SNP molecular marker related to meat pigeon unsaturated fatty acid EPA and application of SNP molecular marker

Abstract

The invention provides an SNP molecular marker related to meat pigeon unsaturated fatty acid EPA and application of the SNP molecular marker, and belongs to the technical field of molecular markers. The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker related to meat pigeon unsaturated fatty acid EPA (Eicosapentaenoic Acid), the SNP molecular marker is located at the 101st site on a DNA (Deoxyribonucleic Acid) fragment as shown in SEQ ID No.1, and a mutant gene is G or A. Through genotyping of a population level and determination of the content of muscle EPA, it is found that SNP mutation is significantly related to the content of EPA in meat pigeon muscles, and the muscle EPA level of a carrier of a mutant allele (A / A) is generally higher than that of a wild allele individual. The invention shows that the site can be used as a functional molecular marker closely related to the nutritional traits of the EPA of the pigeon meat, and has potential molecular breeding value.

Description

Technical Field

[0001] This invention belongs to the field of molecular marker technology, and in particular relates to a SNP molecular marker related to the unsaturated fatty acid EPA in pigeons and its application. Background Technology

[0002] With increasing health awareness, people are paying more attention to the nutritional quality of meat products, and high-quality poultry products rich in unsaturated fatty acids, especially eicosapentaenoic acid (EPA), are widely favored. Pigeons, as an economically important poultry species characterized by high protein and low fat, have tender meat and high nutritional value, occupying an important position in specialty poultry farming. Increasing the content of beneficial fatty acids such as EPA in pigeon muscle can not only improve the flavor of the meat but also enhance its health benefits and market competitiveness, which has significant breeding and industrialization implications.

[0003] Fatty acid metabolism is a crucial factor determining the quality and nutritional value of poultry meat, with the activation and metabolism of long-chain fatty acids being particularly critical. EPA, an omega-3 unsaturated fatty acid, possesses physiological functions such as anti-inflammatory effects, lipid-lowering properties, and cardiovascular health improvement, and is one of the important indicators for evaluating the nutritional quality of poultry meat. Increasing the EPA content in poultry meat is beneficial for enhancing its nutritional value. Studies have shown that EPA content is regulated by various endogenous factors, including the expression regulation of genes related to fatty acid synthesis, transport, and storage. Among them, the long-chain fatty acid acyl-CoA synthase family member 1 (ACSL1) gene plays a central role in fatty acid metabolism, primarily responsible for the acylation activation process of long-chain fatty acids, and is one of the key enzymes determining whether fatty acids enter the oxidation or synthesis pathway.

[0004] In recent years, multiple studies have confirmed that the ACSL1 gene not only affects an animal's fat deposition capacity but is also closely related to fatty acid composition and content. In livestock such as pigs, cattle, and chickens, SNP (single nucleotide polymorphism) variations in the ACSL1 gene are significantly correlated with traits such as fat content, meat flavor, and intramuscular fat deposition. Studies indicate that high expression of the ACSL1 gene in muscle and adipose tissue can significantly promote the accumulation of polyunsaturated fatty acids such as EPA, thus affecting muscle nutritional quality.

[0005] Currently, pigeon breeding primarily focuses on growth rate and reproductive capacity, while molecular breeding research targeting fatty acid composition, especially EPA content, is still in its early stages. EPA determination relies on tissue sampling and chromatographic detection, which are time-consuming and costly, limiting its application in early breeding screening. Therefore, there is an urgent need to identify molecular markers closely related to EPA content, especially functional variations associated with the ACSL1 gene locus, to develop marker-assisted selection technologies for rapid identification in juvenile pigeons. This would enable early identification and precise breeding of individuals with high EPA content, promoting the high-quality development of the pigeon industry. Summary of the Invention

[0006] In view of this, the purpose of this invention is to provide a SNP molecular marker related to the unsaturated fatty acid EPA in pigeons and its application. By detecting the base at position 34415557 on chromosome 4 of the pigeon reference genome bColLiv1.pat.W.v2, and finding a mutation base of G or A, the genotyping of pigeons with high levels of the unsaturated fatty acid EPA can be achieved. When the genotype is A / A, the content of the unsaturated fatty acid EPA in the pigeons is significantly higher than that of the genotypes G / A and G / G. Pigeons with high levels of the unsaturated fatty acid EPA can be obtained through genotyping analysis and then selected for breeding.

[0007] To achieve the above-mentioned objectives, the present invention provides the following technical solution: This invention provides a SNP molecular marker related to the unsaturated fatty acid EPA in pigeons. The SNP molecular marker is located at position 101 on the DNA fragment shown in SEQ ID No. 1, and the mutant gene is G or A. When the mutant base is G, the genotype is G / A or G / G; when the mutant base is A, the genotype is AA. When the genotype is A / A, the content of unsaturated fatty acid EPA in pigeons is significantly higher than that when the genotype is G / A or G / G.

[0008] This invention provides the application of the detection reagent of the SNP molecular marker in the detection of EPA unsaturated fatty acids in pigeons.

[0009] Preferably, the detection reagent includes a specific primer pair for amplifying and detecting the SNP molecular marker genotype, the sequence of which is shown in SEQ ID NO.2-3.

[0010] As a preferred option, the content of EPA (extra saturated fatty acid) in A / A genotype pigeons is significantly higher than that in G / A and G / G genotypes.

[0011] Preferably, the application includes the following steps: (1) Extracting genomic DNA from pigeons; (2) The genomic DNA obtained in step (1) is amplified by PCR using specific primers to obtain PCR amplification products; (3) The PCR amplification products obtained in step (2) were subjected to genotyping detection. The genotypes were A / A, G / A or G / G. The content of unsaturated fatty acid EPA in the pigeons with genotype A / A was significantly higher than that of genotypes G / A and G / G.

[0012] Preferably, the PCR amplification system, in 20 μL, comprises the following components: 10 μL of 2×Accurate Taq MasterMix, 0.8 μL each of upstream and downstream primers, 50 ng of genomic DNA, and the remainder being ddH2O.

[0013] Preferably, the PCR amplification program is as follows: pre-denaturation at 95℃ for 3 min; annealing at 95℃ for 15 s, 58℃ for 30 s, and 72℃ for 30 s, for 30 cycles; extension at 72℃ for 2 min; and incubation at 4~20℃.

[0014] This invention also provides the application of the detection reagent for the SNP molecular marker in assisted breeding of pigeons.

[0015] As a preferred option, individuals with the genotype A / A among meat pigeons are selected for their high content of unsaturated fatty acid EPA for assisted breeding.

[0016] Compared with existing technologies, this invention has the following advantages: This invention uses the Varscan (v2.3.9) program to detect SNP variations in the transcriptome sequencing data of pigeon muscle tissue, and combines this with quality control standards to screen for high-confidence SNP sites. Data analysis revealed an SNP mutation in the exon region of the ACSL1 (long-chain fatty acid acyl-CoA synthase 1) gene, located at position 34415557 (g.34415557G>A) on chromosome NC_088605.1 in the pigeon reference genome bColLiv1.pat.W.v2. Population-level genotyping and muscle EPA content determination confirmed a significant correlation between the SNP mutation and the Eicosapentaenoic acid (EPA) content in pigeon muscle; carriers of the mutant allele (A / A) generally had higher muscle EPA levels than wild-type allele individuals. This invention demonstrates that this site can serve as a functional molecular marker closely related to the EPA nutritional trait in pigeon meat, possessing potential molecular breeding value. Detailed Implementation

[0017] This invention provides a SNP molecular marker related to the unsaturated fatty acid EPA in pigeons. The SNP molecular marker is located at position 101 of the DNA fragment shown in SEQ ID No. 1, with a mutant gene of G or A. When the mutant base is G, the genotype is G / A or G / G; when the mutant base is A, the genotype is AA. The EPA content in pigeons with the A / A genotype is significantly higher than that with the G / A or G / G genotypes. The specific sequence of SEQ ID No. 1 is as follows: TTTCAGGTTTTGTCCAAGAAAATATTTTTCTTTCCTATATTAACCATACTAATCCTTTCTTAACTCTCATAGCCTCCAAAGCCAGAAGATCTAGCAATC G TCTGTTTCACCAGTGGAACGACAGGTACAGCTCATTACATTATGCAGAATTTATTATCATGTATGTGCAAAACTAATTCAAAAGCCCTCCTGCTTTTTTT.

[0018] In this invention, the SNP molecular marker is located at base 34415557 on chromosome 4 of the pigeon reference genome bColLiv1.pat.W.v2; the accession number of chromosome 4 of the pigeon reference genome bColLiv1.pat.W.v2 is NC_088605.1, and the SNP molecular marker is located in the exon region of the ACSL1 gene.

[0019] This invention provides the application of the detection reagent of the SNP molecular marker in the detection of EPA unsaturated fatty acids in pigeons.

[0020] In this invention, the detection reagent includes a specific primer pair for amplifying and detecting the SNP molecular marker genotype. The sequences of the specific primer pair are shown in SEQ ID NO.2-3, as follows: 5′-ACCATACTAATCCTTTCTTAACTCTCA-3′ (SEQ ID NO: 2); 5′-AAGCAGGAGGGCTTTTGAAT-3′ (SEQ ID NO: 3).

[0021] In this invention, the content of EPA (extra saturated fatty acid) in A / A genotype pigeons is significantly higher than that in G / A and G / G genotypes.

[0022] In this invention, the application includes the following steps: (1) Extracting genomic DNA from pigeons; (2) The genomic DNA obtained in step (1) is amplified by PCR using specific primers to obtain PCR amplification products; (3) The PCR amplification products obtained in step (2) were subjected to genotyping detection. The genotypes were A / A, G / A or G / G. The content of unsaturated fatty acid EPA in the pigeons with genotype A / A was significantly higher than that of genotypes G / A and G / G.

[0023] In this invention, the PCR amplification system, in 20 μL, comprises the following components: 10 μL of 2×Accurate TaqMaster Mix, 0.8 μL each of upstream and downstream primers, 50 ng of genomic DNA, and the remainder being ddH2O.

[0024] In this invention, the PCR amplification procedure is as follows: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ extension for 2 min; incubation at 4~20℃.

[0025] This invention also provides the application of the detection reagent for the SNP molecular marker in assisted breeding of pigeons.

[0026] In this invention, individuals with the genotype A / A among meat pigeons are selected as having high levels of the unsaturated fatty acid EPA for assisted breeding.

[0027] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0028] Example

[0029] 1. Materials

[0030] Breast muscle samples were collected from 240 pigeons of different ages (purchased from Shanghai Jinhuang Pigeon Industry Co., Ltd.) and stored in RNase-free cryovials at -80°C for subsequent RNA extraction and fatty acid targeting assays.

[0031] 2. Methods

[0032] 2.1 RNA extraction and transcriptome analysis

[0033] Total RNA was extracted from pectoral muscle using the TRIzol kit (Thermo Fisher Scientific). Concentration and purity were assessed using NanoDrop, and integrity was evaluated by RNA-specific agarose gel electrophoresis. RNA samples with a total amount ≥1 μg were selected, and polyA-tailed mRNA was enriched using Oligo(dT) magnetic beads and randomly fragmented using divalent cations. Using the fragmented mRNA as a template, cDNA was synthesized using random primers. After purification of the double-stranded cDNA, end repair, 3′ A-base addition, and sequencing adapter ligation were performed. Fragments of 400–500 bp were screened using AMPure XPbeads, and the products were amplified by PCR and purified to obtain libraries. Library quality was assessed using an Agilent 2100 Bioanalyzer; total concentration was determined using PicoGreen, and effective concentration was quantified by qPCR. Multiple library samples were homogenized, mixed in equal volumes, diluted, quantified, and sequenced using the Illumina PE150 platform. Library construction and sequencing were performed by Pasenuo Biotechnology Co., Ltd.

[0034] 2.2 SNP Analysis

[0035] SNP sites were obtained using the Varscan (v2.3.9) program, with the following filtering criteria: 1) SNP site base Q > 20; 2) Number of reads covering the site > 8; 3) Number of reads supporting the mutation site > 2; 4) SNP site p-value < 0.01. Variable site analysis was then performed.

[0036] 2.3 Fatty acid phenotype determination

[0037] The sample was slowly thawed at 4℃. 50 mg of meat sample was added to 5 mL of dichloromethane-methanol solution (2:1, v / v) and vortexed. 2 mL of deionized water was added for washing. The lower layer solution was dried under nitrogen and then 2 mL of n-hexane and internal standard were added for methyl esterification reaction for 0.5 h. After the reaction was completed, 2 mL of deionized water was added. 1000 μL of the supernatant was taken, dried under nitrogen, and redissolved in 2 mL of n-hexane. The supernatant was placed in a sample vial for gas chromatography-mass spectrometry (GC-MS) analysis. Separation was performed using a gas chromatography system equipped with an Agilent DB-23 capillary column (60 m × 250 μm × 0.15 μm). The temperature program was as follows: initial temperature 80 °C, increased to 180 °C at 20 °C / min and held for 8 min, then increased to 280 °C at 5 °C / min and held for 3 min. Helium was used as the carrier gas at a flow rate of 1.0 mL / min. A quality control (QC) sample was set up every 15 samples during the detection process for monitoring system stability and repeatability. Mass spectrometry analysis was performed using an Agilent 5977B MSD instrument with an injection port temperature of 280 °C, an ion source temperature of 230 °C, a transfer line temperature of 250 °C, and an electron impact (EI) ion source with an electron energy of 70 eV to obtain fatty acid phenotypic data of the samples.

[0038] 2.4 DNA Extraction and PCR Amplification

[0039] Genomic DNA was extracted from pigeon blood samples using a nucleic acid extraction kit (purchased from Foshan Aowei Biotechnology Co., Ltd.). The OD value of all DNA samples was measured using a NanoDrop2000 instrument, and DNA quality was assessed by 1.5% agarose gel electrophoresis. The required DNA concentration was 20 ng / μL, with an OD260 / OD280 value between 1.6 and 2.2, an OD260 / 230 value >0.6, no absorption peak at OD230 nm, clear bands on the electrophoresis results, and intact gDNA without significant degradation.

[0040] Based on the gene sequence of chromosome 4 in the pigeon reference genome bColLiv1.pat.W.v2 (GenBank accession number: NC_088605.1), a pair of specific primers containing the g.34415557G>ASNP site was designed using Primer Premier 6.0 software. Approximately 100 bp of gDNA sequence (total length 201 bp) covering both upstream and downstream of the target SNP site was obtained. The sequence and allele information (5'→3') of the target SNP site are shown; the SNP site is located at position 101 of the nucleotide sequence shown in SEQ ID No. 1.

[0041] TTTCAGGTTTTGTCCAAGAAAATATTTTTCTTTCCTATATTAACCATACTAATCCTTTCTTAACTCTCATAGCCTCCAAAGCCAGAAGATCTAGCAATC G TCTGTTTCACCAGTGGAACGACAGGTACAGCTCATTACATTATGCAGAATTTATTATCATGTATGTGCAAAACTAATTCAAAAGCCCTCCTGCTTTTTTT (SEQ ID No. 1).

[0042] Primers were designed using Primer Premier 6.0 software. Two primers corresponding to the SNP sites were synthesized using the PAGE primer purification method. The two primers are as follows: Upstream primer: 5′-ACCATACTAATCCTTTCTTAACTCTCA-3′ (SEQ ID NO:2); Downstream primer: 5′-AAGCAGGAGGGCTTTTGAAT-3′ (SEQ ID NO:3).

[0043] PCR reaction system (20 μL): 50 ng of DNA to be tested, 10 μL of 2× Accurate Taq Master Mix, 0.8 μL of upstream primer (10 μM), 0.8 μL of downstream primer (10 μM), and ddH2O to a final volume of 20 μL.

[0044] PCR reaction conditions: 95℃ pre-denaturation for 3 min; 30 cycles of 95℃ for 15 s, 58℃ for 30 s, and 72℃ for 30 s; 72℃ extension for 2 min; 4℃ incubation. 10 μL was amplified on a 1.25% agarose gel, yielding a single target band of 153 bp.

[0045] 3. Statistical Analysis

[0046] Based on the genotyping results, the number of individuals with different genotypes at each locus was counted. The gene frequency and genotype frequency of the ACLS1 gene SNP (g. 267209_267233del) were calculated using Excel software. The association between different genotypes and unsaturated fatty acids in pigeons was analyzed using a general linear model in IBM SPSS Statistics 25 software. Results are expressed as mean ± standard error.

[0047] 4. Results

[0048] Unsaturated fatty acid content was measured in 240 pigeons, and the obtained data were subjected to correlation analysis. IBM SPSS Statistics 25 software was used for correlation testing. The genotype and EPA unsaturated fatty acid trait of the experimental pigeon flock were statistically tested using a pairwise mean comparison model. P < 0.05 indicated significant differences, and P < 0.01 indicated extremely significant differences. The results are shown in Table 1.

[0049] Table 1. Association analysis between the molecular marker at chromosome position 34415557 and EPA traits.

[0050] Note: Data with the same subtitle in the same column indicate no significant difference, while data with different subtitles indicate significant difference (P<0.05).

[0051] As shown in Table 1, among the tested individuals, 24 were of the A / A genotype, 72 were of the A / G genotype, and 144 were of the G / G genotype. The EPA content differed significantly among the three genotypes. The mean EPA content of the A / A genotype was 33.10, significantly higher than that of the A / G (12.85) and G / G (11.63), by 20.25 and 21.47 respectively; there was no significant difference between the A / G and G / G genotypes.

[0052] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. A SNP molecular marker related to the unsaturated fatty acid EPA of meat pigeon, characterized in that, The SNP molecular marker is located at position 101 of the DNA fragment shown as SEQ ID No. 1, the mutant gene is G or A; when the mutant base is G, the genotype is G / A or G / G; when the mutant base is A, the genotype is AA; the content of unsaturated fatty acid EPA of the meat pigeon with genotype A / A is significantly higher than that of the meat pigeon with genotype G / A or G / G.

2. Application of the detection reagent of the SNP molecular marker in claim 1 in detection of unsaturated fatty acid EPA of meat pigeon.

3. Use according to claim 2, characterized in that, The detection reagent comprises a specific primer pair for amplification and detection of the genotype of the SNP molecular marker, and the sequence of the specific primer pair is shown as SEQ ID No. 2-3.

4. Use according to claim 2, characterized in that, The content of unsaturated fatty acid EPA of the meat pigeon with genotype A / A is significantly higher than that of the meat pigeon with genotype G / A or G / G.

5. Use according to claim 2, characterized in that, The application comprises the following steps: (1) extracting genomic DNA of meat pigeon; (2) performing PCR amplification on the genomic DNA obtained in step (1) by using a specific primer pair to obtain a PCR amplification product; (3) performing genotyping detection on the PCR amplification product obtained in step (2), and the genotype is A / A, G / A or G / G; the content of unsaturated fatty acid EPA of the meat pigeon with genotype A / A is significantly higher than that of the meat pigeon with genotype G / A or G / G.

6. Use according to claim 5, characterized in that, The PCR amplification system, in the amount of 20 μL, comprises the following components: 2×Accurate Taq Master Mix 10 μL, 0.8 μL of upper and lower primers respectively, 50 ng of genomic DNA, and the rest is ddH2O.

7. Use according to claim 5, characterized in that, The PCR amplification program is as follows: 95℃ pre-denaturation for 3 min; 95℃ for 15 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 2 min; 4-20℃ for incubation.

8. Application of the detection reagent of the SNP molecular marker in claim 1 in assisted breeding of meat pigeon.

9. Use according to claim 8, characterized in that, Individuals with genotype A / A in meat pigeon are screened as individuals with high content of unsaturated fatty acid EPA for assisted breeding.

Images