Phpepd mutant and application thereof in fermentative production of l-carnosine
By screening and expressing the PhPepD mutant N158D/I176F/E393Q, the problem of insufficient PepD enzyme activity in microbial fermentation was solved, significantly increasing the yield of L-carnosine and laying the foundation for its industrial production.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-09-30
- Publication Date
- 2026-03-17
AI Technical Summary
In the existing microbial fermentation method for synthesizing L-carnosine, insufficient PepD enzyme activity leads to low yield, and the selection of mutation sites is difficult, which affects the industrial production of L-carnosine.
Homology analysis was used to identify PepD enzymes from different sources, and error-prone PCR mutant libraries were constructed. PhPepD mutants N158D/I176F/E393Q were screened out and expressed in recombinant microorganisms. Combined with exogenous expression of the panD gene, L-carnosine production was increased.
Without the need for the addition of β-alanine, L-carnosine production increased by 74.26%, providing favorable conditions for industrial production.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] This invention relates to the field of microbial technology, and more specifically, to a PhPepD mutant and its application in the fermentation production of L-carnosine. Background Technology
[0002] L-Carnosine is a dipeptide composed of β-alanine and L-histidine, naturally occurring in the muscles, brain, heart, and other tissues of humans and animals. L-Carnosine possesses antioxidant, anti-glycation, and anti-inflammatory properties and has wide applications in pharmaceuticals, food, and cosmetics. Microbial fermentation for L-carnosine preparation offers advantages such as low cost, mild conditions, high efficiency, and environmental friendliness. Increasing fermentation yield is beneficial for promoting large-scale industrial production of L-carnosine. The synthesis of L-carnosine via microbial fermentation in *E. coli* involves the synthesis of L-histidine and L-aspartic acid from glucose, followed by the further processing of L-aspartic acid... pledge The gene-encoded aspartate-α-decarboxylase catalyzes the production of β-alanine, and L-histidine and β-alanine are then... pepD Gene-encoded dipeptidase catalyzes the production of L-carnosine.
[0003] Currently, insufficient PepD activity is the main bottleneck for increasing L-carnosine yield in the process of synthesizing L-carnosine by microbial fermentation. The number of PepDs characterized in the literature is limited, and the yield of L-carnosine synthesized by microbial fermentation is low. Therefore, exploring PepDs with higher activity or enhancing PepD activity through enzyme mutation may be expected to improve L-carnosine yield.
[0004] During enzyme mutation, saturation mutations at key sites can generate a set of mutants that significantly affect enzyme performance, facilitating rapid screening for mutants with enhanced enzyme activity. However, correctly selecting key sites for saturation mutations is not easy. Generally, homology modeling and molecular docking can predict sites close to or interacting with the substrate; mutations at these sites may significantly alter enzyme activity. However, some literature indicates that sites farther from the substrate-binding region may also affect enzyme activity. Therefore, further in-depth research on specific proteins is still needed to find practical solutions that are beneficial for production. Summary of the Invention
[0005] One of the objectives of this invention is to provide a PepD mutant that can increase L-carnosine production.
[0006] This invention provides a PhPepD mutant, the amino acid sequence of which is shown in SEQ ID NO:18.
[0007] The PhPepD mutant of this invention has a mutation site of N158D / I176F / E393Q compared to the wild-type PhPepD protein.
[0008] To address the issues of insufficient PepD enzyme activity and the selection of enzyme mutation sites, this invention first mines PepD from different sources in the database based on homology analysis. Then, it selects natural enzymes with high activity for mutation. During the mutation process, a mutation library is constructed using error-prone PCR with a broad mutation spectrum covering the entire coding sequence of PepD, and sites that contribute significantly to yield improvement are identified. Subsequently, site-directed saturation mutagenesis is performed on these sites, and finally, a specific PhPepD N158D / I176F / E393Q mutant is screened. After being introduced into host cells, it can increase L-carnosine yield by 74.26%, creating favorable conditions for the industrial-scale production of L-carnosine.
[0009] The present invention also provides a nucleic acid encoding the above-mentioned PhPepD mutant.
[0010] Preferably, the nucleic acid of the present invention has a nucleotide sequence as shown in SEQ ID NO.3.
[0011] The present invention also provides biological materials containing the above-mentioned nucleic acids, wherein the biological materials are expression cassettes, vectors or host cells.
[0012] The present invention also provides a recombinant microorganism that exogenously expresses the above-mentioned PhPepD mutant; the recombinant microorganism is Escherichia coli capable of fermenting to produce L-carnosine.
[0013] The recombinant microorganisms of the present invention can express PhPepD mutants through plasmids, genome integration, and other methods.
[0014] The recombinant microorganism of this invention overexpresses, compared to the original strain, press Genes and hisGDCBHAFI Gene;
[0015] The press The nucleotide sequence of the gene is shown as bases 75 to 1022 of SEQ ID NO:1;
[0016] The hisGDCBHAFI The nucleotide sequence of the gene is shown as bases 75 to 7108 of SEQ ID NO:2;
[0017] Preferably, the recombinant microorganism also expresses exogenous expression compared to the starting strain. pledge Genes; the stated pledge The NCBI number for the protein sequence encoded by the gene is WOA97268.1.
[0018] To save production costs, the recombinant microorganisms of this invention can be further expressed exogenously. pledge Genes were developed to increase carnosine production in a culture medium that does not require the addition of β-alanine.
[0019] pledge Genes originate from Bacillus subtilis .
[0020] This invention also provides any of the following applications of the above-mentioned PhPepD mutant, nucleic acid, biological material, or recombinant microorganism:
[0021] (1) Application in the fermentation production of L-carnosine;
[0022] (2) Application in the genetic breeding of microorganisms for the production of L-carnosine;
[0023] (3) Application in increasing the yield of L-carnosine produced by fermentation.
[0024] The present invention also provides a method for producing L-carnosine, which includes a step of fermentation culture with recombinant microorganisms as described above.
[0025] The present invention also provides a method for constructing recombinant microorganisms, comprising the step of exogenously expressing the PhPepD mutant in the recombinant microorganisms; wherein the recombinant microorganisms are Escherichia coli capable of fermenting to produce L-carnosine.
[0026] The method of the present invention further includes overexpressing the recombinant microorganism. press Genes and hisGDCBHAFI Genes, or further exogenous expression pledge The steps of gene generation; the described press Gene, hisGDCBHAFI Genes and pledge The genes are as described above.
[0027] Recombinant microorganisms that can produce carnosine without the addition of β-alanine (exogenous expression) pledge In the gene, expression of the PhPepD mutant of the present invention can also increase the production of L-carnosine.
[0028] The beneficial effects of this invention are at least as follows:
[0029] This invention provides a novel dipeptidase PepD mutant that can increase L-carnosine production by up to 74.26%. It also demonstrates an effect of increasing L-carnosine production in recombinant microorganisms that can produce carnosine without the addition of β-alanine. Detailed Implementation
[0030] The preferred embodiments of the present invention will now be described in detail with reference to specific examples. It should be understood that the following examples are given for illustrative purposes only and are not intended to limit the scope of the invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from its spirit and essence.
[0031] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available or prepared according to conventional methods in the art.
[0032] Example 1: Construction and screening of carnosine-producing strains
[0033] Construction of carnosine-producing strains. Using strains derived from *E. coli*. press Genes and hisGDCBHAFI Genes, artificially synthesized Ptrc promoter-controlled press Gene expression sequence Ptrc-prs (as shown in SEQ ID NO:1, where bases 75 to 1022 are...) press (the nucleic acid sequence of the gene), and the Ptrc promoter-controlled... hisGDCBHAFI The gene expression sequence Ptrc-hisGDCBHAFI (as shown in SEQ ID NO:2, where bases 75 to 7108 are...) hisGDCBHAFI (The nucleic acid sequence of the gene). Genome editing was performed on the MG1655 genome using a CRISPR / Cas9-based method. lacZ Site integration of Ptrc-prs, while in recA Ptrc-hisGDCBHAFI was integrated into the site to obtain the recombinant strain STR01.
[0034] Taking the integration of Ptrc-prs as an example, the specific genome editing method uses the *E. coli* MG1655 genome as a template. The lacZ-U fragment is obtained by amplification using primers lacZ-UF (gctggttgccaacgatcagatgg, SEQ ID NO:4) and lacZ-UR (gccggatgattaattgtcaaagcctggggtgcctaatgagt, SEQ ID NO:5). The lacZ-D fragment is obtained by amplification using primers lacZ-DF (ctgccatgttcgaacactaataataaccgggcaggccatgtc, SEQ ID NO:6) and lacZ-DR (aaattcgaaattactgcgacggctg, SEQ ID NO:7). The lacZ-U, Ptrc-prs, and lacZ-D fragments are then amplified by overlap PCR to obtain the lacZ-Donor fragment.
[0035] Using plasmid pTargeF (purchased from Addgene plasmid, plasmid catalog number 62226) as a template, pTarget-lacZ plasmid was obtained by amplification with primers pTarget-lacZ-F (gcgctgggtcggttacggccgttttagagctagaaatagcaagttaaaataaggctag, SEQ ID NO:8) and pTarget-lacZ-R (ggccgtaaccgacccagcgcactagtattatacctaggactgagctagctg, SEQ ID NO:9).
[0036] The fragment lacZ-Donor, plasmid pTarget-lacZ, and plasmid pCas (purchased from Addgene plasmid, catalog number 62225) were transformed into E. coli MG1655 to obtain the fragments in the MG1655 genome. lacZ Recombinant strains of Ptrc-prs integrated at the site.
[0037] Using the recombinant strain integrating Ptrc-prs as the starting strain, the same method described above was used to... recA The Ptrc-hisGDCBHAFI sequence was further integrated between the sequence taaaaatcttcgttagtttc (SEQ ID NO:20) and the sequence catttttactcctgtcatgc (SEQ ID NO:21) to obtain the recombinant strain STR01.
[0038] use Serratia marcescens Source SmpepDThe gene was modified by changing the first base of its coding sequence from G to A, and then cloned using Gibson assembly between the sequences tttcacacaggaaacagacc (SEQ ID NO:22) and ggctgttttggcggatgaga (SEQ ID NO:23) of the pTrc99a plasmid (purchased from Addgene plasmid, catalog number 155179) to obtain the recombinant plasmid pLSM01. Protein sequence alignment tools from the NCBI database were used for sequencing. SmpepD Five sequences with greater than 50% homology to the gene coding sequence were selected. After codon optimization using *E. coli*, their coding sequences were cloned into the pTrc99a plasmid backbone to obtain recombinant plasmids pLSM02 to pLSM06. Table 1 shows information on PepD protein sequences and their expression plasmids from different sources.
[0039] Table 1. PepD protein sequences and their expression plasmid information from different sources
[0040]
[0041] plasmids pLSM01 to pLSM06 were transformed into strain STR01 to obtain recombinant strains STR02 to STR07.
[0042] Screening of carnosine-producing strains. The overnight culture of strains STR02 to STR07 was inoculated at a rate of 5% into 500 mL baffled shake flasks containing 50 mL of fermentation medium. The cultures were incubated at 37 °C and 200 rpm until the OD600 reached 0.6. 0.1 mMIPTG was then added, and the cultures were incubated for another 48 h.
[0043] The fermentation medium formula (1L) is as follows: glucose 20 g, β-alanine 5 g, magnesium sulfate heptahydrate 0.8 g, diammonium hydrogen phosphate 4 g, potassium dihydrogen phosphate 6.67 g, potassium citrate 1.35 g, 3-morpholine propanesulfonic acid 20.9 g, yeast extract 2.5 g, ferrous sulfate heptahydrate 50 mg, calcium chloride dihydrate 10 mg, zinc sulfate heptahydrate 11 mg, manganese sulfate tetrahydrate 2.5 mg, copper sulfate pentahydrate 5 mg, ammonium molybdate 0.5 mg, sodium borate decahydrate 0.1 mg, and ampicillin 100 mg / L.
[0044] The concentration of L-carnosine was detected by high performance liquid chromatography during fermentation, and the results are shown in Table 2.
[0045] Table 2. Test results of carnosine-producing strains expressing PepD protein from different sources.
[0046]
[0047] As shown in Table 2, the STR05 strain expressing PhPepD protein had the highest yield, reaching 1.18 g / L, which was 21.65% higher than the STR02 strain expressing SmPepD protein.
[0048] Example 2: Screening and Identification of PhPepD Random Mutants
[0049] Construction and screening of the PhPepD random mutant library. Using pLSM04 plasmid as a template, primers PhpepD-Mutant-F (caggaaacagaccatgtctcaactgaccaccctgtcc, SEQ ID NO:10) and PhpepD-Mutant-R (ccaaaacagccttagtttttaaccgggatgttttcaggatagc, SEQ ID NO:11) were used to codon-optimized... PHPEPD Error-prone PCR amplification was performed on the gene expression sequence, and the error-prone PCR product was purified and recovered. Dpn After digesting the template with enzyme I, the clone was inserted into the pTrc99a plasmid between the sequences tttcacacaggaaacagacc (SEQ ID NO:22) and ggctgttttggcggatgaga (SEQ ID NO:23) via Gibson assembly. The ligation product was chemically transformed into competent E. coli BL21(DE3) cells, and after recovery, it was plated on solid medium supplemented with ampicillin. After overnight incubation, the single colonies on the plates constituted the PhPepD random mutant library.
[0050] Single colonies were randomly picked from the plates and cultured in 96-well plates for 12 h. The cells were then collected and resuspended in Tris-HCl (pH=7.5) buffer. Lysozyme was added for digestion to prepare crude enzyme solution. The mutant library was initially screened by the colorimetric reaction of o-phthalaldehyde (OPA) and histidine (see the method described in Zhang X, Liu X, Chen X, et al. Identification and structure-based engineering of adipeptidase CpPepD from Clostridium perfringens for the synthesis of L-carnosine[J]. Journal of Biotechnology, 2024, 389: 86-93). Using a strain expressing the natural PhPepD protein (a recombinant strain obtained by transforming the pLSM04 plasmid into E. coli BL21(DE3)) as a control, a total of 2000 mutants were tested. Twenty-four mutants with enhanced enzyme activity were selected, and plasmids were extracted from each mutant and transformed into the STR01 strain. The mutants were then re-screened according to the fermentation test method described in Example 1. The STR05 strain was used as a control, with a yield of 1.15 g / L. The three strains with the highest yields among the 24 mutants were labeled as strains STR08 to STR10, with yields of 1.36, 1.47, and 1.21 g / L, respectively, representing increases of 18.26%, 27.83%, and 5.22% compared to the control.
[0051] Identification of PhPepD mutants. PhPepD mutations were identified by sequencing plasmids from strains STR08 to STR10. These mutations were identified as S63A / A70G / I176V, N158S / E304G / E393A, and V184L / E240V / V268M / A327T / S383R, totaling 11 point mutations. Overlap PCR was used to prepare PhPepD expression sequences for each of these 11 single-point mutations, and these sequences were cloned into the pTrc99a plasmid backbone using Gibson assembly to obtain recombinant plasmids pLSM07 to pLSM17. The specific procedure was taken as an example of pLSM07 plasmid construction. Using pLSM04 plasmid as a template, two pairs of primers, PhpepD-Mutant-F and PhpepD-S63A-R (catagccagcagtggctggtttacggatcagaatgttac, SEQ ID, SEQ ID), were used. PhpepD-S63A-F (taaaccagccactgctggctatgaaaaccgtaaaggagttgt, SEQ ID NO:12) and PhpepD-Mutant-R were amplified to obtain PhpepD-S63A-U and PhpepD-S63A-D fragments. PhpepD-S63A-U and PhpepD-S63A-D fragments were used to obtain PhpepD-S63A fragment by overlap PCR. PhpepD-S63A fragment was cloned into the pTrc99a plasmid backbone by Gibson assembly to obtain recombinant plasmid pLSM07.
[0052] plasmids pLSM07 to pLSM17 were transformed into strain STR01 to obtain recombinant strains STR11 to STR21. The L-carnosine yield was measured according to the fermentation test method in Example 1, as shown in Table 3.
[0053] Table 3. Test results of carnosine-producing strains with PhpepD single-point mutation
[0054]
[0055] As shown in Table 3, among the 11 point mutations screened from the random mutant library, the three point mutations I176V, N158S and E393A contributed the most to the yield increase, with yields reaching 1.29, 1.35 and 1.45 g / L, respectively, which were 6.61%, 11.57% and 19.83% higher than the control.
[0056] Example 3: Screening and Identification of PhPepD Site-Directed Saturation Mutants
[0057] Site-directed saturation mutagenesis was performed simultaneously at three sites: N158, I176, and E393 of PhPepD, and the combined mutants were screened and identified.
[0058] Using pLSM04 plasmid as a template, three pairs of primers were used: PhpepD-Mutant-F and PhpepD-N158-I176-SSM-R (cctcagagtcagtgttgatcagaatgtcagcttgcagccamnntgcttgcagcccgaaagcac, SEQ ID NO:14), PhpepD-N158-I176-SSM-F (ttctgatcaacactgactctgaggaagaaggcgaannktatatgggttgtgcaggtggcg, SEQ ID NO:15), and PhpepD-E393-SSM-R (tagctgccmnntgcacgatattttgcttgggccag, SEQ ID NO:16), PhpepD-E393-SSM-F (tatcgtgcannkggcagctacccgggctggca, SEQ ID NO:15). NO:17) and PhpepD-Mutant-R were amplified, and the PCR products were labeled PhpepD-CM-A, PhpepD-CM-B, and PhpepD-CM-C, respectively. The NNK in the primers contained 32 codons encoding 20 amino acids, m for a / c, n for a / c / g / t, and k for g / t. PhpepD-CM-A and PhpepD-CM-B were overlapped by PCR to obtain the PhpepD-CM-AB fragment. PhpepD-CM-AB and PhpepD-CM-C were overlapped by PCR to obtain the PhpepD-CM fragment. The PhpepD-CM fragment was then Gibson assembled with the pTrc99a plasmid backbone. The ligation product was chemically transformed into competent E. coli BL21(DE3) cells. After recovery, the cells were plated on solid medium supplemented with ampicillin and cultured overnight. Single colonies on the plates constituted PhPepD. The N158, I176 and E393 site-directed saturation mutant library.
[0059] Following the method described in Example 2, 1000 mutants were initially screened, and 24 mutants with enhanced enzyme activity were selected. Plasmids were extracted from these mutants and transformed into strain STR01 for secondary screening. Strains STR02 and STR05 were used as controls (control yields were 1.01 g / L and 1.22 g / L, respectively). The strain with the highest yield among the 24 mutants was labeled STR22, with a yield of 1.76 g / L, which was 74.26% and 44.26% higher than that of strains STR02 and STR05, respectively. The expression plasmid for the PhPepD mutant in strain STR22 was labeled pLSM18. Sequencing identified the mutation site of the PhPepD mutant as N158D / I176F / E393Q. The amino acid sequence of the PhPepD mutant is shown in SEQ ID NO:18, and the corresponding coding sequence is shown in SEQ ID NO:3.
[0060] Example 4: The effect of the PhPepD mutant in carnosine-producing strains that do not require the addition of β-alanine.
[0061] To eliminate the need for adding β-alanine during fermentation, the following method is adopted: Bacillus subtilis Source pledge The gene (protein sequence NCBI number WOA97268.1) synthesizes RBS-containing proteins. pledge The gene sequence RBS-panD (SEQ ID NO:19, where bases 25 to 408 are shown as) pledgeThe nucleotide sequence of the gene was obtained. RBS-panD was cloned into the cgatccctgagcgcgcgtaa (SEQ ID NO:24) and ggctgttttggcggatgaga (SEQ ID NO:23) sequences of the pLSM01 plasmid and expressed to obtain the recombinant plasmid pLSM19. RBS-panD was cloned into the acatcccggttaaaaactaa (SEQ ID NO:25) and ggctgttttggcggatgaga (SEQ ID NO:23) sequences of the pLSM04 and pLSM18 plasmids, respectively, and expressed to obtain the recombinant plasmids pLSM20 and pLSM21. The plasmids pLSM19, pLSM20, and pLSM21 were transformed into strain STR01 to obtain recombinant strains STR23, STR24, and STR25. Following the method in Example 1, the STR23, STR24, and STR25 strains were fermented in a medium without 5 g / L β-alanine. The L-carnosine yields were 0.54, 0.64, and 0.83 g / L, respectively. This indicates that in carnosine production without the need for β-alanine, the N158D / I176F / E393Q mutant using PhPepD can increase L-carnosine yield by 53.70% and 29.69% compared to using SmPepD and PhPepD, respectively.
[0062] Example 5: Effect of PhPepD mutant integration expression
[0063] To verify the integration expression effect of the PhPepD mutant, samples were selected from the E. coli genome. pepD Genes serve as integration sites. pepD The gene sequence range is GenBank: U00096.3 complement (254259..255716), and its encoded protein has the NCBI number AAC73341.1. Using a CRISPR / Cas9-based genome editing method, the expression sequences of the SmPepD, PhPepD, and PhPepD (N158D / I176F / E393Q) mutants with promoters from plasmids pLSM01, pLSM04, and pLSM18 were integrated into the genome of strain STR01. pepDThe gene locus, specifically the integration site between the sequences cgacaaggagacttaacgtg (SEQ ID NO:26) and gaaattccggcgaagtaatt (SEQ ID NO:27), yielded recombinant strains STR26, STR27, and STR28. Fermentation tests of strains STR26, STR27, and STR28 were conducted according to the method in Example 1, without the addition of antibiotics. The L-carnosine yields were 0.36, 0.44, and 0.62 g / L, respectively. This indicates that during integration expression, the N158D / I176F / E393Q mutant using PhPepD increased L-carnosine yield by 72.22% and 40.91% compared to using SmPepD and PhPepD, respectively.
[0064] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.
Claims
1. A PhPepD mutant, characterized in that, The amino acid sequence is shown as SEQ ID NO:
18.
2. A nucleic acid encoding the PhPepD mutant of claim 1.
3. The nucleic acid of claim 2, wherein, having a nucleotide sequence as shown in SEQ ID NO.
3.
4. A biological material containing the nucleic acid of claim 2 or 3, which is an expression cassette, a vector or a host cell.
5. A recombinant microorganism, characterized in that, The recombinant microorganism exogenously expresses the PhPepD mutant of claim 1; the recombinant microorganism is an E. coli capable of fermentatively producing L-carnosine.
6. The recombinant microorganism of claim 5, wherein, The recombinant microorganism overexpresses prs the gene and hisGDCBHAFI the gene; The nucleotide sequence of the gene is shown in SEQ ID NO: 1 from base 75 to 1022. prs The nucleotide sequence of the gene is shown in SEQ ID NO: 1 from base 75 to 1022. The nucleotide sequence of the gene is shown in bases 75 to 7108 of SEQ ID NO:
2. hisGDCBHAFI The nucleotide sequence of the gene is shown in bases 75 to 7108 of SEQ ID NO:
2.
7. The recombinant microorganism of claim 6, wherein, The recombinant microorganism further exogenously expresses compared to the starting strain panD gene; the panD The NCBI number of the protein sequence encoded by the gene is WOA97268.
1.
8. Use of the PhPepD mutant of claim 1, or the nucleic acid of claim 2 or 3, or the biological material of claim 4, or the recombinant microorganism of any one of claims 5-7, in any one of the following: (1) in fermentatively producing L-carnosine; (2) in genetically breeding a microorganism for producing L-carnosine; (3) in improving the yield of fermentatively producing L-carnosine.
9. A method for producing L-muscle peptide, characterized by, comprising the step of fermentatively culturing a recombinant microorganism as described in any one of claims 5-7.
10. A method of constructing a recombinant microorganism, comprising, comprising the step of making the recombinant microorganism exogenously express the PhPepD mutant of claim 1; the recombinant microorganism is an E. coli capable of fermentatively producing L-carnosine.
11. The method of claim 10, wherein, Also included is the step of overexpressing in said recombinant microorganism prs a gene and hisGDCBHAFI a gene, or further exogenous expression panD of a gene; The prs gene, hisGDCBHAFI gene as described in claim 6, the panD gene as described in claim 7.
Citation Information
Patent Citations
Escherichia coli-based recombinant strain and construction method therefor and application thereof
WO2021037165A1
Engineered bacterium, construction method therefor and use thereof
WO2025140256A1