Use of peach fruit hexokinase PpHXK3 gene in preparation of plant cold-resistant product

By cloning and expressing the peach fruit hexokinase PpHXK3 gene, the activity of polygalacturonase PG was inhibited, thus solving the chilling injury problem of peach fruit during low-temperature storage and improving the fruit's chilling resistance and storage quality.

CN121249778BActive Publication Date: 2026-04-07NINGBO UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-08
Publication Date
2026-04-07

AI Technical Summary

Technical Problem

Peach fruits are prone to chilling injury symptoms during low-temperature storage, such as flesh browning, fluffing, fruit softening, and juice loss, which affect storage time and commercial value. Existing methods for treating exogenous NO and H2S are stringent and can easily cause adverse effects.

Method used

By using the peach fruit hexokinase PpHXK3 gene, and through the design of nucleotide and amino acid sequences, the PpHXK3 gene was cloned and expressed to inhibit the activity of polygalacturonase PG, maintain the integrity of the cell wall structure, and improve the cold resistance of the fruit.

Benefits of technology

The PpHXK3 gene can effectively inhibit PG activity, maintain the stability of cell wall pectin, improve fruit firmness and cold resistance, and reduce cold damage symptoms. It is suitable for genetic breeding and transgenic technology screening of peach varieties with strong cold resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121249778B_ABST
    Figure CN121249778B_ABST
Patent Text Reader

Abstract

The application discloses application of a peach fruit hexokinase PpHXK3 gene in preparation of a plant cold-resistant product, and is characterized in that the nucleotide sequence is shown as SEQ ID NO. 1, and the amino acid sequence is shown as SEQ ID NO. 2; a cloning method of PpHXK3 comprises the following steps: extracting total RNA of peach fruit and reversely transcribing the total RNA into cDNA as a template, and designing upper and lower amplification primers according to a gene sequence of PpHXK3; finally, a PpHXK3 gene amplification product is obtained through PCR amplification; the application of PpHXK3 in preparation of polygalacturonase PpPG21 inhibitors and / or polygalacturonase PpPG23 inhibitors, and the application of PpHXK3 in preparation of peach fruit cold-resistant products and heterologous plant cold-resistant products are also provided; and the advantages are that the decomposition of pectin is reduced, the integrity of a cell wall structure and the hardness of a fruit are maintained, the fruit has higher cold resistance, and cold damage in a storage and transportation process is reduced.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to the application of a peach fruit hexokinase PpHXK3 gene in the preparation of plant cold-resistant products. Background Technology

[0002] Peach( Prunus persica (L.) Batsch), a plant of the genus *Prunus* in the family Rosaceae. Peaches are harvested during the hot and rainy summer. After picking, if left at room temperature, the flesh softens rapidly, relying on vigorous metabolism to provide energy and maintain normal bodily functions, making it highly susceptible to rotting and significantly shortening its storage time. Low-temperature storage is one of the effective methods to maintain fruit quality and extend its shelf life. However, peaches are cold-sensitive fruits. After being stored at low temperatures for a period of time (about two weeks), the fruit will exhibit symptoms of chilling injury, such as flesh browning, rotting, softening, juice loss, and cell wall leatheriness. These chilling injury symptoms worsen with prolonged storage, affecting commercial value and causing substantial economic losses.

[0003] Chilling injury symptoms in peaches during low-temperature storage, such as loss of normal softening ability, lignification, and juice loss, are all closely related to cell wall metabolism. Pectin is an important component of the middle lamella and primary cell wall in plant cells. Polygalacturonase (PG) decomposes pectin in the cell wall and middle lamella, causing cells to lose their adhesive force, thus leading to fruit softening. Studies have shown that exogenous NO and H2S treatment can reduce PG activity in peaches, delay pectin degradation, maintain the integrity of cell wall structure and fruit firmness, thereby improving the fruit's chilling resistance and storage quality. However, the concentrations of NO and H2S used are extremely low and the requirements are strict; even slight deviations can have adverse effects on the fruit.

[0004] Hexokinase (HXK) plays a crucial role in numerous metabolic pathways, including glycolysis, cell wall synthesis, and the pentose phosphate pathway. HXK can regulate plant growth and development, as well as various biotic and abiotic stresses, such as nutrient stress, seed development, salt stress, and cold stress. Arabidopsis thaliana AtHXK2 and AtHXKL3 The expression of [specific compound] was significantly induced under cold stress. Under low-temperature stress, overexpression [was observed]. CsHXK4 Arabidopsis plants exhibit stronger cold resistance. Currently, there is no evidence regarding the application of the peach fruit hexokinase PpHXK3 gene in improving postharvest cold resistance in peach fruits. Summary of the Invention

[0005] The application aims to provide an application of a peach fruit hexokinase PpHXK3 gene in preparing a plant cold-resistant product, and improve the cold resistance of postharvest peach fruit.

[0006] The application adopts the technical scheme that the peach fruit hexokinase PpHXK3 gene is applied in preparing a peach fruit cold-resistant product, and the nucleotide sequence is shown in SEQ ID NO. 1.

[0007] The application also provides an application of a protein encoded by the peach fruit hexokinase PpHXK3 gene in preparing a plant cold-resistant product, and the amino acid sequence is shown in SEQ ID NO. 2.

[0008] The application also provides a cloning method of the peach fruit hexokinase PpHXK3 gene, which comprises the following steps. PpHXK3

[0009] (1) extracting total RNA of peach fruit and reverse transcribing into cDNA as a template;

[0010] (2) designing primers according to the gene sequence: the sequence of an upstream amplification primer is 5'-TTGGGATAGGGGGCGTAGAT-3', and the sequence of a downstream amplification primer is 5'-GAAAAATATGGACAAACCTTCCCT-3'; PpHXK3

[0011] (3) PCR amplification: obtaining a gene amplification product through PCR amplification. PpHXK3

[0012] The application also provides an application of the peach fruit hexokinase PpHXK3 gene in preparing a polygalacturonase PpPG21 inhibitor and / or a polygalacturonase PpPG23 inhibitor.

[0013] The application also provides an application of the peach fruit hexokinase PpHXK3 gene in preparing a peach fruit cold-resistant product.

[0014] The application also provides an application of the peach fruit hexokinase PpHXK3 gene in preparing a tomato fruit cold-resistant product.

[0015] The application also provides an application of the peach fruit hexokinase PpHXK3 gene in preparing an Arabidopsis thaliana seedling cold-resistant product.

[0016] Compared with the prior art, the application has the advantages that

[0017] ​​​1. The peach fruit hexokinase gene PpHXK3 with cold stress resistance function is confirmed for the first time. PpHXK3 can interact with polygalacturonase PpPG, inhibit PG activity, maintain the stability of pectin in the cell wall, and alleviate the fruit softening caused by long-term low-temperature storage.

[0018] 2. PpHXK3 can be used as a molecular marker for peach fruit, for genetic breeding and transgenic screening of peach varieties with strong cold resistance. PpHXK3 For high-expression varieties, it can effectively inhibit polygalacturonase activity, reduce pectin decomposition, maintain the integrity of the cell wall structure and fruit hardness, so as to make the fruit have higher cold resistance and reduce cold damage during storage and transportation. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 RT-qPCR relative expression analysis results of peach fruit hexokinase under low temperature PpHXKs

[0020] Figure 2 Effect of overexpression on tomato cold resistance, wherein A is overexpression PpHXK3 Positive identification of overexpression tomato PpHXK3 Phenotype of overexpression tomato fruit cold resistance PpHXK3

[0021] Figure 3 Effect of complementation on Arabidopsis cold resistance, wherein A is complementation PpHXK3 Positive identification of complementation Arabidopsis PpHXK3 Phenotype of complementation Arabidopsis seedlings PpHXK3 Survival rate of complementation Arabidopsis at 5°C PpHXK3

[0022] Screening of PpHXK3 interacting proteins under the yeast two-hybrid system, wherein A is pGBKT7-PpHXK3 self-activation detection; B is 3AT inhibition of pGBKT7-PpHXK3 self-activation detection; C is positive clone back verification; positive control: pGBKT7-p53+pGADT7-largeT; negative control: pGBKT7-laminC+pGADT7-largeT Figure 4

[0023] Yeast two-hybrid verification of PpHXK3 and PpPG interaction; positive control: pGBKT7-p53+pGADT7-largeT; negative control: pGBKT7-laminC+pGADT7-largeT Figure 5

[0024] Figure 6 ​​​To verify the interaction between PpHXK3 and PpPG for bimolecular fluorescence complementation; negative controls in Figure A: pSPYCE-PpHXK3+pSPYNE, pSPYNE-PpPG21+pSPYCE, and pSPYCN+pSPYNE; negative controls in Figure B: pSPYCE-PpHXK3+pSPYNE, pSPYNE-PpPG23+pSPYCE, and pSPYCN+pSPYNE.

[0025] Figure 7 The expression analysis of PpHXK3 recombinant protein particle in Rosetta (DE3) strain is shown in A, B, and C. The red arrows indicate the location of the target band.

[0026] Figure 8 Western blot analysis of PpPG21 and PpPG23 recombinant protein particles expressed in BL21(DE3) strain, where A represents PpPG21 recombinant protein; B represents PpPG23 recombinant protein; and the red arrows indicate the location of the target band.

[0027] Figure 9 The effects of PpHXK3 on the in vitro inhibition of PpPG activity are shown in Figure A, where PpHXK3 affects the crude protein activity of PpPG21; Figure B shows the effect of PpHXK3 on the crude protein activity of PpPG23; and Figure C shows the effect of PpHXK3 on the PG activity of crude enzyme solution from peach fruit.

[0028] Figure 10 To overexpress the gene in peach fruit via Agrobacterium transient transformation. PpHXK3 Inhibit PG activity, where A is the product of transient transformation by Agrobacterium. PpHXK3 Expression level analysis; B represents the effect of Agrobacterium-mediated transient transformation on PG activity. Detailed Implementation

[0029] The present invention will be further described in detail below with reference to the accompanying drawings and embodiments.

[0030] Specific Example 1: Peach Fruit Hexokinase Sensitive to Low Temperature PpHXK3 The screening process.

[0031] Five peach fruit hexokinase genes (accession numbers: Purpoe.7G218800, Purpoe.3G057800, Purpoe.4G256200, Purpoe.1G366000, Purpoe.6G212100) were screened from literature and the Phytozome peach fruit database. Primers were designed according to Table 1, and peach fruits stored at low temperature for 4 weeks were subjected to... PpHXKsGene quantification.

[0032] Table 1 Quantitative primer sequences of peach fruit hexokinase gene RT-qPCR

[0033]

[0034] The five hexokinase genes were named as PpHXK1-3 Prupe.7G218800, PpHKL1-2 Prupe.3G057800, PpHXK1 Prupe.4G256200, PpHXK2 Prupe.1G366000, PpHXK3 Prupe.6G212100.As shown in the results of RT-qPCR, PpHKL1 Prupe.7G218800 could not be accurately quantified, while the other four PpHKL2 Prupe.3G057800, Figure 1 Prupe.4G256200, PpHKL2 Prupe.1G366000, PpHXK Prupe.6G212100 were the most sensitive to low temperature and might have the greatest effect on resisting cold stress. PpHXK3 Specific embodiment two, peach fruit hexokinase

[0035] gene cloning and sequence analysis. PpHXK3

[0036] 1. Total RNA was extracted from the fruit of "Hujingmilu" peach and reverse transcribed into cDNA for PCR template; the specific process was as follows: the total RNA of peach fruit was extracted by using the Eastep® Super total RNA extraction kit of Promega, and then reverse transcribed into cDNA by using the HiScript® II Q Select RT Super Mix for qPCR kit as the template for PCR reaction;

[0037] 2. The specific amplification primer of the CDS region of peach fruit PpHXK3 Gene (Gene ID: LOC18779707) was designed by using NCBI-PRIMER (National Center for Biotechnology Information, USA), the sequence of the upstream amplification primer was 5'-TTGGGATAGGGGGCGTAGAT-3', and the sequence of the downstream amplification primer was 5'-GAAAAATATGGACAAACCTTCCCT-3';

[0038] 3. PCR amplification: the PCR amplification was performed by using the specific amplification primer of the CDS region of peach fruit PpHXK3The reaction system of gene amplification product, PCR amplification, was as follows: 2 μL cDNA, 25 μL 2×Phanta Max Master Mix (PCR amplification high-fidelity enzyme: 2×Phanta Max Master Mix, product number: P525-02; purchased from Nanjing Novozyme Biotech Co., Ltd.), 2 μL upstream and downstream primers, and 19 μL ddH2O; the PCR amplification procedure was as follows: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15 s, annealing at 60 ℃ for 15 s, extension at 72 ℃ for 2 min, 35 cycles; complete extension at 72 ℃ for 5 min; and 1 wt% agarose gel electrophoresis was used to verify whether the product band was correct.

[0039] 4. Colony PCR and sequencing alignment: after the cloned PCR product was recovered and purified by using a Gel Extraction Kit kit (OMEGA, Guangzhou, China), the product was connected with a pMD18-T vector, and then transformed into E. coli DH5α, which was coated on an LB-Amp plate uniformly coated with X-Gal and IPTG, and then incubated at 37 ℃ for overnight; a white single colony was picked, further verified by PCR, and then sequenced to obtain a nucleotide sequence of the gene matched with the peach fruit genome data, as shown in SEQ ID NO. 1. PpHXK3 The nucleotide sequence of the gene is shown in SEQ ID NO. 1.

[0040]

[0041] The protein encoded by peach hexokinase PpHXK3, the amino acid sequence of which is shown as SEQ ID NO. 2:

[0042] MGKVAVGLAVGVAVAACAVATVLVGRRIRSRRKWRRVVGVLKELEQSCETTVGRLRQVVDAMAVEMHAGLASDGGSKLKMLLTFVDKLPNGSEKGTYYALDLGGTNFRVLRVKLEGTRSSTLEHDVYRQAIPQDLMTGSSEDLFDFIASSLKEFVEREGDISELSLDRRGELGFTFSFPVKQMSVSSGTLLKWTKGFSIEDMVGREIAGCLENAMTRKGLNMRVAALVNDSVGSLALGHYHDTDTVAAVIIGTGTNACYLERTDAIIKSQGLLTTSGGMVVNMEWGNFWSSHLPRTLYDIELDADSPNPNDQGFEKLISGMYLGDVVRRVIVRMSQESDIFDPISSKLSMPFILRTPLIAAMHEDDSPDLEEVRRILRDNLEILDVPLKVRKLIVKVCDVVTRRAARLAAAGIVGILKKIGRDGSGGIAGGRSRSDQKMRRTVVAMEGGLYTGYTMFRDYLHEALTEILGEDIAQHVIIKVTEDGSAMGAALLAASHSSYPVDSVQLL.

[0043] Bioinformatics analysis showed that PpHXK3 contains 508 amino acid residues (AA), with a molecular weight of 55.41 kD, a theoretical isoelectric point (pI) of 6.36, and an instability coefficient of 46.68, which is an unstable protein; the average hydrophobicity is -0.004, which is a hydrophilic protein. Protein secondary structure prediction, the alpha-helix of PpHXK3 contains 203 amino acids, accounting for 39.96%, the extended chain contains 94 amino acids, accounting for 18.50%, and the random coil contains 211 amino acids, accounting for 41.54%. PpHXK3 has a transmembrane structure, and the transmembrane region is between the 4th and 26th amino acids of the polypeptide chain. Protein signal peptide prediction showed that PpHXK3 contains a signal peptide structure at the N-terminus, and the cleavage site is located between the 20th alanine Ala and the 21st alanine Ala and threonine Thr. PpHXK3 contains 2 N-glycosylation sites, located at AA 90 and 229.

[0044] Specific embodiment three, heterologous plants PpHXK3 Verification of cold resistance function.

[0045] 1. Overexpression PpHXK3 Positive identification of transgenic tomato

[0046] The overexpression PpHXK3 The amplified product was constructed into BG Plant-express MCS empty vector, and the recombinant plasmid was sent to Chongqing Bao Guang Biotechnology Co., Ltd. to obtain overexpression PpHXK3 Transgenic tomato seedlings (T0 generation). The T0 transgenic seedlings were transplanted to the greenhouse and managed normally until flowering and fruiting. After the fruits matured, the seeds of each T0 plant were harvested separately. The seeds harvested from each T0 plant were a T1 family. The T1 transgenic tomato seeds were planted on 1 / 2 MS solid medium containing 50 mg / L kanamycin (Kana) for preliminary positive screening. After about 10 days of culture, the seedlings that germinated and grew normally were transplanted to the soil and managed until flowering and fruiting. After the fruits matured, the seeds of each T1 plant were harvested separately. The seeds harvested from each T1 plant were a T2 family. The T2 overexpression PpHXK3 Transgenic tomato (abbreviated as OE- PpHXK3 Tomato, L1-L3: 3 different OE- PpHXK3 Tomato T2 family) and wild type (Wild Type, abbreviated as WT) tomato seeds were planted, and tomato plant leaves were harvested after about a month, rapidly frozen in liquid nitrogen, and ground into a uniform fine powder using a mortar. The total RNA of OE- SlActin and WT tomato leaves was extracted and reverse-transcribed into cDNA for qPCR amplification. The reaction system was as follows: 2 μL cDNA, 25 μL 2×Phanta Max Master Mix, 2 μL of upstream and downstream primers, and 19 μL ddH2O, wherein SlActin The tomato internal reference primers were as follows: SlActin The upstream primer sequence was as follows: TGTCCCTATTTACGAGGGTTATGC, PpHXK3 The downstream primer sequence was as follows: CAGTTAAATCACGACCAGCAAGAT, Figure 2 The upstream and downstream primers were as shown in Table 1 for quantitative primers; the PCR amplification program was as follows: pre-denaturation at 95 °C for 3 min; denaturation at 95 °C for 15 s, annealing at 60 °C for 15 s, extension at 72 °C for 2 min, 35 cycles; complete extension at 72 °C for 5 min; and the product band was verified using 1 wt% agarose gel electrophoresis. The results are shown in SlActin A, using PpHXK3 Tomato internal reference primers, L1-L3 lines and WT could all amplify correct bands; using PpHXK3Quantitative primers showed that the L1-L3 lines amplified the correct bands, while the WT lines showed no bands, indicating that the L1-L3 lines were overexpressing the virus. PpHXK3 Successful; it is a positive strain. It can be used for subsequent cold resistance experiments.

[0047] 2. Overexpression PpHXK3 Chill injury phenotype of genetically modified tomato fruit

[0048] T2 generation OE- Figure 2 Transgenic tomato and WT tomato seeds were planted, and mature fruits were harvested in about 3 months. These fruits were then stored in a 5°C cold storage for 4 weeks, and phenotypic changes were observed and recorded. Results are as follows: PpHXK3 As shown in Figure B, compared to the previous week, WT tomatoes showed more pronounced dents and wrinkles in the fruit during week 4, lost their luster, lost a large amount of water, and suffered severe chilling injury, while OE- PpHXK3 The tomatoes were smoother, with less surface dents and wrinkles, and showed no obvious signs of chilling injury, indicating overexpression. PpHXK3 It will improve the cold resistance of tomato fruit.

[0049] 3. Dipping flower method for Arabidopsis thaliana to replenish AtHXK1

[0050] Hexokinase against WT Arabidopsis thaliana gin2-1 Knockout was performed, and the resulting knockout strain was named... gin2-1 .Will gin2-1 Transplant the seedlings into a plant culture box and manage them normally until they flower and bear fruit. Once the pods are mature, harvest each plant individually. gin2-1 The seeds of the plant. PpHXK3 Replant the plant seeds and manage them until the initial inflorescence appears. Then, use the flower-dip immersion method to replenish the hexokinase in the peach fruit. PpHXK3 Gene.

[0051] Will PpHXK3 Connect the pCAMBIA vector, pCAMBIA- PpHXK3 The plasmid was transferred to Agrobacterium GV3101 competent cells via chemical transformation. The plasmid was then transformed into pCAMBIA- gin2-1LB solid medium containing antibiotics (antibiotic components and concentrations: 100 mg / L spectinomycin Spect, 20 mg / L rifampicin Rif, 40 mg / L gentamicin Gen), and the single colonies were picked and added to 5 mL of LB liquid medium containing antibiotics (same antibiotic components and concentrations as above) and cultured at 28 ℃, 220 r / min overnight, and then 20 mL of LB liquid medium containing antibiotics (same antibiotic components and concentrations as above) was used to culture at 28 ℃, 220 r / min until the OD600 was about 0.6-0.8. The bacterial cells were collected by centrifugation at 5000xg for 10 min, resuspended in fresh infiltration solution (containing 10% sucrose, 400 μL / L organic silicon surfactant Silwet L-77), and the OD600 was adjusted to about 0.8-1.0. After 1 h of light-free standing, the infiltration solution was used. 600

[0052] PpHXK3 The pods and fully opened flowers on the Arabidopsis plants were cut off, and the plants were watered thoroughly before infiltration to fully open the stomata. The plant buds were completely immersed in the bacterial solution and gently shaken for 1 min, and then briefly air-dried. The plants were completely sealed to maintain humidity, and after 24 h of culture in the dark, they were transferred to a normal light environment (light 24 ℃ / 16 h, dark 18 ℃ / 8 h). After 6-7 days, the sealing bag was removed, and the plants were normally watered about a week later, and then once a week until the mature seeds were harvested, which were the T0 generation. The T0 seeds were planted on 1 / 2 MS solid medium containing 50 mg / L Kana, and the Arabidopsis seedlings that grew normally were transplanted into the soil, and the seeds from a single plant were collected, which were the screened positive plants T1 generation. The same method was used to continue screening positive seedlings until the seeds could all survive on 1 / 2 MS solid medium containing 50 mg / L kanamycin, indicating that the seeds were homozygous positive plants, and were named L1-L3, which could be used for subsequent experiments.

[0053] 4. Backfilling gin2- Positive identification of Arabidopsis

[0054] L1, L2, and L3 seeds were planted on 1 / 2 MS solid medium containing 50 mg / L kanamycin (Kana), AtActin 1 and WT seeds were planted on 1 / 2 MS solid medium without 50 mg / L Kana, and the seedlings were transplanted into the soil and grown normally for 4 weeks under a light incubator. The 4-week-old Arabidopsis leaves were frozen and ground in liquid nitrogen, and total RNA was extracted and reverse-transcribed into cDNA. The Arabidopsis leaf cDNA was used as a reference gene AtActin ​​​AtActin Internal control upstream primer: CAGAGCGATTCCGTTGTCCT; PpHXK3 Internal control downstream primer: CCTTTGCGATCCACATCTGC), Figure 3 The quantitative primers were used to amplify the products of the identified genes, and the PCR products were detected by electrophoresis in 1 wt% agarose gel. The results are shown in AtActin The internal control primers were used to amplify the products of the identified genes, and the PCR products were detected by electrophoresis in 1 wt% agarose gel. The results are shown in gin2-1 The L1-L3 lines, PpHXK3 and WT can all amplify the correct bands; the quantitative primers were used to amplify the products of the identified genes, and the PCR products were detected by electrophoresis in 1 wt% agarose gel. The results are shown in gin2-1 The L1-L3 lines can amplify the correct bands, while PpHXK3 and WT have no bands, indicating that the L1-L3 lines have successfully complemented PpHXK3 and are positive lines. They can be used for subsequent cold resistance experiments.

[0055] 5、Complementation of Arabidopsis thaliana seedlings gin2-1 Cold resistance of Arabidopsis thaliana seedlings

[0056] L1, L2, L3, Figure 3 and WT Arabidopsis seeds, 30 each, were planted on 1 / 2 MS medium. The control group (Control) grew under normal conditions, and the experimental group of 2-week-old seedlings grew under normal conditions and was subjected to cold stress at 5 ℃ for 4 d, and then recovered under normal conditions for 4 d. The survival rate was calculated according to the morphology. The results are shown in gin2-1 B, the survival rate of Arabidopsis seedlings was the lowest, and the complemented PpHXK3 The survival rate of Arabidopsis seedlings was higher than that of gin2-1 and WT. The survival rate statistics are shown in Figure 3 C, the survival rates of the five lines in the control group were close to 100%, and the survival rates of the L1-L3 lines in the experimental group were significantly higher than those of gin2-1 and WT. It is indicated that the complementation of PpHXK3 can improve the cold resistance of Arabidopsis seedlings. The above phenotypic results of heterologous plants indicate that the peach fruit hexose kinase PpHXK3 can improve the cold resistance of plants. Figure 4

[0057] Specific embodiment four, screening of PpPG interacting with PpHXK3 by yeast two-hybrid and verification

[0058] 1、Screening of PpPG interacting with PpHXK3 by yeast two-hybrid library

[0059] ​The recombinant plasmid of PpHXK3 constructed into pGBKT7 vector was used as bait, and pGBKT7-PpHXK3 and pGADT7 empty plasmid were co-transformed into yeast strain AH109 (stock number: CC300-10x100 μL; purchased from Beijing Coolab Technology Co., Ltd.), and 6 single colonies of the yeast transformants grown from pGBKT7-PpHXK3+pGADT7 co-transformation AH109 were randomly selected for PCR detection and preservation. The correct single colonies detected by PCR were used as the experimental group, and 3 randomly selected points were cultured on SD / -Leu / -Trp Broth (SD-TL) and SD / -His / -Leu / -Trp Broth (SD-TLH) (SD-TL stock number: PM2221-10x0.5 L; SD-TLH stock number: PM2151-10x0.5 L; both purchased from Beijing Coolab Technology Co., Ltd.), pGBKT7-p53+pGADT7-largeT was used as a positive control, and pGBKT7-laminC+pGADT7-largeT was used as a negative control (p53, laminC and largeT were all purchased from Beijing Coolab Technology Co., Ltd., and then co-transformed into Y2H competent cells), and cultured at 30°C for 3-5 days, and the growth state of the colonies was observed. The results are shown in Figure 4 As shown in FIG. 1A, pGBKT7-PpHXK3 and the positive control grew on the SD-TL and SD-TLH deficient plates, indicating that pGBKT7-PpHXK3 had obvious self-activation phenomenon.

[0060] In yeast two-hybrid experiments, the use of 3-Amino-1,2,4-triazole (3AT) with a suitable concentration determined by titration is a key step to ensure reliable experimental results and low false positive rate. The addition of 3AT can inhibit the self-activation of pGBKT7-PpHXK3, thereby excluding the false positive results of pGBKT7-PpHXK3 yeast two-hybrid. 3AT (stock number: CA1311-25g; purchased from Beijing Coolab Technology Co., Ltd.) concentrations of 5, 10, 20, 30, 40, 50, 75 and 100 mM were set to verify the concentration of inhibiting the self-activation of pGBKT7-PpHXK3. The results are shown in Figure 4 As shown in FIG. 1B, at a 3AT inhibition concentration of 75 mM, pGBKT7-PpHXK3 had no self-activation phenomenon.

[0061] The AH109 yeast strain with pGBKT7-MERGEFIELD gene name PpHXK3 as bait plasmid was used as the recipient bacteria to prepare competent cells, and the library plasmid MERGEFIELD library name peach cDNA was introduced into the competent cells. The library was screened on the SD-TLH+MERGEFIELD M_3AT concentration 75 mM 3AT screening plate. The number of MERGEFIELD bacteria P single clone colonies grown on the SD-TLH+MERGEFIELD M_3AT concentration 75 mM 3AT plate was 96. These positive clones were amplified from the yeast cells for DNA sequencing and BLAST comparison analysis with the sequences in the GenBank database. The control strain positive control (the second from the left in the last row from left to right) can grow on the SD-TL, SD-TLH+MERGEFIELD M_3AT concentration 75 mM 3AT, SD-TLH+MERGEFIELD M_3AT concentration 75 mM 3AT+X-a-gal, SD / -Ade / -His / -Leu / -Trp Broth (SD-TLHA)+MERGEFIELD M_3AT concentration 75 mM 3AT and SD-TLHA+MERGEFIELD M_3AT concentration 75 mM 3AT+X-a-gal defect plates, and can show blue color on the SD-TLH+MERGEFIELD M_3AT concentration 75 mM 3AT+X-a-gal and SD-TLHA+MERGEFIELD M_3AT concentration 75 mM 3AT+X-a-gal defect plates. The negative control (the last one from left to right in the last row) can only grow on the SD-TL plate, but cannot grow on the other plates. The results are shown in Figure 5As shown in FIG. 2, the 37 positive yeast clones screened can grow on the SD-TL, SD-TLH+ MERGEFIELD M_3AT with 75 mM 3AT, SD-TLH+ MERGEFIELD M_3AT with 75 mM 3AT+X-α-gal, SD-TLHA+ MERGEFIELD M_3AT with 75 mM 3AT, SD-TLHA+ MERGEFIELD M_3AT with 75 mM 3AT+X-α-gal defective plates, and can show blue on the SD-TLH+ MERGEFIELD M_3AT with 75 mM 3AT+X-α-gal defective plate, and 36 clones can show blue on the SD-TLHA+ MERGEFIELD M_3AT with 75 mM 3AT+X-α-gal. Subsequent screening found that No. 30 is a gene PpPG21 related to peach fruit softening, combined with the high-throughput data results, a PpPG23 was screened again, and the two PG proteins may have protein interaction with PpHXK3.

[0062] 2. One-to-one verification of protein interaction between PpHXK3 and PpPG by yeast two-hybrid

[0063] The prey protein recombinant plasmids pGADT7-PpPG21 and pGADT7-PpPG23 were constructed. The pGBKT7-PpHXK3 and pGADT7-PpPG21 plasmids were co-transferred into the yeast competent AH109, and the pGBKT7-PpHXK3 and pGADT7-PpPG23 plasmids were co-transferred into the yeast competent AH109, and single colonies of each group of transformed yeast recombinants were picked and verified by PCR. After successful verification, the single colonies were resuspended in 1 mL of sterile ddH2O, OD 600 The OD was adjusted to 0.2, and the bacterial solution was diluted by 10 times, 100 times, and 1000 times with ddH2O, and then dropped onto the SD-TL, SD-TLH+ MERGEFIELD M_3AT with 75 mM 3AT, SD-TLH+ MERGEFIELD M_3AT with 75 mM 3AT+X-α-gal, SD-TLHA+ MERGEFIELD M_3AT with 75 mM 3AT, and SD-TLHA+ MERGEFIELD M_3AT with 75 mM 3AT+X-α-gal defective plates, and cultured at 30°C for 3-5 days. The results are shown in FIG. 2. Figure 6As shown, the strain co-transfected with pGBKT7-PpHXK3+ pGADT7-PpPG21 can grow on SD-TL, SD-TLH+ MERGEFIELD M_3AT concentration 75 mM 3AT and SD-TLH+ MERGEFIELD M_3AT concentration 75 mM 3AT deficient plates as the positive control strain, and can show color on SD-TLH+ MERGEFIELD M_3AT concentration 75 mM 3AT+X-α-gal and SD-TLHA+ MERGEFIELD M_3AT concentration 75 mM 3AT+X-α-gal deficient plates; while the negative control can only grow on SD-TL plate and cannot grow on other plates; the results of pGBKT7-PpHXK3+ pGADT7-PpPG23 are consistent with those of pGBKT7-PpHXK3+ pGADT7-PpPG21. Therefore, it is preliminarily confirmed that there is protein interaction between PpHXK3 and PpPG21, PpPG23.

[0064] 3. Verification of protein interaction between PpHXK3 and PpPG by Bi-molecular fluorescence complementation

[0065] PpHXK3 was constructed into pSPYCE-35S vector, and PpPG21 and PpPG23 were constructed into pSPYNE-35S vector. The recombinant plasmid was transformed into Agrobacterium GV3101 competent cells (purchased from Shanghai Uptide Biotechnology Co., Ltd.) by chemical transformation method. The Agrobacterium containing the recombinant plasmid was picked into 5 mL LB medium containing antibiotics (50 mg / L Kana, 20 mg / L Rif, 40 mg / L Gen) and cultured at 28 °C, 200 rpm for 2 d. 1 mL of cultured Agrobacterium liquid was transferred to 20 mL of LB medium containing antibiotics (same as above) for expansion culture, and cultured at 28 °C, 200 rpm until the logarithmic phase of Agrobacterium growth (OD 600 = 0.5-0.6). The bacteria were collected by centrifugation at room temperature, 5000 rpm for 10 min, suspended in infiltration liquid (containing 10 mM MgCl2, 10 mM MES, 150 μM Acetosyringone (AS), pH = 5.6) to OD 600 = 1.0, and stood at room temperature for 2-3 h.

[0066] pSPYCE-35S-PpHXK3+pSPYNE-35S-PpPG21 and pSPYCE-35S-PpHXK3+pSPYNE-35S-PpPG23 as experimental groups, pSPYCE-35S-PpHXK3+pSPYNE-35S, pSPYNE-35S-PpPG21+pSPYCE-35S, pSPYNE-35S-PpPG23+pSPYCE-35S and pSPYCE-35S+pSPYNE-35S as negative control groups. Equal volume of bacteria containing different plasmids were mixed. A small hole was gently opened on the back of tobacco leaf with a 1 mL needle, and then the bacterial solution was sucked into the needle tube without the needle and injected into the leaf from the wound of the leaf. The tobacco leaf was marked with a marker pen. The injected plants were cultured at about 21 °C for 2 days, and then the fluorescence of the injected Agrobacterium tumefaciens region of the tobacco was observed. The marked region of the tobacco leaf was torn and imaged by laser confocal microscopy. The results are shown in Figure 6 A and Figure 7 B, compared with the negative control, only the tobacco co-injected with pSPYCE-35S-PpHXK3+pSPYNE-35S-PpPG21 and pSPYCE-35S-PpHXK3+pSPYNE-35S-PpPG23 emitted fluorescence and the position was located in the cell membrane and cytoplasm, and further confirmed that there was interaction between PpHXK3 and PpPG21, PpPG23.

[0067] The above yeast two-hybrid and bi-molecular fluorescence complementation experiments can prove that there is protein interaction between PpHXK3 and PpPG21, PpPG23.

[0068] Example Five, Effect of PpHXK3 on PpPG Activity

[0069] 1. In vitro recombinant protein expression and purification of PpHXK3 and PpPGs

[0070] PpHXK3 and PpPGs were recombinantly expressed and purified in a prokaryotic system (E. coli). PpHXK3, PpPG21 and PpPG23 were constructed into pGEX-4T empty vector, and pGEX-4T-PpHXK3 recombinant plasmid was transformed into E. coli Rosetta (DE3) (purchased from Shanghai Widi Biotechnology Co., Ltd.), and pGEX-4T-PpPG21 and pGEX-4T-PpPG23 recombinant plasmids were transformed into E. coli BL21 (DE3) (purchased from Nanjing Novozyme Biotech Co., Ltd.). After the colonies grew, 3-5 single colonies were picked and identified by bacterial liquid PCR and sequenced. After successful sequencing, the bacteria were preserved.

[0071] The Rosetta (DE3) strain transformed with the recombinant plasmid pGEX-4T-PpHXK3 was removed from the preservation library, activated by gentle shaking, and then shaken vigorously until the OD600 was between 0.6 and 0.8. One mL of the uninduced bacterial culture was then taken... Figure 7 In lane A (lane 1), induction was performed using 0.1 mM IPTG at 16 ℃, with sampling times of 16 h, 18 h, 20 h, 22 h, and 24 h. Figure 7 Take 1 mL of IPTG-induced bacterial culture from each of lanes A (lanes 2-6), centrifuge at 10000 rpm for 2 min at room temperature, discard the supernatant, resuspend in 70 μL of 1×PBS, add 40 μL of the resuspended culture to 20 μL of 2×protein loading buffer, and then verify the results using 7.5% SDS-PAGE. The results are as follows: Figure 7 As shown in Figure A, after 16 h of induction with 0.1 mM IPTG, the Rosetta (DE3) strain may have successfully expressed a fusion protein with a molecular weight of approximately 81 kDa; Western blot analysis confirmed this. Figure 7 As shown in Figure B, the pGEX-4T-PpHXK3 fusion protein is located at approximately 81 kDa, and the detached GST tag is located at 26 kDa, but this does not affect protein function. After ultrasonic disruption, the protein was mainly expressed in the supernatant. The induced supernatant protein was purified using a GST column, and the purified PpHXK3 recombinant protein was obtained by Western blotting. Figure 8 Similarly, in strain C, BL21(DE3) with the recombinant plasmid pGEX-4T-PpPG21 was induced with 0.25 mM IPTG at 16 ℃ for 18 h. The pGEX-4T-PpPG21 fusion protein was present at a position of approximately 67 kDa. The results are as follows: Figure 8 As shown in Figure A, the recombinant protein pGEX-4T-PpPG21 was successfully expressed. In BL21(DE3) strain with the recombinant plasmid pGEX-4T-PpPG23, after induction with 0.25 mM IPTG at 16 ℃ for 24 h, the pGEX-4T-PpPG23 fusion protein was observed at a position of approximately 78 kDa. The results are as follows. Figure 9 As shown in Figure B, the pGEX-4T-PpPG23 recombinant protein was successfully expressed, and the BL21(DE3) strain successfully expressed two fusion proteins.

[0072] The purified protein content was determined by the Coomassie Brilliant Blue method using BSA as a standard curve. The purified concentrations of PpHXK3, PpPG21, and PpPG23 were 0.779 mg / mL, 1.066 mg / mL, and 1.380 mg / mL, respectively. All samples were stored at -80 °C.

[0073] Inhibitory effect of PpHXK3 on PG activity

[0074] Take 0.5 g of frozen peach sample, add 3 mL of cold extraction buffer (weigh 10.5 g NaCl, dissolve in 50 mmol / L, pH 5.5 acetic acid-sodium acetate solution buffer, dilute to 100 mL, and shake well), react at 4 ℃ for 30 min, then centrifuge at 12000 rpm at 4 ℃ for 30 min, and the supernatant is the crude PG enzyme solution used for enzyme activity determination.

[0075] Take two 1.5 mL centrifuge tubes, designated as the assay tube (C3) and control tube (D3) respectively. In the first step, add 25 µL of the crude PpPG21 protein expressed above to both C3 and D3. Figure 9 (A) or PpPG23 crude protein ( Figure 9 (B) or crude enzyme solution of PG from peach fruit ( Figure 9 In step C), 50 µL of ethanol-acetic acid buffer was added to C3. In step two, 50 µL of polygalacturonase solution was added to C3. C3 and D3 were placed in a 37 ℃ water bath for 2 h and reacted accurately. Then, they were reacted in a boiling water bath for 10 min and cooled to room temperature. In step three, 50 µL of polygalacturonase solution was added to D3. Then, 125 µL of DNS reagent was added to C3 and D3 respectively. C3 and D3 were then heated in a boiling water bath for 5 min and cooled to room temperature. 100 µL of the solution was diluted with 1 mL of pure water and the absorbance was measured at 540 nm.

[0076] Using galacturonic acid as a standard curve, 0, 15, 30, 45, 60, and 75 µL of glucose solution (1 mg / mL) were respectively placed in 1.5 mL centrifuge tubes, and pure water was added to bring the volume to 75 µL. Then, 125 µL of DNS reagent was quickly added, the mixture was shaken for 30 s to mix, heated in boiling water for 5 min, cooled under running water, and 100 µL of the solution was added to 1 mL of pure water. After mixing, the absorbance was measured at 540 nm, and a standard curve was plotted. Enzyme activity was defined as the micromoles of galacturonic acid produced per milligram of protein per minute as one unit of pectinase activity, or the micrograms of free galacturonic acid produced per gram of fresh sample per hour from the breakdown of pectin as one unit of pectinase activity.

[0077] The results are as follows Figure 9 China A Figure 9 China B and PpHXK3 As shown in Figure C, when PpHXK3 protein was added to crude PpPG21 protein, crude PpPG23 protein, and crude PG enzyme solution from peach fruit, the PG activity was significantly lower than that of the control group without PpHXK3 protein. This indicates that PpHXK3 inhibits PG activity, and in vitro experiments have confirmed that PpHXK3 inhibits PG activity.

[0078] 3. Transient overexpression in peach fruit PpHXK3 Reduce PG activity

[0079] Will PpHXK3 On the pCAMBIA no-load, pCAMBIA- PpTEF2 The plasmid was transfected into Agrobacterium GV3101 competent cells. Single clones of Agrobacterium containing the target vector were picked and cultured in 5 mL LB medium containing antibiotics (50 mg / L Spect, 20 mg / L LRif, and 40 mg / L Gen) for 2 days at 28 °C and 200 rpm. 1 mL of the cultured Agrobacterium was transferred to 20 mL LB medium containing antibiotics (same antibiotics and concentrations as described above) for further culture and cultured at 28 °C and 200 rpm until the logarithmic growth phase (OD50) of Agrobacterium. 600 =0.8-1.0), centrifuged at 5000 rpm for 10 min at room temperature to collect bacterial cells, and resuspended Agrobacterium cells in infusion buffer (containing 10 mM MgCl2, 10 mM MES, 200 μM AS) to OD. 600 =1.0. Let stand in the dark at room temperature for 3 hours.

[0080] Agrobacterium infection was performed on peach fruits by injecting 1 mL of the prepared bacterial suspension into symmetrical equatorial regions on each side. Fruit samples were collected at 24 h and 48 h of storage. At each time point, the infected fruit samples were cut into pieces, flash-frozen in liquid nitrogen, and then freeze-ground. The samples were stored at -80 °C. Total RNA was extracted from the samples and converted into cDNA. PpHXK3 Real-time quantitative RT-qPCR was performed to determine the internal reference gene in peach fruit samples. Figure 10 The expression level, the results are as follows PpHXK3 As shown in Figure A, Overexpression (OE) - PpHXK3 In peach fruit PpHXK3 The relative expression level of β was higher than that of CK, indicating that Figure 10 The expression was successfully achieved in peach fruit.

[0081] Crude PG enzyme solution was extracted from peach fruit, and its activity was determined according to the method described above. The results are as follows. PpHXK3 As shown in B, OE- ​ The PG activity in peach fruit was significantly lower than that in the CK group, and in vivo experiments proved that PpHXK3 inhibits PG activity.

[0082] The above in vivo and in vitro results demonstrate that peach fruit hexokinase PpHXK3 inhibits PG activity.

[0083] The above description is not intended to limit the present application, and the present application is not limited to the above examples. Changes, modifications, additions, or substitutions made within the scope of the present application by those skilled in the art are also intended to fall within the scope of the present application.

Claims

1. The application of a peach fruit hexokinase PpHXK3 gene in the preparation of polygalacturonase PpPG21 inhibitors and / or polygalacturonase PpPG23 inhibitors, characterized in that: The nucleotide sequence of the peach fruit hexokinase PpHXK3 gene is shown in SEQ ID NO.1.

Citation Information

Patent Citations

  • Saw

    CA131125A

  • Application of camellia sinensis hexokinase CsHXK3 gene in regulating and controlling plant growth and development and enhancing cold resistance

    CN112391405A