron. Add 6m of ultrapure concentrated nitric acid. (2) Pre-digest at 130℃ for 30min, transfer to microwave digestion system, set relevant parameters, increase to 300℃ in 10min, maintain for 5min, increase to 600℃ in 10min, maintain for 20min, and gradually decrease to 70℃. Transfer to constant temperature metal bath, incubate at 150℃ for 1h, and remove when the solution is clear and transparent, and place at room temperature. (3) Make up to 10mL with ultrapure water, centrifuge at 3000rpm / min for 5min, aspirate the supernatant and discard the precipitate. 13. ICP-MS check of copper content (1) Correctly turn on the instrument power supply system, exhaust system and instrument argon gas. (2) Turn on the instrument switch, evacuate the vacuum, confirm that the sample injection system is normal, place the sample injection tube in ultrapure water / 1% HNO; assemble the peristaltic pump tube, turn on the cooling circulating water machine (confirm that the water pressure is 45~65psig and the temperature is 20℃), and the gas cylinder pressure is above 0.8. (3) Tuning, perform the daily optimization program, put the sample injection tube into the tuning solution, and start the optimization operation. (4) Establish the determination method (external standard method), select an existing method or create a new method. Typical parameters are as follows: 1) In the Timing tab under the Method interface, set: Sweeps / Rcading20Reading / Replicatel Replicates 3; 2) In the Timing tab under the Method interface, set the Cu element information; 3) Analyze the sample using the external standard method, in the Calibration tab under the Method interface, set as follows: select External Std, all Curve Type Linear ThruZero, and enter the actual concentration in sequence. (5) Sample measurement: Analyze the sample using the external standard method.

[0141] Figure 18 Shows the brain copper content of humanized Wilson's disease mice. The bar chart shows the total brain copper content of mice in each group at 1, 3, and 5 months of age, and the line chart shows the trend of brain copper changing with age. The brain copper in KO mice is significantly higher than that in WT and BAC-WT mice; the brain copper in BAC humanized mutant mice is significantly lower than that in KO mice but higher than that in WT mice, suggesting that mutant ATP7B can partially reduce brain copper deposition. We found that there was no significant difference in brain copper between WT and KO mice at 1m, 3m, and 5m, and only the brain copper in ko mice in the 5m group was higher than that in the ATP7B of the 5m group BAC +Atp7b - / - Brain copper value of mice (p = 0.0270).

[0142] Example 6: Urinary copper content of transgenic mice The Atp7b gene knockout mice used in this invention were generously donated by Professor Svetlana Lutsenko of the United States. The genetic background of these mice is clear, and they are C57BL3129S6 / SvEv hybrid mice. The genotypes of the mice required for the experiment are Atp7b + / + (i.e., Wildtype, WT) and Atp7b− / − (i.e., Knockout, KO), both of which are bred from Atp7b+ / − parents. All experimental mice are of SPF grade and are housed in individually ventilated cages in the barrier facility of the Experimental Animal Center of the South Lake Brain-Machine Interface Research Institute [SYXK(Zhe) 2023-0050], with free access to food and water. The temperature in the breeding room is 22 - 24 °C, with a 12 h / 12 h light-dark cycle. The animal experiment protocols involved in this study have been approved by the Experimental Animal Ethics Committee of the South Lake Brain-Machine Interface Research Institute (approval number: 202404171112000409594).

[0143] Urine sample collection: At 1, 3, and 5 months of age of the mice, single mice were placed in a metabolic cage. After collecting the urine of the mice for 24 hours, the volume of the liquid in the urine collector in the device was recorded and poured into a 15 ml centrifuge tube, and then stored temporarily in a -80 °C refrigerator.

[0144] Urine sample processing: (1) Sample digestion: Accurately weigh the body fluid sample and place it in a digestion tank. Add 5 mL of nitric acid to each tank to ensure that the sample is submerged, tighten the digestion lid, and place it in a high-throughput closed high-pressure microwave digestion instrument for digestion. (2) Sample preparation: Rinse the inner lid with 2 mL of ddH2O, pour all the liquid into the tank together, and wait until the liquid becomes clear and transparent. Then quantitatively transfer the digestion solution to a centrifuge tube with water, weigh it to 10 mL, and shake well. Prepare the test blank in the same way. (3) Detect the sample on an ICP-MS inductively coupled plasma mass spectrometer.

[0145] ICP-MS Copper Content Check Operation (1) Correctly turn on the instrument power supply system, exhaust system and instrument argon gas. (2) Turn on the instrument switch, evacuate, confirm that the sample injection system is normal, place the sample injection tube in ultrapure water / 1% HNO3, assemble the peristaltic pump tube, turn on the cooling water circulation machine (confirm that the water pressure is 45~65 psig and the temperature is 20℃), and the gas cylinder pressure is above 0.8. (3) Tuning, perform the daily optimization program, put the sample injection tube into the tuning solution, and start the optimization operation. (4) Establish the determination method (external standard method), select an existing method or create a new method. Typical parameters are as follows: 1) Set the Timing tab under the Method interface to: Sweeps / Rcading20Reading / Replicatel Replicates 3; 2) Set the Cu element information in the Timing tab under the Method interface; 3) Analyze the sample using the external standard method. In the Calibration tab under the Method interface, set the following: Select External Std, all Curve Types, Linear ThruZero, and enter the actual concentrations in sequence. (5) Sample measurement: Analyze the sample using the external standard method.

[0146] Figure 19 (Urinary copper content) The bar chart shows the 24-hour urinary copper content of mice in 1-, 3-, and 5-month-old groups, and the line graph shows the trend of urinary copper content with age. KO mice had significantly higher urinary copper content than WT and BAC-WT mice; BAC humanized mutant mice had significantly lower urinary copper content than KO mice, but higher than WT mice, indicating that mutant ATP7B can partially restore renal copper excretion (p<0.001, p<0.01). Figure 19 The results showed that urinary copper levels in BAC humanized mutant mice were significantly higher than those in WT and BAC-WT mice, but slightly lower than those in KO mice. Urinary copper levels in R778L and P992L mutants were slightly higher than those in T935M mutants.

[0147] Example 7: Copper content in the feces of transgenic mice The Atp7b gene knockout mice used in this invention were kindly provided by Professor Svetlana Lutsenko of the United States. These mice have a clear genetic background and are C57BL3129S6 / SvEv hybrid mice. The required mouse genotype for the experiment is Atp7b. + / +(i.e., Wildtype, WT) and Atp7b− / − (i.e., Knockout, KO) were both bred from Atp7b+ / − parents. All experimental mice were of SPF grade and were housed in individually ventilated cages in the barrier facility of the Experimental Animal Center of the South Lake Brain-Machine Intersection Research Institute [SYXK(Zhe) 2023-0050], with free access to food and water. The temperature in the animal house was 22-24 °C, with a 12 h / 12 h light-dark cycle. The animal experiment protocols involved in this study have been approved by the Animal Ethics Committee of the South Lake Brain-Machine Intersection Research Institute (approval number: 202404171112000409594).

[0148] Fecal sample collection: At 1, 3, and 5 months of age, single mice were placed in metabolic cages, and after collecting mouse feces for 24 hours, all mouse feces were placed in 50 ml centrifuge tubes. For all solid samples, the lids need to be opened and placed in a 60 °C constant temperature drying oven for 3 days or more to ensure complete drying and dehydration. After drying, weigh and record the dry weight, and store at room temperature.

[0149] Fecal sample processing: (1) Sample digestion: Accurately weigh the fecal sample and place it in a digestion tank. Add 5 mL of nitric acid to each tank to ensure that the sample is submerged, tighten the digestion lid, and place it in a high-throughput closed high-pressure microwave digestion instrument for digestion. (2) Prepare the sample: Rinse the inner lid with 2 mL of ddH2O, pour all the liquid into the tank, and wait until the liquid is clear and transparent. Then quantitatively transfer the digested solution to a centrifuge tube with water to a volume of 10 mL, shake well. Prepare the test blank in the same way. (3) Detect the sample on an ICP-MS inductively coupled plasma mass spectrometer.

[0150] ICP-MS Copper Content Check Operation (1) Correctly turn on the instrument power supply system, exhaust system and instrument argon gas. (2) Turn on the instrument switch, evacuate, confirm that the sample injection system is normal, place the sample injection tube in ultrapure water / 1% HNO3, assemble the peristaltic pump tube, turn on the cooling water circulation machine (confirm that the water pressure is 45~65 psig and the temperature is 20℃), and the gas cylinder pressure is above 0.8. (3) Tuning, perform the daily optimization program, put the sample injection tube into the tuning solution, and start the optimization operation. (4) Establish the determination method (external standard method), select an existing method or create a new method. Typical parameters are as follows: 1) Set the Timing tab under the Method interface to: Sweeps / Rcading20Reading / Replicatel Replicates 3; 2) Set the Cu element information in the Timing tab under the Method interface; 3) Analyze the sample using the external standard method. In the Calibration tab under the Method interface, set the following: Select External Std, all Curve Types, Linear ThruZero, and enter the actual concentrations in sequence. (5) Sample measurement: Analyze the sample using the external standard method.

[0151] Figure 20 (fecal copper content) shows the 24-hour fecal copper content of mice in 1-, 3-, and 5-month-old groups, and the line graph shows the trend of fecal copper content with age. There was no significant difference in fecal copper content between KO mice and WT and BAC-WT mice; the change with mouse age was not significant.

[0152] Example 8: Systematic study of behavioral phenotypes in transgenic mice To systematically investigate the evolution of behavioral phenotypes and genotypic differences in Wilson's disease (WD) mice with different ages, this embodiment comprehensively tested mice of different ages and genotypes through multidimensional behavioral experiments.

[0153] 1 Experimental Design Mice were grouped into four groups: wild-type (WT), BAC wild-type (BAC-WT), ATP7B knockout (KO), R778L mutant (778), P992L mutant (992), and T935M mutant (935). Experiments were conducted at 1, 2, 3, 4, 5, and 6 months of age, with 6 male mice in each group (n=6). Experiments included: open field test, Y-maze neoarm test, Y-maze spontaneous alternation test, rotarod test, grasping test, and body weight measurement, to comprehensively assess the mice's spontaneous activity, spatial memory, motor coordination, muscle function, and growth status.

[0154] 2 Experimental Methods 2.1 Open field test: Mice were placed in an open field box measuring 40cm×40cm×40cm and allowed to move freely for 5 minutes. The percentage of time spent in the central area and the total distance moved were recorded using video tracking software (such as EthoVision XT) to assess the mice's anxiety-like behavior and ability to move independently.

[0155] 2.2 Y-maze experiment Novel Arm Experiment: Mice freely explored the three arms of a Y-maze (each arm 40cm long, 10cm wide, and 20cm high) for 8 minutes. The percentage of time spent in the novel arm and the percentage of distance traveled in the novel arm were recorded to assess spatial exploration and response to novel stimuli. Spontaneous Alternation Experiment: Mice entered the sequence of the three arms consecutively. The spontaneous alternation rate (number of complete alternations / total number of entries × 100%) and the distance traveled in the novel arm were calculated to assess spatial working memory.

[0156] 2.3 Rotating bar experiment A rotating bar apparatus with increasing rotation speed (initial speed 5 rpm, increasing by 5 rpm every 30 seconds) was used to record the fall latency of mice on the rotating bar and to assess their motor coordination and balance.

[0157] 2.4 Grasp Force Experiment The maximum gripping force of the forelimbs of mice was measured using a forelimb gripping force meter to assess muscle strength and motor function.

[0158] 2.5 Weight Measurement The mice were weighed monthly using an electronic balance, and their growth status was recorded.

[0159] 3 Results Analysis 3.1 1-month-old mice ( Figure 21 Most behavioral indicators showed no statistically significant differences (ns), except for the "center time percentage" in the open field test, which showed a significant difference (p < 0.05). Other indicators (total distance, Y-maze items, rotarod, grip strength, and weight) showed no significant differences between groups. This suggests that WD-related behavioral abnormalities were not yet clearly present at 1 month of age.

[0160] 3.2 Two-month-old mice ( Figure 22 The rotarod test showed a significant difference in "fall latency" (marked by red arrows), while there were no statistically significant differences (ns) in other indicators (open field, Y-maze, grip strength, and body weight) between groups. This indicates that mild abnormalities in motor coordination began to appear in WD mice at 2 months of age.

[0161] 3.3 3-month-old mice ( Figure 23In the Y-maze novel arm experiment, the "distance traveled" showed a significant difference (p < 0.05) (marked by red arrows). Other indicators (open field, Y-maze time percentage, spontaneous alternation, rotarod, grip strength, and body weight) showed no statistically significant differences (ns) between groups. This indicates that differences in spatial exploration behavior began to appear in WD mice at 3 months of age.

[0162] 3.4 Four-month-old mice ( Figure 24 Significant differences were observed in the total distance in the open field (**p<0.01), the distance of the novel Y-maze arm (*p<0.05), and the fall latency of the rotundus (*p<0.05) (marked by red arrows). No statistically significant differences were found among the other groups (ns). This suggests that WD mice at 4 months of age exhibited abnormalities in multiple dimensions of spontaneous activity, spatial exploration, and motor coordination.

[0163] 3.5 5-month-old mice ( Figure 25 Significant differences were observed in the open field "center time percentage" (*p<0.05), "total distance" (*p<0.05), spontaneous alternation "distance" in the Y-maze (*p<0.05), and grip strength test (***p<0.001) (marked by red arrows). No statistically significant differences were found among the other groups (ns). This indicates that 5-month-old WD mice exhibited significant abnormalities in anxiety-like behavior, spontaneous activity, spatial memory, and muscle strength.

[0164] 3.6 Six-month-old mice ( Figure 26 Significant differences were observed in open field "total distance" (*p<0.05), Y-maze neo-arm "distance" (*p<0.05), and rotarod "fall latency" (*p<0.05) (marked by red arrows), while no statistically significant differences were found among the groups for the other indicators (ns). This indicates that behavioral abnormalities persisted in WD mice at 6 months of age.

[0165] 3.7 Time Trend Analysis (1-6 Months) Figure 27 Significant differences were observed in open field movement distance (5 months, *p<0.05) and spontaneous alternating movement distance in the Y-maze (5 months, **p<0.01, ***p<0.001) (marked with boxes), while no differences were observed at other ages (ns). This suggests that 5 months of age is a critical time point for the development of behavioral phenotypes in WD mice, at which time abnormalities in spontaneous activity and spatial memory are most pronounced.

[0166] 4. Conclusion This invention, through systematic behavioral experiments, reveals that behavioral abnormalities in WD mice are age-dependent, gradually appearing from 2 months of age, and significantly manifesting in multiple dimensions such as anxiety-like behavior, spontaneous activity, spatial memory, and muscle strength at 5 months of age. Furthermore, behavioral phenotypes differ among different genotypes (R778L, P992L, T935M). This result provides experimental evidence for research on the neurobehavioral mechanisms of WD and for exploring the time window for therapeutic intervention.

[0167] The experimental results of this invention show that: I. Summary of Experimental Results 1. Pathological phenotypes of the liver and spleen Gross dissection (Fig. 7-8) and tissue staining experiments showed that ATP7B knockout (KO) mice developed significant liver cirrhosis (hepatic nodule formation and volume reduction) and splenomegaly with increasing age; while BAC humanized mutant mice carrying East Asian high-frequency mutations (p.R778L, p.P992L, p.T935M) had fewer liver nodules and no splenomegaly, with significantly milder pathological damage than KO mice, demonstrating that the model can morphologically alleviate liver and spleen lesions in WD.

[0168] 2. Copper metabolism and liver function Liver copper and liver function indicators ( Figures 13-17 ): KO mice showed significantly increased liver copper content, elevated serum ALT, AST, and TBIL levels, and decreased ALB levels; BAC humanized mutant mice showed decreased liver copper content and significantly improved liver function indicators (ALT, AST, TBIL, ALB), indicating that the model can restore liver copper metabolism balance and function.

[0169] Systemic copper metabolism ( Figures 18-20 ): KO mice showed reduced brain copper accumulation and urinary copper excretion; BAC humanized mutant mice showed reduced brain copper and increased urinary copper excretion, indicating that the model can improve systemic copper metabolism disorders and reduce abnormal copper deposition in the brain.

[0170] 3. Neurobehavioral phenotypes Behavioral experiments ( Figures 21-27 The results showed that after 5 months of age, BAC humanized mutant mice exhibited significant behavioral abnormalities in the open field test (reduced spontaneous activity), Y maze test (impaired spatial memory), and rotarod test (decreased motor coordination), mimicking the neurological symptoms of WD patients; while there were no significant differences between 1-4 months of age, suggesting that the neurological phenotype of the model is age-dependent, consistent with the late-onset characteristics of neurological symptoms in human WD.

[0171] 4. Molecular mechanism level Protein and mRNA expression experiments ( Figure 12The results showed that the level of ATP7B protein in the liver of BAC humanized mutant mice was significantly reduced, but the mRNA level was not different. This suggests that the p.R778L, p.P992L, and p.T935M mutations mainly affect the stability of ATP7B protein (rather than the transcriptional level), providing a direct basis for elucidating the molecular pathogenic mechanism of WD.

[0172] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A method for constructing a transgenic mouse model expressing human ATP7B and its high-frequency mutants, characterized in that, Includes the following steps: S1. The three additional genes UTP14C, ALG11, and NEK5 of the BAC plasmid were knocked out, and the ATP7B-BAC plasmid was transformed into E. coli to obtain a BAC strain. Subsequently, recombination was performed in this strain using pRedET and pFlpe plasmids to introduce a 3×Myc tag to obtain wild-type ATP7B-BAC DNA. Using CRISPR / Cas9 combined with single-stranded DNA-mediated base editing technology, the wild-type ATP7B-BAC DNA was modified with p.R778L, p.P992L, and p.T935M bases, respectively. After screening, label excision, and sequencing verification, four types of ATP7B-BAC DNA were obtained. Then, the mutant ATP7B-BAC DNA obtained by NotI restriction enzyme digestion was purified by dialysis. S2. The purified mutant ATP7B-BAC DNA was introduced into the fertilized eggs of donor mice via microinjection, and then transplanted into surrogate mother mice to develop and give birth to F0 generation mice. Transgenic positive F0 generation mice were then screened. S3. The obtained transgenic positive F0 generation mice were then compared with Atp7b. - / - Mice were crossbred to obtain F1 generation mice; the F1 generation mice were then crossbred again with Atp7b - / - Mice were backcrossed for 2 to 3 generations. After each generation of crosses, the offspring mice were genotyped and screened for mice with the genotype of endogenous Atp7b homozygous knockout and integration of human ATP7B mutant BAC, which are transgenic mice expressing human ATP7B high-frequency mutants.

2. The construction method according to claim 1, characterized in that, In S1, p.R778L is located in the 8th exon of the ATP7B gene. The base mutation c.2333G>T results in the amino acid change from arginine to leucine. p.P992L is located in exon 13. The base mutation c.2975C>T changes the amino acid from proline to leucine. It is the second most frequent mutation in East Asian populations. p.T935M is located in exon 12, with a base mutation c.2804C>T, changing the amino acid from threonine to methionine.

3. The construction method according to claim 1, characterized in that, The single-stranded DNA sequence for CRISPR / Cas9 base editing in S1 is designed for each mutation site to ensure that only the target bases are replaced and there are no other random mutations. Sequencing verification uses Sanger sequencing, covering the full-length coding region of the ATP7B gene and 200 bp upstream and downstream of the mutation site.

4. The construction method according to claim 1, characterized in that, The four types of ATP7B-BAC DNA in S1 are: ATP7B-BAC DNA without base modification, ATP7B-BAC DNA modified with p.R778L base, ATP7B-BAC DNA modified with p.P992L base, and ATP7B-BAC DNA modified with p.T935M base.

5. The construction method according to claim 1, characterized in that, The concentration of purified mutant ATP7B-BAC DNA in S1 is ≥50 ng / μL.

6. The construction method according to claim 1, characterized in that, The donor mice in S2 are SPF-grade Fvb mice.

7. The construction method according to claim 1, characterized in that, In S2, microinjection involves injecting a DNA solution into the male pronucleus of the fertilized egg.

8. The construction method according to claim 1, characterized in that, Atp7b in S3 - / - The mice were endogenous Atp7b gene knockout mice.

9. The application of the transgenic mouse model obtained by the construction method according to any one of claims 1-8 in the study of the pathogenesis of Wilson's disease (WD), characterized in that, This study aims to investigate the effects of high-frequency WD mutations p.R778L, p.P992L, and p.T935M on copper metabolism in East Asian populations, and the pathogenesis of extrapyramidal symptoms of WD neurological symptoms.

10. The application of the transgenic mouse model obtained by the construction method according to any one of claims 1-8 in the screening and evaluation of WD therapeutic drugs, characterized in that, This study aims to evaluate the effects of targeted drugs against high-frequency mutations in human ATP7B on liver damage and neurological function.

Images